Protein variant and method for producing l-isoleucine by using same

A novel protein variant with specific amino acid substitutions in the ThrA protein, when used in Corynebacterium microorganisms, enhances L-amino acid production, addressing the challenge of increased yield in existing technologies.

WO2026071848A1PCT designated stage Publication Date: 2026-04-02CJ CHEILJEDANG CORP
View PDF 10 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-30
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Existing technologies face challenges in increasing the production capacity of L-amino acids, necessitating improved methods for enhancing the efficiency of L-amino acid production.

Method used

A novel protein variant with specific amino acid substitutions in the ThrA (Aspartokinase) protein of Corynebacterium, combined with a microorganism containing this variant, is used to enhance L-amino acid production through culturing in a medium.

Benefits of technology

The protein variant significantly increases the yield of L-amino acids compared to conventional microorganisms, demonstrating improved production capacity.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure relates to: a protein variant; a polynucleotide encoding the protein variant; a microorganism of the genus Corynebacterium, the microorganism comprising at least one selected from the group consisting of the protein variant and the polynucleotide; and a method for producing L-isoleucine by using the microorganism.
Need to check novelty before this filing date? Find Prior Art

Description

Protein variant and method for producing L-amino acid using the same

[0001] The present disclosure relates to a novel protein variant, a microorganism of the genus Corynebacterium comprising the protein variant, and a method for producing L-amino acids using the microorganism.

[0002] Various studies are being conducted to develop high-efficiency production microorganisms and fermentation process technologies for the production of L-amino acids and other useful substances. For example, target substance-specific approaches, such as increasing the expression of genes encoding enzymes involved in L-threonine biosynthesis or removing genes unnecessary for biosynthesis, are mainly used (WO2008-013428 A1).

[0003] However, due to the increasing demand for L-amino acids, research is still needed to effectively increase the production capacity of L-amino acids.

[0004]

[0005] The problem to be solved by the present disclosure is to provide a protein variant comprising an amino acid sequence in which, in the amino acid sequence of SEQ ID NO. 12, the amino acid corresponding to the 58th position from the N-terminus is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), the amino acid corresponding to the 710th position is substituted with aspartic acid (D), the amino acid corresponding to the 784th position is substituted with cysteine ​​(C), or a combination thereof; a polynucleotide encoding the protein variant; and a microorganism of the genus Corynebacterium comprising one or more selected from the group consisting of the protein variant and the polynucleotide encoding the protein variant; and a method for producing L-amino acids comprising the step of culturing the microorganism in a medium. and the above protein variant, polynucleotide, or microorganism is used for the production of L-amino acids.

[0006]

[0007] One objective of the present disclosure is to provide a novel protein variant.

[0008] Another object of the present disclosure is to provide a polynucleotide encoding the protein variant.

[0009] Another object of the present disclosure is to provide a microorganism of the genus Corynebacterium comprising one or more selected from the group consisting of the protein variant and the polynucleotide encoding it.

[0010] Another object of the present disclosure is to provide a method for producing L-amino acids, comprising the step of culturing the microorganism in a medium.

[0011]

[0012] When culturing a microorganism of the genus Corynebacterium containing the novel protein variant of the present disclosure, it is possible to produce L-amino acid in a high yield compared to a microorganism having a conventional unmodified polypeptide.

[0013]

[0014] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this disclosure may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure should not be considered limited by the specific descriptions provided below. Additionally, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the state of the art to which the present invention pertains and the content of the present invention.

[0015]

[0016] One aspect of the present disclosure provides a protein variant comprising an amino acid sequence in which one or more amino acids selected from the group consisting of the amino acid corresponding to the 58th position from the N-terminus, the amino acid corresponding to the 352nd position, the amino acid corresponding to the 433rd position, the amino acid corresponding to the 521st position, the amino acid corresponding to the 710th position, and the amino acid corresponding to the 784th position in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original.

[0017]

[0018] In the present disclosure, the sequence of SEQ ID NO. 12 is as shown in Table 1 below.

[0019] 단백질명(gene ID,gene name)서열 (N-말단 → C-말단)서열번호ThrA (Aspartokinase)MRVLKFGGTSVANAERFLRVADILESNARQGQVATVLSAPAKITNHLVAMIEKTISGQDALPNISDAERIFAELLTGLAAAQPGFPLAQLKTFVDQEFAQIKHVLHGISLLGQCPDSINAALICRGEKMSIAIMAGVLEARGHNVTVIDPVEKLLAVGHYLESTVDIAESTRRIAASRIPADHMVLMAGFTAGNEKGELVVLGRNGSDYSAAVLAACLRADCCEIWTDVDGVYTCDPRQVPDARLLKSMSYQEAMELSYFGAKVLHPRTITPIAQFQIPCLIKNTGNPQAPGTLIGASRDEDELPVKGISNLNNMAMFSVSGPGMKGMVGMAARVFAAMSRARISVVLITQSSSEYSISFCVPQSDCVRAERAMQEEFYLELKEGLLEPLAVTERLAIISVVGDGMRTLRGISAKFFAALARANINIVAIAQGSSERSISVVVNNDDATTGVRVTHQMLFNTDQVIEVFVIGVGGVGGALLEQLKRQQSWLKNKHIDLRVCGVANSKALLTNVHGLNLENWQEELAQAKEPFNLGRLIRLVKEYHLLNPVIVDCTSSQAVADQYADFLREGFHVVTPNKKANTSSMDYYHLLRHAAEKSRRKFLYDTNVGAGLPVIENLQNLLNAGDELMKFSGILSGSLSYIFGKLDEGMSFSEATTLAREMGYTEPDPRDDLSGMDVARKLLILARETGRELELADIEIEPVLPAEFNAEGDVAAFMANLSQLDDLFAARVAKARDEGKVLRYVGNIDEDGACRVKIAEVDGNDPLFKVKNGENALAFYSHYYQPLPLVLRGYGAGNDVTAAGVFADLLRTLSWKLGV.12

[0020] In one embodiment, the protein variant of the present disclosure described above may essentially consist of an amino acid sequence in which the amino acid corresponding to the 352nd position from the N-terminus, the amino acid corresponding to the 433rd position, and the amino acid corresponding to the 521st position in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original.

[0021] In another embodiment, the protein variant of the present disclosure described above may consist of an amino acid sequence in which one or more amino acids selected from the group consisting of the amino acid corresponding to the 352nd position from the N-terminus, the amino acid corresponding to the 433rd position, and the amino acid corresponding to the 521st position in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original.

[0022] In another embodiment, the protein variant of the present disclosure described above may consist of an amino acid sequence in which one or more amino acids selected from the group consisting of the amino acid corresponding to the 58th position from the N-terminus, the amino acid corresponding to the 352nd position, the amino acid corresponding to the 433rd position, the amino acid corresponding to the 521st position, and the amino acid corresponding to the 710th position in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original.

[0023] In another embodiment, the protein variant of the present disclosure described above may consist of an amino acid sequence in which one or more amino acids selected from the group consisting of the amino acid corresponding to the 352nd position from the N-terminus, the amino acid corresponding to the 433rd position, the amino acid corresponding to the 521st position, and the amino acid corresponding to the 710th position in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original.

[0024] In another embodiment, the protein variant of the present disclosure described above may consist of an amino acid sequence in which one or more amino acids selected from the group consisting of the amino acid corresponding to the 58th position from the N-terminus, the amino acid corresponding to the 352nd position, the amino acid corresponding to the 433rd position, the amino acid corresponding to the 521st position, the amino acid corresponding to the 710th position, and the amino acid corresponding to the 784th position in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original.

[0025]

[0026] In the present disclosure, the amino acid sequence of SEQ ID NO. 12 may be the sequence of the ThrA (Aspartokinase) protein. In one embodiment, the protein may be a protein encoded by the thrA gene.

[0027]

[0028] In one embodiment, the amino acid corresponding to the 58th position from the N-terminus in the amino acid sequence of SEQ ID NO. 12 may be glutamine (Gln, Q), but is not limited thereto.

[0029] In another embodiment, the amino acid corresponding to the 352nd position from the N-terminus in the amino acid sequence of SEQ ID NO. 12 may be serine (Ser, S), but is not limited thereto.

[0030] In another embodiment, the amino acid corresponding to the 433rd position from the N-terminus in the amino acid sequence of SEQ ID NO. 12 may be glycine (Gly, G), but is not limited thereto.

[0031] In another embodiment, the amino acid corresponding to the 521st position from the N-terminus in the amino acid sequence of SEQ ID NO. 12 may be tryptophan (Trp, W), but is not limited thereto.

[0032] In another embodiment, the amino acid corresponding to the 710th position from the N-terminus in the amino acid sequence of SEQ ID NO. 12 may be asparagine (Asn, N), but is not limited thereto.

[0033] In another embodiment, the amino acid corresponding to the 784th position from the N-terminus in the amino acid sequence of SEQ ID NO. 12 may be tyrosine (Tyr, Y), but is not limited thereto.

[0034]

[0035] In one embodiment, the protein variant of the present disclosure may comprise an amino acid sequence in which the amino acid corresponding to the 58th position from the N-terminus is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), the amino acid corresponding to the 710th position is substituted with aspartic acid (D), the amino acid corresponding to the 784th position is substituted with cysteine ​​(C), or a combination thereof.

[0036] In another embodiment, the protein variant of the present disclosure may comprise an amino acid sequence in which the amino acid corresponding to the 352nd position from the N-terminus is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), and the amino acid corresponding to the 521st position is substituted with arginine (R).

[0037] In another embodiment, the protein variant of the present disclosure may comprise an amino acid sequence in which the amino acid corresponding to the 58th position from the N-terminus is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), and the amino acid corresponding to the 710th position is substituted with aspartic acid (D).

[0038] In another embodiment, the protein variant of the present disclosure may comprise an amino acid sequence in which the amino acid corresponding to the 352nd position from the N-terminus is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), and the amino acid corresponding to the 710th position is substituted with aspartic acid (D).

[0039] In another embodiment, the protein variant of the present disclosure may comprise an amino acid sequence in which the amino acid corresponding to the 58th position from the N-terminus is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), the amino acid corresponding to the 710th position is substituted with aspartic acid (D), and the amino acid corresponding to the 784th position is substituted with cysteine ​​(C).

[0040]

[0041] The protein variant of the present disclosure may have an activity that increases the L-amino acid production capacity compared to the wild-type protein (polypeptide).

[0042] The protein variant of the present disclosure comprises: an amino acid sequence in which the amino acids corresponding to positions 352, 433, and 521 from the N-terminus in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original; an amino acid sequence in which the amino acids corresponding to positions 58, 352, 433, 521, and 710 from the N-terminus in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original; and an amino acid sequence in which the amino acids corresponding to positions 352, 433, 521, and 710 from the N-terminus in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original. Alternatively, it may include an amino acid sequence in which the amino acids corresponding to positions 58, 352, 433, 521, 710, and 784 from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original, and an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.7% or more of homology or identity. Furthermore, it is obvious that a variant having an amino acid sequence in which some sequences are deleted, modified, substituted, conservedly substituted, or added is included within the scope of the present disclosure, provided that the amino acid sequence has such homology or identity and exhibits an efficacy (L-amino acid production increase efficacy) corresponding to the variant of the present disclosure.

[0043] For example, cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions that do not alter the function of the variant of the present disclosure at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0044] The aforementioned "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions have little to no effect on the activity of a protein or polypeptide.

[0045] In this disclosure, the term “variant” refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, resulting in a sequence of amino acids different from that of the variant prior to modification, while retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the capabilities of the variant may be increased, unchanged, or decreased compared to the polypeptide prior to modification. Additionally, some variants may include variants in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion of the N- and / or C-terminus of a mature protein has been removed. The term "variant" mentioned above may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited to these terms as long as they are used with the meaning of being mutated.

[0046] Additionally, the variant may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, a signal (or leader) sequence involved in co-translational or post-translational protein translocation may be conjugated to the N-terminus of the variant. Additionally, the variant may be conjugated with another sequence or linker to enable identification, purification, or synthesis.

[0047] In one embodiment, the protein variant of the present disclosure described above may have 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more and less than 100% homology or identity with the amino acid sequence of SEQ ID NO. 12. That is, the protein variant of the present disclosure described above may have 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more and less than 100% amino acid sequence identity with the amino acid sequence of SEQ ID NO. 12.

[0048]

[0049] Another aspect of the present disclosure provides a protein variant comprising any one amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NOs 15 to 18. In one embodiment, the protein variant may be a protein variant comprising the amino acid sequence of SEQ ID NOs 15, SEQ ID NOs 16, SEQ ID NOs 17, or SEQ ID NOs 18. In another embodiment, the variant of the present disclosure may essentially consist of the amino acid sequence of SEQ ID NOs 15, SEQ ID NOs 16, SEQ ID NOs 17, or SEQ ID NOs 18. In yet another embodiment, the variant of the present disclosure may consist of the amino acid sequence of SEQ ID NOs 15, SEQ ID NOs 16, SEQ ID NOs 17, or SEQ ID NOs 18.

[0050]

[0051] In the present disclosure, the amino acid sequence of SEQ ID NO. 15 may be the sequence of a protein variant in which the amino acid corresponding to the 352nd position of the protein (ThrA) encoded by the thrA gene is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), and the amino acid corresponding to the 521st position is substituted with arginine (R).

[0052] In the present disclosure, the amino acid sequence of SEQ ID NO. 16 may be the sequence of a protein variant in which the amino acid corresponding to the 58th position of the protein (ThrA) encoded by the thrrA gene is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), and the amino acid corresponding to the 710th position is substituted with aspartic acid (D).

[0053] In the present disclosure, the amino acid sequence of SEQ ID NO. 17 may be the sequence of a protein variant in which the amino acid corresponding to the 352nd position of the protein (ThrA) encoded by the thrrA gene is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), and the amino acid corresponding to the 710th position is substituted with aspartic acid (D).

[0054] In the present disclosure, the amino acid sequence of SEQ ID NO. 18 may be the sequence of a protein variant in which the amino acid corresponding to the 58th position of the protein (ThrA) encoded by the thrrA gene is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), the amino acid corresponding to the 710th position is substituted with aspartic acid (D), and the amino acid corresponding to the 784th position is substituted with cysteine ​​(C).

[0055]

[0056] Protein variants of the present disclosure may comprise any one amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NOs 15 to 18 (e.g., the amino acid sequence of SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, or SEQ ID NO. 18), or may comprise an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with said amino acid sequence. Furthermore, it is obvious that variants having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added are also included within the scope of the present disclosure, provided that such an amino acid sequence has such homology or identity and exhibits an efficacy (efficacy of increasing L-amino acid production) corresponding to that of the variants of the present disclosure.

[0057] For example, cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions that do not alter the function of the variant of the present disclosure at the N-terminus, C-terminus, and / or within the amino acid sequence.

[0058] In the above protein variants, conservative substitutions, variants, etc. are as described above.

[0059]

[0060] In this disclosure, the terms 'homology' or 'identity' refer to the degree of similarity between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0061] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.

[0062] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] (Including Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.

[0063] The homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0064] As an example of the present disclosure, the variant of the present disclosure described above may have an activity that increases the L-amino acid production capacity compared to a wild-type protein (polypeptide).

[0065] The above L-amino acid may be selected from the group consisting of L-threonine, L-isoleucine, O-acetyl L-homoserine, and L-glycine, but is not limited thereto.

[0066] In this disclosure, the term “corresponding to” refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to a residue listed in a polypeptide. Identifying the amino acid at the corresponding position may involve determining a specific amino acid of a sequence that references a specific sequence. As used in this disclosure, “corresponding region” generally refers to a similar or corresponding position in a related protein or a reference protein.

[0067]

[0068] For example, any amino acid sequence, an amino acid sequence in which the amino acids corresponding to the 352nd, 433rd, and 521st positions from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original,

[0069] An amino acid sequence in which the amino acids corresponding to positions 58, 352, 433, 521, and 710 from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original,

[0070] An amino acid sequence in which the amino acids corresponding to positions 352, 433, 521, and 710 from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original,

[0071] An amino acid sequence in which the amino acids corresponding to positions 58, 352, 433, 521, 710, and 784 from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original, or

[0072] Align with any one amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NOs 15 to 18 (e.g., the amino acid sequence of SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, or SEQ ID NO. 18), and

[0073] Based on this, each amino acid residue of the above amino acid sequence is an amino acid sequence in which the amino acids corresponding to the 352nd, 433rd, and 521st positions from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original,

[0074] An amino acid sequence in which the amino acids corresponding to positions 58, 352, 433, 521, and 710 from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original,

[0075] An amino acid sequence in which the amino acids corresponding to positions 352, 433, 521, and 710 from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original,

[0076] An amino acid sequence in which the amino acids corresponding to positions 58, 352, 433, 521, 710, and 784 from the N-terminus of the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original, or

[0077] Numbering can be done by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of any one amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NOs 15 to 18 (e.g., the amino acid sequence of SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, or SEQ ID NO. 18).

[0078] For example, a sequence alignment algorithm such as that described in the present disclosure can identify the location of an amino acid, or the location where modifications such as substitution, insertion, or deletion occur, by comparing it with a query sequence (also referred to as a "reference sequence").

[0079] For such alignment, examples such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) may be used, but are not limited thereto, and sequence alignment programs and pairwise sequence comparison algorithms known in the art may be appropriately used.

[0080]

[0081] Another aspect of the present disclosure is to provide a polynucleotide encoding a protein variant of the present disclosure.

[0082] In the present disclosure, the term “polynucleotide” refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, as a DNA or RNA strand of a certain length or longer, and more specifically, as a polynucleotide fragment encoding the variant.

[0083]

[0084] In one example, the polynucleotide is an amino acid sequence in which the amino acid corresponding to the 352nd position from the N-terminus, the amino acid corresponding to the 433rd position, and the amino acid corresponding to the 521st position in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original;

[0085] An amino acid sequence in which one or more amino acids selected from the group consisting of the amino acid corresponding to the 58th position from the N-terminus, the amino acid corresponding to the 352nd position, the amino acid corresponding to the 433rd position, the amino acid corresponding to the 521st position, and the amino acid corresponding to the 710th position are substituted with an amino acid different from the original;

[0086] An amino acid sequence in which, in the amino acid sequence of SEQ ID NO. 12, one or more amino acids selected from the group consisting of the amino acid corresponding to the 352nd position from the N-terminus, the amino acid corresponding to the 433rd position, the amino acid corresponding to the 521st position, and the amino acid corresponding to the 710th position are substituted with an amino acid different from the original; or

[0087] The polynucleotide encoding a protein variant comprising an amino acid sequence in which one or more amino acids selected from the group consisting of the amino acid corresponding to the 58th position from the N-terminus, the amino acid corresponding to the 352nd position, the amino acid corresponding to the 433rd position, the amino acid corresponding to the 521st position, the amino acid corresponding to the 710th position, and the amino acid corresponding to the 784th position in the amino acid sequence of SEQ ID NO. 12 are substituted with amino acids different from the original.

[0088] In one example, the polynucleotide may comprise a polynucleotide comprising any one nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs 22 to 25, such as the nucleotide sequences of SEQ ID NOs 22 to 25.

[0089] A polynucleotide encoding a protein variant of the present disclosure may have or include any one nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs 22 to 25, such as the nucleotide sequence of SEQ ID NOs 22, SEQ ID NOs 23, SEQ ID NOs 24, or SEQ ID NOs 25. In another example, the polynucleotide may include a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the nucleotide sequence. In addition, it is obvious that polynucleotides having nucleotide sequences in which some sequences are deleted, modified, substituted, conservatively substituted, or added, are included within the scope of the present disclosure, provided that the sequences have such homology or identity and encode a polypeptide or protein that exhibits efficacy (increased L-amino acid production) corresponding to the variants of the present disclosure.

[0090]

[0091] In one example, the nucleotide sequence or amino acid sequence provided in this specification may include one that has been modified by conventional mutagenesis, such as direct evolution and / or site-directed mutagenesis, to the extent that their original or intended function is maintained.

[0092] The polynucleotide of the present disclosure may have various modifications made to its coding region within a range that does not alter the amino acid sequence of the variant of the present disclosure, taking into account the degeneracy of the codons or the codons preferred by the organism intended to express the variant of the present disclosure. Specifically, the polynucleotide of the present disclosure may have or include a nucleotide sequence having homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% with any one nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NO. 22 to SEQ ID NO. 25 (e.g., nucleotide sequence of SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24, or SEQ ID NO. 25), or may be composed of or essentially composed of a nucleotide sequence having homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% with said nucleotide sequence, but is not limited thereto.

[0093] Additionally, the polynucleotides of the present disclosure may be included without limitation as long as they are probes that can be prepared from known gene sequences, for example, sequences that can be hybridized under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present disclosure. The term "stringent condition" means a condition that enables specific hybridization between polynucleotides. For example, conditions may be listed in which polynucleotides with high homology or identity are hybridized with each other, polynucleotides with homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and polynucleotides with lower homology or identity are not hybridized with each other, or conditions in which washing is performed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, such as 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS.

[0094] Hybridization requires that two nucleic acids have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term “complementary” is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present disclosure may also include isolated nucleic acid fragments that are complementary to the entire sequence as well as substantially similar nucleotide sequences.

[0095] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present disclosure can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.

[0096] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the relevant technical field.

[0097]

[0098] Another aspect of the present disclosure is to provide a vector comprising the polynucleotide of the present disclosure. The vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.

[0099] The vector of the present disclosure may comprise a DNA product comprising a sequence of a polynucleotide encoding said target polypeptide, which is operably linked to a suitable expression control region (or expression control sequence) so as to enable the expression of said target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.

[0100] The vectors used in this disclosure are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, or pDC24 vectors may be used.

[0101] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome insertion has occurred. The selection marker is intended to select cells transformed by the vector, that is, to confirm whether the target nucleic acid molecule has been inserted, and markers conferring selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of a surface polypeptide may be used. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.

[0102] In the present disclosure, the term “transformation” means introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by said polynucleotide can be expressed within the host cell. The transformed polynucleotide may include both inserted into and located within the chromosomes of the host cell and extrachromosomally, as long as it can be expressed within the host cell. Additionally, said polynucleotide includes DNA and / or RNA encoding the target polypeptide. said polynucleotide may be introduced in any form that can be introduced into and expressed within the host cell. For example, said polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. That expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to said polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

[0103] In addition, the term "operably connected" as above means that a promoter sequence and a polynucleotide sequence are functionally connected to initiate and mediate the transcription of a polynucleotide encoding the target variant of the present disclosure.

[0104]

[0105] Another aspect of the present disclosure provides a microorganism of the genus Corynebacterium comprising one or more selected from the group consisting of protein variants of the present disclosure and polynucleotides of the present disclosure.

[0106] The microorganism of the present disclosure may include a protein variant of the present disclosure, a polynucleotide encoding said protein variant, or a vector comprising the polynucleotide of the present disclosure.

[0107] In the present disclosure, the term “microorganism (or strain)” includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may be microorganisms in which specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the enhancement or inactivation of the activity of endogenous genes, and may be microorganisms that include genetic modification for the production of a desired polypeptide, protein, or product.

[0108] The microorganism of the present disclosure may be, but is not limited to, a microorganism comprising one or more of the protein variant of the present disclosure, the polynucleotide of the present disclosure, and a vector comprising the polynucleotide of the present disclosure; a microorganism modified to express a variant of the present disclosure or a polynucleotide of the present disclosure; a microorganism expressing a variant of the present disclosure or a polynucleotide of the present disclosure (e.g., a recombinant microorganism); or a microorganism having the activity of a variant of the present disclosure (e.g., a recombinant microorganism).

[0109] The microorganism of the present disclosure may be a microorganism capable of producing L-amino acids.

[0110] The microorganism of the present disclosure is a microorganism of the genus Corynebacterium that does not include one or more selected from the group consisting of the protein variant of the present disclosure described above and the polynucleotide encoding said protein variant (i.e., a protein variant comprising an amino acid sequence in which, in the amino acid sequence of SEQ ID NO. 12, the amino acid corresponding to the 58th position from the N-terminus is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), the amino acid corresponding to the 710th position is substituted with aspartic acid (D), the amino acid corresponding to the 784th position is substituted with cysteine ​​(C), or a combination thereof; or any one amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NO. 15 to SEQ ID NO. 18, for example, a protein comprising the amino acid sequence of SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, or SEQ ID NO. 18). Compared to a microorganism that does not express the variant, or a microorganism that expresses a wild-type protein corresponding to the protein variant, the L-amino acid production capacity may be increased.

[0111] The microorganisms of the present disclosure may be, but are not limited to, microorganisms that naturally possess the ability to produce L-amino acids, or microorganisms to which a variant of the present disclosure or a polynucleotide encoding the same (or a vector containing said polynucleotide) is introduced into a parent strain that lacks the ability to produce L-amino acids, and / or microorganisms to which the ability to produce L-amino acids is conferred.

[0112] For example, the microorganism of the present disclosure is a cell or microorganism that expresses the protein variant of the present disclosure by being transformed with a vector comprising the polynucleotide of the present disclosure or a polynucleotide encoding a variant of the present disclosure, and for the purposes of the present disclosure, the strain of the present disclosure may include all microorganisms capable of producing L-amino acids, including the variant of the present disclosure. For example, the microorganism of the present disclosure may be a recombinant microorganism in which the ability to produce L-amino acids is increased by introducing a polynucleotide encoding a variant of the present disclosure into a natural wild-type microorganism or a microorganism that produces L-amino acids.

[0113] In one embodiment, the microorganism of the present disclosure may have increased L-amino acid production capacity compared to a microorganism of the genus Corynebacterium that does not contain one or more selected from the group consisting of the protein variant of the present disclosure and the polynucleotide encoding said protein variant. The microorganism of the genus Corynebacterium that does not contain one or more selected from the group consisting of the protein variant of the present disclosure and the polynucleotide encoding said protein variant may be a natural wild-type microorganism or an unmodified microorganism, and may also be expressed as a parent strain.

[0114] In the present disclosure, the microorganism as a host cell (non-modified microorganism) may be (1) a microorganism that naturally has the ability to produce L-amino acids, (2) a microorganism that naturally has no or significantly less ability to produce L-amino acids, and / or (3) a microorganism into which a mutation is introduced (transformed) to the microorganism that naturally has the ability to produce L-amino acids or the microorganism that has no or significantly less ability to produce L-amino acids, thereby having the ability to produce L-amino acids or having an enhanced ability to produce L-amino acids. In one embodiment, the microorganism as a host cell may be the Corynebacterium glutamicum ATCC13032 strain, Corynebacterium glutamicum KCCM12502P (Korean Patent No. 10-2126951), Corynebacterium glutamicum KCCM12739P (Korean Patent No. 10-2363913), or Corynebacterium glutamicum KCCM12634P (Korean Patent No. 10-2182497), but is not limited thereto.

[0115] In one embodiment, the microorganism (a mutant microorganism or a microorganism as a host cell) may be a microorganism that has additionally enhanced the biosynthetic pathway of L-amino acids to increase the production of L-amino acids, but is not limited thereto.

[0116]

[0117] In one example, the microorganism may be a microorganism in which feedback inhibition of L-threonine dehydratase is released, feedback inhibition of homoserine dehydrogenase is released, and / or feedback inhibition of aspartate kinase is released.

[0118]

[0119] In one embodiment, the microorganism may be a microorganism in which the feedback inhibition of L-threonine dehydratase is released.

[0120] In the present disclosure, the term “threonine dehydratase (EC 4.3.1.19)” refers to an enzyme that produces 2-ketobutyrate from threonine, is encoded by the ilvA gene, and is known to be feedback inhibited by L-isoleucine. Microorganisms of the genus Corynebacterium synthesize L-isoleucine through three intermediate metabolites using pyruvate and 2-ketobutyrate as precursors. The amino acid sequence of the threonine dehydratase can be obtained from known databases such as NCBI’s GenBank or US 2023-0098971 A1, US 10982244 B2.

[0121]

[0122] In another embodiment, the microorganism may have the feedback inhibition of homoserine dehydrogenase released.

[0123] In the present disclosure, the term "homoserine dehydrogenase (EC:1.1.1.3)" refers to an enzyme encoded by the hom gene that catalyzes the synthesis of homoserine. Homoserrine dehydrogenase is known to be feedback inhibited by isoleucine. The amino acid sequence of the homoserrine dehydrogenase can be obtained from known databases such as NCBI's GenBank or US 10982244 B2.

[0124]

[0125] In one embodiment, the microorganism may have released feedback inhibition of aspartate kinase.

[0126] In the present disclosure, the term "aspartate kinase (EC: 2.7.2.4)" is encoded by the lysC gene, and the amino acid sequence of said aspartate kinase can be obtained from known databases such as NCBI’s GenBank or US 10662450 B2.

[0127]

[0128] In the present disclosure, the term feedback inhibition release may mean that the activity of a polypeptide, protein, or enzyme is increased or enhanced relative to its intrinsic activity, or that the activity is not inhibited relative to its intrinsic activity. In one embodiment, the microorganism may be a microorganism that additionally includes one or more of the following variants: additionally introducing a genetic variant (R407H) into the hom gene (US 10982244 B2), additionally introducing a genetic variant (T381A, F383A and / or V323A) into the ilvA gene (US 2023-0098971 A1, US 10982244 B2), and additionally introducing a genetic variant (L377K) into the lysC gene encoding aspartokinase (US 10662450 B2), but is not limited thereto.

[0129] In one embodiment, the microorganism of the present disclosure with increased L-amino acid production may have an L-amino acid production capacity increased by about 1% or more, about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 42.5% or more, about 42.75% or more, about 45% or more, or about 47.5% or more compared to the parent strain before mutation or the non-mutated microorganism (the upper limit is not specifically limited and may be, for example, about 200% or less, about 150% or less, about 100% or less, or about 50% or less), but is not limited thereto. In another embodiment, the microorganism of the present disclosure with increased L-amino acid production capacity may have an L-amino acid production capacity that is increased by about 1.01 times or more, about 1.1 times or more, about 1.2 times or more, about 1.3 times or more, about 1.4 times or more, about 1.425 times or more, about 1.4275 times or more, about 1.45 times or more, or about 1.475 times or more compared to the parent strain before mutation or the non-mutated microorganism, but is not limited thereto.

[0130] The above term “about” refers to a range that includes ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes, but is not limited to, all numerical values ​​within a range equivalent to or similar to the numerical value following the term “about.”

[0131]

[0132] In one embodiment, the microorganism of the present disclosure is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens, and more specifically, Corynebacterium glutamicum.

[0133]

[0134] In this disclosure, the term "weakening" of a polypeptide is a concept that includes both reduced activity and lack of activity relative to its intrinsic activity. Such weakening may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0135] The above weakening may include cases where the activity of the polypeptide itself is reduced or eliminated compared to the polypeptide activity originally possessed by the microorganism due to mutations in the polynucleotide encoding the polypeptide, etc.; cases where the overall polypeptide activity and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of gene expression of the polynucleotide encoding it or inhibition of translation into the polypeptide; cases where the expression of the polynucleotide does not occur at all; and / or cases where the polypeptide is not active even if the polynucleotide is expressed. The above "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type, or non-modified microorganism prior to the change in trait due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification." The statement that the activity of a polypeptide is "inactivated, deficient, reduced, downregulated, lowered, or attenuated" relative to its intrinsic activity means that the activity of a specific polypeptide has decreased compared to the activity originally possessed by the parent strain or non-modified microorganism prior to transformation.

[0136] The attenuation of the activity of such polypeptides can be performed by any method known in the art, but is not limited thereto, and can be achieved by the application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 et al.).

[0137] Specifically, the weakening of the polypeptide of the present disclosure is

[0138] 1) Deletion of all or part of the gene encoding a polypeptide;

[0139] 2) Modification of the expression regulatory region (or expression regulatory sequence) to reduce the expression of the gene encoding the polypeptide;

[0140] 3) Modification of the amino acid sequence constituting the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);

[0141] 4) Modification of the gene sequence encoding the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more nucleotides on the nucleotide sequence of the polypeptide gene to code for a polypeptide modified so as to remove or weaken the activity of the polypeptide);

[0142] 5) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0143] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide;

[0144] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the upstream end of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure incapable of ribosome attachment;

[0145] 8) Addition of a reverse-transcribed promoter to the 3' end of the open reading frame (ORF) of a gene sequence encoding a polypeptide (Reverse transcription engineering, RTE); or

[0146] 9) Regulation of the cellular localization of proteins (polypeptides); or

[0147] 10) It may be based on two or more combinations selected from 1) to 9) above, but is not specifically limited thereto.

[0148] for example,

[0149] The deletion of part or all of the gene encoding the polypeptide mentioned above 1) may be the removal of the entire polynucleotide encoding the intrinsic target polypeptide within the chromosome, replacement with a polynucleotide in which some nucleotides have been deleted, or replacement with a marker gene.

[0150] Additionally, modification of the expression regulatory region (or expression regulatory sequence) described in 2) above may be a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in a mutation on the expression regulatory region (or expression regulatory sequence), or replacement with a sequence having weaker activity. The expression regulatory region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0151] In addition, the above 3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a lower polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0152] In addition, modifications to the amino acid sequences or polynucleotide sequences of 4) and 5) above may involve the occurrence of sequence variations in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to weaken the activity of the polypeptide, or may involve replacement with an amino acid sequence or polynucleotide sequence modified to have weaker activity or an amino acid sequence or polynucleotide sequence modified to have no activity, but are not limited thereto. For example, gene expression may be inhibited or weakened by introducing a variation within the polynucleotide sequence to form a stop codon, but are not limited thereto.

[0153] For the introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide 6) above, refer to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0154] 7) In order to form a secondary structure in which ribosome attachment is impossible, the addition of a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a gene encoding a polypeptide may make mRNA translation impossible or slow it down.

[0155] Reverse transcription engineering (RTE) of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide above may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0156] The above 9) regulation of the intracellular localization of the protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0157] Such weakening of polypeptide activity may involve a reduction in the activity or concentration expression of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or an increase in the amount of product produced from said polypeptide, but is not limited thereto.

[0158]

[0159] In the present disclosure, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to its intrinsic activity. Such enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may include exhibiting activity that was not originally possessed, or exhibiting improved activity compared to the intrinsic activity or activity prior to modification. The “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or the non-modified microorganism prior to the change in traits caused by genetic mutations due to natural or artificial factors. This may be used interchangeably with “activity prior to modification.” "Enhancement," "upregulation," "overexpression," or "increase" of polypeptide activity relative to intrinsic activity means that the activity and / or concentration (expression amount) of a specific polypeptide were originally possessed by the parent strain or non-modified microorganism prior to transformation.

[0160] The above enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or concentration (expression amount) of an intrinsic polypeptide. Whether the activity of the polypeptide is enhanced can be confirmed by an increase in the degree of activity, expression amount, or amount of product released from the polypeptide.

[0161] The enhancement of the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may utilize, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0162] Specifically, the reinforcement of the polypeptide of the present disclosure is

[0163] 1) Increase in the intracellular copy number of polynucleotides encoding polypeptides;

[0164] 2) Replace the chromosomal gene expression regulatory region encoding a polypeptide with a potent sequence;

[0165] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0166] 4) Modification of the amino acid sequence of the polypeptide to enhance polypeptide activity;

[0167] 5) Modification of the polynucleotide sequence encoding the polypeptide to enhance polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to enhance polypeptide activity);

[0168] 6) Introduction of a foreign polypeptide exhibiting polypeptide activity or a foreign polynucleotide encoding the same;

[0169] 7) Codon optimization of polynucleotides encoding polypeptides;

[0170] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites; or

[0171] 9) Regulation of the cellular localization of proteins (polypeptides); or

[0172] 10) It may be based on two or more combinations selected from 1) to 9) above, but is not specifically limited thereto.

[0173] The increase in the intracellular copy number of the polynucleotide encoding the above 1) polypeptide may be achieved by introducing into a host cell a vector to which the polynucleotide encoding the said polypeptide is operably linked, which can replicate and function independently of the host. Alternatively, it may be achieved by introducing one or more copies of the polynucleotide encoding the said polypeptide into the chromosomes within the host cell. The introduction into the chromosomes may be performed by introducing into the host cell a vector capable of inserting said polynucleotide into the chromosomes within the host cell, but is not limited thereto. The said vector is as described above.

[0174] Replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide 2) above with a sequence having potent activity may, for example, involve deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or may involve a sequence mutation, or replacement with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0175] Examples of known strong promoters include, but are not limited to, CJ1 to CJ7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, yccA promoter, etc.

[0176] The above 3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a higher polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0177] The modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may involve the occurrence of sequence variations in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to enhance the activity of the polypeptide, or may involve replacement with an amino acid sequence or polynucleotide sequence modified to have stronger activity or an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used in this case may additionally include a selection marker to confirm whether chromosome insertion has occurred. The selection marker is as described above.

[0178] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide described in 6) above may be the introduction into a host cell of an exogenous polynucleotide encoding a polypeptide that exhibits the same or similar activity as the polypeptide. As long as the exogenous polynucleotide exhibits the same or similar activity as the polypeptide, there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be generated and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0179] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be a codon optimization of the intrinsic polynucleotide such that transcription or translation within the host cell increases, or a codon optimization of the extrinsic polynucleotide such that optimized transcription or translation occurs within the host cell.

[0180] 8) The above method of analyzing the tertiary structure of the polypeptide to select and modify or chemically modify an exposed site may involve, for example, determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, confirming the structure based on this, and selecting and modifying or modifying an exposed site to be modified or chemically modified.

[0181] The above 9) regulation of the intracellular localization of the protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0182] Such enhancement of polypeptide activity may involve increasing the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or increasing the amount of the product produced from said polypeptide, but is not limited thereto.

[0183]

[0184] Modification of part or all of a polynucleotide in the microorganism of the present disclosure (e.g., modification to code for the protein variant described above) may be induced by (a) homologous recombination using a vector for chromosomal insertion within the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto. The method of modifying part or all of the gene may include methods by DNA recombination technology. For example, deletion of part or all of the gene may be achieved by inducing homologous recombination by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into the microorganism. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.

[0185]

[0186] In the microorganism of the present disclosure, the protein variant, polynucleotide, and L-amino acid, etc. are as described in the other embodiments above.

[0187]

[0188] Another aspect of the present disclosure provides a method for producing L-amino acids, comprising the step of culturing a microorganism of the genus Corynebacterium, comprising a protein variant of the present disclosure or a polynucleotide of the present disclosure, in a medium.

[0189] The method for producing L-amino acids of the present disclosure may include the step of culturing a microorganism of the genus Corynebacterium in a medium comprising the protein variant of the present disclosure, the polynucleotide of the present disclosure, or the vector of the present disclosure.

[0190]

[0191] In this disclosure, the term "culture" means growing the microorganisms of the genus Corynebacterium of this disclosure under appropriately controlled environmental conditions. The culture process of this disclosure may be carried out according to suitable media and culture conditions known in the art. Such culture process can be easily adjusted and used by those skilled in the art depending on the strain selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0192] In this disclosure, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the microorganisms of the genus Corynebacterium of this disclosure, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of the genus Corynebacterium of this disclosure may be any medium used for culturing ordinary microorganisms without special limitations; however, the microorganisms of the genus Corynebacterium of this disclosure may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0193] Specifically, culture media for strains of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0194] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0195] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0196] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.

[0197] In addition, during the cultivation of the microorganisms of the genus Corynebacterium disclosed in this disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as a fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0198] In the culture of the present disclosure, the culture temperature may be 20°C to 45°C, specifically 25°C to 40°C, 25°C to 40°C, 25°C to 37°C, 25°C to 35°C, 27°C to 40°C, 27°C to 37°C, 27°C to 35°C, 30°C to 40°C, 30°C to 37°C, or 30°C to 35°C, but is not limited thereto. In the culture of the present disclosure, the culture time may be about 10 to 160 hours, but is not limited thereto.

[0199] The L-amino acid produced by the culture of the present disclosure may be secreted into the medium or remain in the cell.

[0200] The method for producing L-amino acids of the present disclosure may additionally include, for example, the step of preparing a microorganism of the genus Corynebacterium of the present disclosure, the step of preparing a medium for culturing said strain, or a combination thereof (in any order), prior to said culturing step.

[0201] The method for producing L-amino acids according to the present disclosure may further include a step of recovering L-amino acids from a culture medium (a culture medium in which the culture is performed) or from a microorganism of the genus Corynebacterium. The recovery step may be further included after the culture step.

[0202] The above recovery may involve collecting the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism disclosed in this disclosure, for example, a batch, continuous, or fed-batch culture method. For example, various chromatographs such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the desired L-amino acid may be recovered from the culture medium or microorganism using a suitable method known in the art.

[0203] Additionally, the method for producing L-amino acids of the present disclosure may further include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing L-amino acids of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0204] In the method of the present disclosure, the variant, polynucleotide, vector, strain, etc. are as described in the other embodiments above.

[0205]

[0206] Another aspect of the present disclosure provides a composition for producing L-amino acids comprising one or more microorganisms of the genus Corynebacterium selected from the group consisting of a protein variant of the present disclosure, a polynucleotide encoding said protein variant, and a vector containing said polynucleotide; a culture medium in which said is cultured; or a combination of two or more of these.

[0207] The composition of the present disclosure may further include any suitable excipients commonly used in compositions for producing amino acids, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents, but are not limited thereto.

[0208] In the composition of the present disclosure, the variant, polynucleotide, vector, strain, medium, and L-amino acid, etc. are as described in the other embodiments above.

[0209]

[0210] According to another aspect of the present disclosure, the present disclosure may provide a method for increasing the L-amino acid production capacity of a microorganism, a method for conferring L-amino acid production capacity to the microorganism, or a method for producing a microorganism with increased L-amino acid production capacity, comprising the step of introducing (e.g., transforming) a novel protein variant of the present disclosure described above, a polynucleotide encoding said variant, and / or a recombinant vector comprising said polynucleotide into said microorganism.

[0211] In the method for producing the microorganism of the present disclosure, the polynucleotide, recombinant vector, and microorganism, etc. are as described above.

[0212]

[0213] Another aspect of the present disclosure provides a use for producing L-amino acids of a microorganism comprising: a protein variant of the present disclosure described above; a polynucleotide encoding said protein variant; or one or more selected from the group consisting of said protein variant and the polynucleotide encoding said variant.

[0214] In the use of the present disclosure, the protein variant, polynucleotide, and microorganism, etc. are as described above.

[0215]

[0216] The present disclosure is described in more detail below by way of examples. However, the following examples are merely preferred embodiments for illustrating the present disclosure and are therefore not intended to limit the scope of the rights of the present disclosure. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present disclosure or a similar technical field.

[0217]

[0218] Examples

[0219] Example 1. Construction of a Threonine Biosynthesis Gene Group (thrABC) Variant Library

[0220] Example 1-1. Construction of target gene insertion vector pDC24ΔNCgl1496

[0221] To insert a foreign gene into the chromosome of Corynebacterium glutamicum, NCgl1496, known as the gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site.

[0222] Specifically, to construct NCgl1496 deletion and target gene insertion vectors, PCR was performed using the genomic DNA of the wild-type Corynebacterium glutamicum ATCC13032 strain as a template and primer pairs SEQ ID NO. 1 and SEQ ID NO. 2, and SEQ ID NO. 3 and SEQ ID NO. 4, and the left homologous cancer region of NCgl1496 and the right homologous cancer region of NCgl1496 were obtained, respectively. The polymerase for the PCR reaction was Solg TMPfu-X DNA polymerase (SolGent co.) was used, and the PCR conditions were as follows: denaturation at 95°C for 5 minutes, followed by 27 cycles of denaturation at 95°C for 20 seconds, annealing at 55°C for 40 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. Primers of SEQ ID NOs. 2 and 3 were designed to include a Sca1-HF cleavage site between the left homologous arm and the right homologous arm. The primer sequences used are shown in Table 2 below.

[0223]

[0224] SEQ ID NO Sequence Name Sequence (5'->3')1N1496 Left FTCGAGCTCGGTACCCGTTCCATCGCTGAGT2N1496 Left RTGGTTTTTCGAAAGTACTACCTGATTATTCCA3N1496 Right FTGGAATAATCAGGTAGTACTTTCGAAAAACCA4N1496 Right RAGAGGATCCCCTGAGGAGTACATGCGCGAC

[0225] The gene fragments obtained from the above process were cloned into the pDC24 vector (SEQ No. 5), which had been cleaved with SmaI restriction enzyme, using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid. Cloning was performed by mixing the Gibson assembly reagents with each gene fragment in calculated molar amounts and incubating at 50°C for 1 hour. Through this process, a vector for NCgl1496 gene deletion and target gene insertion was constructed and named pDC24ΔNCgl1496.

[0226]

[0227] Example 1-2. Construction of a Threonine Biosynthesis Gene Group (thrABC) Mutation Expression Vector Library Using Artificial Mutagene Method

[0228] A library of thrABC mutation expression vectors was constructed using the following method.

[0229] thrABC gene fragments with randomly introduced base substitution mutations were obtained by error-prone PCR using the primer pair of SEQ ID NOs. 6 and 7, with the genomic DNA of the Escherichia coli W ATCC9637 (NC_017635) strain as a template. Error-prone PCR was performed using the Genemorph II Random Mutagenesis Kit (Stratagene) under conditions where 0 to 3.5 mutations were introduced per 1kb of amplified gene fragment, and the PCR conditions were denaturation at 96°C for 30 seconds; annealing at 53°C for 30 seconds; The polymerization reaction was repeated 30 times at 72°C for 6 minutes. To obtain the gapA promoter (PgapA) fragment capable of linking with thrABC, PCR was performed using the primer pair of SEQ ID NO. 8 and SEQ ID NO. 9 with the genomic DNA of the wild-type Corynebacterium glutamicum ATCC13032 strain as a template, and the PgapA fragment was obtained. The PCR conditions involved denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 20 seconds, annealing at 55°C for 40 seconds, and polymerization at 72°C for 30 seconds, repeated 27 times, followed by polymerization at 72°C for 5 minutes. The primer sequences used are shown in Table 3 below.

[0230]

[0231] Sequence No. Sequence Name Sequence(5'-> 3')6thrABC FAGAGGAGACACAACATGCGAGTGTTGAAGT7thrABC RGTGGTTTTTCGAAAGTTTACTGATGATTCA8PgapA FGGAATAATCAGGTAGTTTAATTTGTGGATT9PgapA RACTTCAACACTCGCATGTTGTGTCTCCTCT

[0232] After treating the pDC24ΔNCgl1496 vector prepared in Example 1-1 with the restriction enzyme Sca1-HF, the mutant thrABC fragments and PgapA fragment obtained by the above process were cloned using the Gibson assembly method in the same manner as in Example 1-1, transformed into E. coli DH5α, and plated on LB solid medium containing kanamycin (25 mg / L).

[0233] After selecting 20 types of transformed colonies and obtaining plasmids, sequencing analysis confirmed that mutations were introduced at different positions with an average mutation frequency of 1.5 mutations / kb. Transformed E. coli colonies were taken to extract plasmids, which were named the pDC24ΔNCgl1496-PgapA_thrABC(mt) library.

[0234]

[0235] Examples 1-3. Construction of wild-type vectors for the threonine biosynthesis gene group (thrABC).

[0236] To construct the pDC24ΔNCgl1496-PgapA_thrABC(WT) vector as a control, PCR was performed in the same manner as in Example 1-1 using the primer pair of SEQ ID NO. 6 and SEQ ID NO. 7 with the genomic DNA of the Escherichia coli W ATCC9637 (NC_017635) strain as a template, and the wild-type thrABC gene fragment was obtained. Subsequently, to obtain the gapA promoter (PgapA) fragment capable of linking with the thrABC fragment, PCR was performed in the same manner as in Example 1-1 using the primer pair of SEQ ID NO. 8 and SEQ ID NO. 9 with the genomic DNA of the wild-type Corynebacterium glutamicum ATCC13032 strain as a template, and the PgapA fragment was obtained.

[0237] After treating the pDC24ΔNCgl1496 vector constructed in Example 1-1 with the restriction enzyme Sca1-HF, the wild-type thrABC gene fragment and PgapA fragment obtained from the above process were cloned using the Gibson assembly method in the same manner as in Example 1-1 to obtain a recombinant plasmid. The constructed recombinant plasmid was named pDC24ΔNCgl1496-PgapA_thrABC(WT).

[0238]

[0239] Example 2. Selection of Threonine Biosynthesis Gene Group (thrABC) Variants via Library Screening

[0240] Example 2-1. Preparation of a mutant library with increased L-threonine production capacity

[0241] The pDC24ΔNCgl1496-PgapA_thrABC(mt) library produced above using the threonine-producing strain KCCM12502P (Republic of Korea Registered Patent No. 10-2126951) as the parent strain was transformed by homologous chromosome recombination using electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545) and plated on a compound plate containing kanamycin (25 mg / ℓ) to obtain about 10,000 colonies, which were named KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-1 to KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-10000. In addition, the above-described pDC24ΔNCgl1496-PgapA_thrABC(WT) vector was transformed into the KCCM12502P strain to construct a control strain, which was named KCCM12502PΔNCgl1496::PgapA_thrABC(WT).

[0242]

[0243] Compound Plate Medium (pH 7.0)

[0244] Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitiol 91 g, Agar 20 g (based on 1 liter of distilled water)

[0245]

[0246] Example 2-2. Library screening of mutant strains with increased L-threonine production capacity

[0247] Approximately 10,000 colonies obtained in Example 2-1 and the control strain were each inoculated into 300 µl of screening medium containing the following components and cultured in a 96-deep well plate at 32°C and 1000 rpm for approximately 24 hours. The ninhydrin method was used to analyze the production of L-threonine during culture (J. Biol. Chem. 1948. 176:367–388). After the culture was completed, 10 µl of the culture supernatant and 190 µl of ninhydrin reaction solution (63% glycerol, 27% ninhydrin solution (7.1 g / L in 0.5M citrate buffer pH 5.5)) were reacted at 65°C for 30 minutes. Subsequently, absorbance was measured at a wavelength of 570 nm using a spectrophotometer, and approximately 300 mutant strain colonies exhibiting an absorbance increase of 10% or more compared to the control strain KCCM12502PΔNCgl1496:: PgapA_thrABC(WT) were selected. Other colonies showed absorbances similar to or decreased compared to the control group. The composition of the selection medium is as follows.

[0248]

[0249] Selective medium (pH 8.0)

[0250] Glucose 10 g, 5.5 g ammonium sulfate, MgSO4·7H2O 1.2 g, KH2PO4 0.8 g, K2HPO4 16.4 g, Biotin 100 µg, Thiamine HCl 1000 µg, Calcium-pantothenic acid 2000 µg, Nicotinamide 2000 µg (based on 1 liter of distilled water)

[0251]

[0252] The above method was repeated on the 300 strains selected above, and the top 30 mutant strains with improved L-threonine production ability compared to the KCCM12502PΔNCgl1496:: PgapA_thrABC(WT) strain were selected.

[0253]

[0254] Example 2-3. Evaluation of L-Threonine Production Capacity of Selected Mutants

[0255] The L-threonine production ability of the 30 strains selected in Example 2-2 above was analyzed by culturing them in the following manner.

[0256] Each strain was inoculated into a 250 ml Corner-Baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of seed culture was inoculated into a 250 ml Corner-Baffle flask containing 24 ml of production medium and cultured at 32°C for 72 hours with shaking at 200 rpm. The concentration of L-threonine was analyzed using HPLC (High Performance Liquid Chromatography).

[0257] <Seed medium (pH 7.0)>

[0258] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO4 4 g, K2HPO48 g, MgSO4·7H2O 0.5 g, Biotin 0.1 mg, Thiamine HCl 1 mg, Calcium-Pantothenic Acid 22 mg, Nicotinamide 2 mg (based on 1 liter of distilled water)

[0259] Production Medium (pH 7.0)

[0260] Glucose 63 g, (NH4)2SO4 28 g, Soy protein 20 g, Molasses 14 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, Biotin 1.8 mg, Thiamine hydrochloride 9 mg, Calcium pantothenic acid 9 mg, MnSO4 180 mg, FeSO4 200 mg, ZnSO4 1 mg, CuSO4 1 mg, CaCO3 30 g (based on 1 liter of distilled water)

[0261] Among the 30 variant strains selected above, the top 6 strains with increased L-threonine concentration compared to the control group were selected, and the analyzed L-threonine concentrations are as shown in Table 4 below.

[0262]

[0263] Strain nameL-Threonine (g / L)KCCM12502P3.2KCCM12502PΔNCgl1496::PgapA_thrABC(WT)4.0KCCM12502PΔN Cgl1496::PgapA_thrABC(mt)-14.5KCCM12502PΔNCgl1496::PgapA_thrABC(mt)-24.5KCCM1250 2PΔNCgl1496::PgapA_thrABC(mt)-34.3KCCM12502PΔNCgl1496::PgapA_thrABC(mt)-44.3KCCM 12502PΔNCgl1496::PgapA_thrABC(mt)-54.2KCCM12502PΔNCgl1496::PgapA_thrABC(mt)-64.1

[0264] As shown in the table above, it was confirmed that when the wild-type threABC gene derived from Escherichia coli was introduced, threonine production increased compared to the parent strain KCCM12502P. In addition, when the threABC variant gene was introduced, it was confirmed that threonine production increased by approximately 102.5% to approximately 112% compared to KCCM12502P ΔNCgl1496:: PgapA_thrABC(WT) with the wild-type threABC gene introduced. Through this, it was found that the threABC variant improves the L-threonine production capacity of the strain by improving the activity of ThrABC.

[0265]

[0266] Example 2-4. Identification of L-threonine biosynthesis gene group (thrABC) variants in selected mutant strains

[0267] To confirm the mutations introduced into the thrABC of the strains selected in Examples 2-3 above, the nucleotide sequences were analyzed. To determine the nucleotide sequences, PCR was performed using the primer pairs of SEQ ID NO. 10 and SEQ ID NO. 11, with the genomic DNA of the six selected strains serving as templates. The PCR conditions involved denaturation at 95°C for 5 minutes, followed by 27 cycles of denaturation at 95°C for 20 seconds, annealing at 60°C for 40 seconds, and polymerization at 72°C for 6 minutes, followed by polymerization at 72°C for 5 minutes. The primer sequences used were as shown in Table 5 below.

[0268]

[0269] Sequence No. Sequence Name Sequence(5'->3')10thrABC SEQ FGCTGCGAAATCTTTGTTTCC11thrABC SEQ RCCCAAACACCTCCCGTTTAT

[0270] The amino acid sequences of the variant ThrA, ThrB, and ThrC were identified through nucleotide sequence analysis of the variant thrABC of each of the six selected strains, and compared with the amino acid sequences of the wild-type ThrA, ThrB, and ThrC (Sequence No. 12, Sequence No. 13, and Sequence No. 14). Variants with changes in protein sequences due to nucleotide sequence variations within the variant thrABC of the six selected strains are listed in Table 6 below.

[0271]

[0272] Strain name, variant name, sequence number KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-1ThrA(S352P, G433R, W521R)15KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-2ThrA(Q58R,S352P,G433R,W521R,N710D)16KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-3ThrA(S352P,G433R,W521R,N710D)17KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-4ThrA(Q58R,S352P,G433R,W521R,N710D,Y784C)18KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-5ThrB(Q247R)19KCCM12502PΔNCgl1496::PgapA_thrABC(mt)-6ThrC(V193A)20

[0273] As a result, it was confirmed that as few as 1 amino acid to as many as 6 amino acids were substituted.

[0274]

[0275] Example 3. Introduction and Evaluation of Threonine Biosynthesis Gene Group (thrABC) Variants in Isoleucine-Producing Strains

[0276] Example 3-1. Construction of a recombinant vector for the introduction of a threonine biosynthesis gene family (thrABC) mutation

[0277] In order to determine whether there is an effect of increasing isoleucine production capacity through the introduction of the ThrABC variant selected in Example 2 into a Corynebacterium glutamicum strain capable of producing L-isoleucine, a variant introduction vector was constructed in the following manner.

[0278] Specifically, using the primer pair of SEQ ID NO. 8 and SEQ ID NO. 7 with the genomic DNA of KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-1, KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-2, KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-3, KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-4, KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-5, and KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-6 selected in Examples 2-4 above as a template, Example PCR was performed in the same manner as in 2-4, and PgapA_thrA(S352P, G433R, W521R)BC, PgapA_thrA(Q58R, S352P, G433R, W521R, N710D)BC, PgapA_thrA(S352P, G433R, W521R, N710D)BC, PgapA_thrA(Q58R, S352P, G433R, W521R, N710D, Y784C)BC, PgapA_thrAB(Q247R)C, and PgapA_thrABC(V193A) gene fragments were obtained.

[0279] After treating the pDC24ΔNCgl1496 vector constructed in Example 1-1 with the restriction enzyme ScaI-HF, the PgapA_thrA(S352P, G433R, W521R)BC, PgapA_thrA(Q58R, S352P, G433R, W521R, N710D)BC, PgapA_thrA(S352P, G433R, W521R, N710D)BC, PgapA_thrA(Q58R, S352P, G433R, W521R, N710D)BC, PgapA_thrAB(Q247R)C, and PgapA_thrABC(V193A) gene fragments obtained by the above process were cloned using the Gibson assembly method in the same manner as in Example 1-1 and recombined The plasmids were each obtained. The constructed recombinant plasmids were pDC24ΔNCgl1496-PgapA_thrA(S352P, G433R, W521R)BC, pDC24ΔNCgl1496-PgapA_thrA(Q58R, S352P, G433R, W521R, N710D)BC, pDC24ΔNCgl1496-PgapA_thrA(S352P, G433R, W521R, N710D)BC, pDC24ΔNCgl1496-PgapA_thrA(Q58R, S352P, G433R, W521R, N710D, Y784C)BC, pDC24ΔNCgl1496-PgapA_thrAB(Q247R)C, It was named pDC24ΔNCgl1496-PgapA_thrABC(V193A).

[0280]

[0281] Example 3-2. Production of an isoleucine-producing strain with introduced threonine biosynthesis gene group (thrABC) mutations

[0282] The recombinant vectors prepared in Example 3-2 above, pDC24ΔNCgl1496-PgapA_thrA(S352P, G433R, W521R)BC, pDC24ΔNCgl1496-PgapA_thrA(Q58R, S352P, G433R, W521R, N710D)BC, pDC24ΔNCgl1496-PgapA_thrA(S352P, G433R, W521R, N710D)BC, pDC24ΔNCgl1496-PgapA_thrA(Q58R, S352P, G433R, W521R, N710D, Y784C)BC, pDC24ΔNCgl1496-PgapA_thrAB(Q247R)C, After transforming the isoleucine-producing strain KCCM12739P (Korean Registered Patent No. 10-2363913) by electroporation with pDC24ΔNCgl1496-PgapA_thrABC(V193A) and the recombinant vector pDC24ΔNCgl1496-PgapA_thrABC(WT) prepared in Example 1, respectively, the transformed strains were obtained in a screening medium containing 25 mg / L of kanamycin, and these were respectively KCCM12739P ΔNCgl1496 :: PgapA_thrA(S352P, G433R, W521R)BC, KCCM12739P ΔNCgl1496 :: PgapA_thrA(Q58R, S352P, G433R, W521R, N710D)BC, KCCM12739P ΔNCgl1496 :: PgapA_thrA(S352P, G433R, W521R, N710D)BC, KCCM12739P ΔNCgl1496 :: PgapA_thrA(Q58R, S352P, G433R, W521R, N710D, Y784C)BC, KCCM12739P ΔNCgl1496 :: PgapA_thrAB(Q247R)C, KCCM12739P ΔNCgl1496 :: PgapA_thrABC(V193A) and KCCM12739P ΔNCgl1496 :: It was named PgapA_thrABC(WT).

[0283]

[0284] Example 3-3. Evaluation of Isoleucine Production Capacity

[0285] To confirm the L-isoleucine production ability of the strain prepared in Example 3-2 above, it was evaluated by culturing in the following manner. The parent strain and the mutant strain were inoculated into a 250 ml Corner-Barpool flask containing 25 ml of isoleucine production medium, and then cultured at 32°C for 60 hours with shaking at 200 rpm.

[0286] Production Medium (pH 7.2)

[0287] Glucose 10%, Yeast extract 0.2%, Ammonium sulfate 1.6%, Potassium dihydrogen phosphate 0.1%, Magnesium sulfate heptahydrate 0.1%, Iron heptahydrate 10 mg / ℓ, Manganese sulfate monohydrate 10 mg / ℓ, Biotin 200 µg / ℓ (based on 1 L of distilled water)

[0288] After the culture was finished, the production capacity of L-isoleucine was measured by HPLC, and the analyzed concentration of L-isoleucine is as shown in Table 7 below.

[0289]

[0290] Strain nameL-isoleucine (g / L)KCCM12739P3.0KCCM12739PΔNCgl1496::PgapA_thrABC(WT)3.8KCCM12739PΔNCgl1496::PgapA_thrA(S3 52P,G433R,W521R)BC4.3KCCM12739PΔNCgl1496::PgapA_thrA(Q58R,S352P,G433R,W521R,N710D)BC4.4KCCM12739PΔNCgl 1496::PgapA_thrA(S352P,G433R,W521R,N710D)BC4.2KCCM12739PΔNCgl1496::PgapA_thrA(Q58R,S352P,G433R,W521R,N 710D,Y784C)BC4.2KCCM12739PΔNCgl1496::PgapA_thrAB(Q247R)C4.1KCCM12739PΔNCgl1496::PgapA_thrABC(V193A)3.9

[0291] As shown in the table above, it was confirmed that when the wild-type thrABC gene derived from Escherichia coli was introduced, isoleucine production increased compared to the parent strain KCCM12739P. In addition, when the thrABC variant gene was introduced, it was confirmed that isoleucine production increased by approximately 102% to approximately 113% compared to KCCM12739P ΔNCgl1496:: PgapA_thrABC(WT) with the wild-type thrABC gene introduced. In particular, KCCM12739PΔNCgl1496:: PgapA_thrA(S352P, G433R, W521R)BC, KCCM12739PΔNCgl1496:: PgapA_thrA(Q58R, S352P, G433R, W521R, N710D)BC, KCCM12739PΔNCgl1496::PgapA_thrA(S352P,G433R,W521R,N710D)BC, and KCCM12739PΔNCgl1496::PgapA_thrA(Q58R,S352P,G433R,W521R,N710D,Y784C)BC are isoleucine relative to the parent strain KCCM12739P. It was confirmed that production capacity increased significantly. Through this, it was found that the thrrABC mutation enhances the strain's L-isoleucine production capacity by improving the activity of ThrABC.

[0292]

[0293] Example 4. Introduction and Evaluation of Aspartokinase and Homoserine Dehydrogenase 1 (ThrA) Variants into O-Acetylhomoserine Producing Strain

[0294] Example 4-1. Construction of a recombinant vector for the introduction of aspartokinase and homoserine dehydrogenase 1 (ThrA) variants

[0295] In order to determine whether there is an effect of increasing O-acetyl homoserine production capacity through the introduction of the ThrA variant selected in Example 2 into a Corynebacterium glutamicum strain capable of producing O-acetyl homoserine, a variant introduction vector was constructed in the following manner.

[0296] Specifically, PCR was performed using the primer pairs of SEQ ID NO. 8 and SEQ ID NO. 21 with the genomic DNA of KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-1, KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-2, KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-3 and KCCM12502PΔNCgl1496:: PgapA_thrABC(mt)-4 selected in Examples 2-4 above as templates, and PgapA_thrA(S352P, G433R, W521R), PgapA_thrA(Q58R, S352P, G433R, W521R, N710D), PgapA_thrA(S352P, G433R, W521R, N710D) and PgapA_thrA(Q58R, S352P, G433R, W521R, N710D, Y784C) gene fragments were obtained. In addition, to construct the pDC24ΔNCgl1496-PgapA_thrA(WT) vector as a control, PCR was performed using the primer pair of SEQ ID NO. 8 and SEQ ID NO. 21 with the genomic DNA of the KCCM12502PΔNCgl1496:: PgapA_thrABC(WT) strain constructed in Example 2-1 as a template, and the PgapA_thrA(WT) gene fragment was obtained. The PCR conditions were as follows: denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 5 seconds, annealing at 60°C for 40 seconds, and polymerization at 72°C for 4 minutes, repeated 27 times, followed by polymerization at 72°C for 5 minutes.

[0297] After treating the pDC24ΔNCgl1496 vector prepared in Example 1-1 with the restriction enzyme ScaI-HF, the PgapA_thrA(S352P, G433R, W521R), PgapA_thrA(Q58R, S352P, G433R, W521R, N710D), PgapA_thrA(S352P, G433R, W521R, N710D), PgapA_thrA(Q58R, S352P, G433R, W521R, N710D), and PgapA_thrA(WT) gene fragments obtained by the above process were cloned using the Gibson assembly method in the same manner as in Example 1-1 to obtain recombinant plasmids, respectively. The synthesized recombinant plasmids were named pDC24ΔNCgl1496-PgapA_thrA(S352P, G433R, W521R), pDC24ΔNCgl1496-PgapA_thrA(Q58R, S352P, G433R, W521R, N710D), pDC24ΔNCgl1496-PgapA_thrA(S352P, G433R, W521R, N710D), pDC24ΔNCgl1496-PgapA_thrA(Q58R, S352P, G433R, W521R, N710D, Y784C), and pDC24ΔNCgl1496-PgapA_ThrA(WT).

[0298]

[0299] Example 4-2. Preparation of an O-acetylhomoserine-producing strain introduced with aspartokinase and homoserine dehydrogenase 1 (ThrA) variants

[0300] The recombinant vectors pDC24ΔNCgl1496-PgapA_thrA(S352P, G433R, W521R), pDC24ΔNCgl1496-PgapA_thrA(Q58R, S352P, G433R, W521R, N710D), pDC24ΔNCgl1496-PgapA_thrA(S352P, G433R, W521R, N710D), pDC24ΔNCgl1496-PgapA_thrA(Q58R, S352P, G433R, W521R, N710D, Y784C), and pDC24ΔNCgl1496-PgapA_thrA(WT) prepared in Example 4-1 above were each O-acetylhomoserine-producing strains After transforming KCCM12634P (Republic of Korea Registered Patent No. 10-2182497) by electroporation, transformed strains were obtained in a selective medium containing 25 mg / L of kanamycin, and these were respectively KCCM12634P ΔNCgl1496 :: PgapA_thrA(S352P, G433R, W521R), KCCM12634P ΔNCgl1496 :: PgapA_thrA(Q58R, S352P, G433R, W521R, N710D), KCCM12634P ΔNCgl1496 :: PgapA_thrA(S352P, G433R, W521R, N710D), and KCCM12634P ΔNCgl1496 :: PgapA_thrA(Q58R, S352P, G433R, W521R, N710D, Y784C) and KCCM12634P ΔNCgl1496 :: PgapA_thrA(WT) were named.

[0301]

[0302] Example 4-3. Evaluation of O-acetyl homoserine production capacity

[0303] To confirm the O-acetyl homoserine production ability of the strain prepared in Example 4-2 above, it was evaluated by culturing in the following manner. One platinum loop of the strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium, and the culture was shaken at 200 rpm for 20 hours at 33°C.

[0304] Production Medium (pH 7.2)

[0305] Glucose 30g, KH2PO4 2g, Urea 3g, (NH4)2SO4 40g, Peptone 2.5g, CSL (Corn steep liquor, Sigma) 5g (10ml), MgSO4·7H2O 0.5g, CaCO3 20g (based on 1 liter of distilled water)

[0306] After the culture was finished, the production capacity of O-acetyl homoserine was measured by HPLC, and the analyzed concentrations of O-acetyl homoserine are as shown in Table 8 below.

[0307] Strain Name O-Acetyl Homoserine(g / L)KCCM12634P1.05KCCM12634PΔNCgl1496::PgapA_thrA(WT)1.4KCCM12634PΔNCgl1496::PgapA_thrA(S352P,G433R,W521R)1.8KCCM12634PΔNCgl1496::PgapA_thrA(Q58R,S35 2P,G433R,W521R,N710D)1.7KCCM12634PΔNCgl1496::PgapA_thrA(S352P,G433R,W521R,N71 0D)1.55KCCM12634PΔNCgl1496::PgapA_thrA(Q58R,S352P,G433R,W521R,N710D,Y784C)1.6

[0308] As shown in Table 7 above, it was confirmed that when the wild-type thrrA gene derived from Escherichia coli was introduced, the production of O-acetyl homoserine increased compared to the parent strain KCCM12634P. In addition, when the thrrA variant gene was introduced, it was confirmed that the production of O-acetyl homoserine increased by approximately 111% to approximately 128% compared to KCCM12634PΔNCgl1496:: PgapA_thrA(WT) with the wild-type thrrA gene introduced. In particular, KCCM12634PΔNCgl1496:: PgapA_thrA(S352P, G433R, W521R), KCCM12634PΔNCgl1496:: PgapA_thrA(Q58R, S352P, G433R, W521R, N710D), KCCM12634PΔNCgl1496::PgapA_thrA(S352P,G433R,W521R,N710D), and KCCM12634PΔNCgl1496::PgapA_thrA(Q58R,S352P,G433R,W521R,N710D,Y784C) showed O-acetyl homoserine relative to the parent strain KCCM12634P. It was confirmed that production capacity increased significantly. Through this, it was found that the thrrA mutation enhances the strain's O-acetyl homoserine production capacity by improving ThrA activity.

[0309]

[0310] From the foregoing description, those skilled in the art to which this disclosure pertains will understand that this disclosure may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this disclosure should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

1. A protein variant comprising an amino acid sequence of SEQ ID NO. 12, wherein the amino acid corresponding to the 58th position from the N-terminus is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), the amino acid corresponding to the 710th position is substituted with aspartic acid (D), the amino acid corresponding to the 784th position is substituted with cysteine ​​(C), or a combination thereof.

2. In claim 1, the protein variant comprises an amino acid sequence in which the amino acid corresponding to the 352nd position from the N-terminus is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), and the amino acid corresponding to the 521st position is substituted with arginine (R); An amino acid sequence in which the amino acid corresponding to the 58th position from the N-terminus is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), and the amino acid corresponding to the 710th position is substituted with aspartic acid (D); An amino acid sequence in which the amino acid corresponding to the 352nd position from the N-terminus is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), and the amino acid corresponding to the 710th position is substituted with aspartic acid (D); or A protein variant comprising an amino acid sequence in which the amino acid corresponding to the 58th position from the N-terminus is substituted with arginine (R), the amino acid corresponding to the 352nd position is substituted with proline (P), the amino acid corresponding to the 433rd position is substituted with arginine (R), the amino acid corresponding to the 521st position is substituted with arginine (R), the amino acid corresponding to the 710th position is substituted with aspartic acid (D), and the amino acid corresponding to the 784th position is substituted with cysteine ​​(C).

3. In claim 1, the protein variant is a protein variant having 90% or more identity with the amino acid sequence of SEQ ID NO.

12.

4. In claim 1, the protein variant comprises the amino acid sequence of SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, or SEQ ID NO.

18.

5. A polynucleotide encoding the protein variant of claim 1.

6. A microorganism of the genus Corynebacterium comprising one or more selected from the group consisting of the protein variant of claim 1 and the polynucleotide encoding the protein variant.

7. In paragraph 6, the microorganism of the genus Corynebacterium is a microorganism that is Corynebacterium glutamicum.

8. In claim 6, the microorganism is a microorganism having increased L-amino acid production capacity compared to a microorganism of the genus Corynebacterium that does not include one or more selected from the group consisting of the protein variant and the polynucleotide encoding the protein variant.

9. A method for producing L-amino acid, comprising the step of culturing the microorganism of claim 6 in a culture medium.

10. A method for producing L-amino acids according to claim 9, wherein the method further comprises the step of recovering L-amino acids from a cultured medium or cultured microorganism.

11. A method for producing L-amino acid according to claim 9, wherein the L-amino acid is selected from the group consisting of L-threonine, L-isoleucine, O-acetyl L-homoserine, and L-glycine.

12. Use of a microorganism for producing L-amino acids, comprising: a protein variant of any one of claims 1 to 4; a polynucleotide encoding the protein variant; or one or more selected from the group consisting of the protein variant and the polynucleotide encoding the variant.

Citation Information

Patent Citations

  • A modified polypeptide of dihydrodipicolinate reductase and a method for L- threonine using the same

    KR102126951B1

  • A modified inner membrane protein and methods for producing purpose product using them

    KR102182497B1

  • Novel modified L-threonine dehydratase and a method of producing L-Isoleucine using thereof

    KR102363913B1

  • Promoter and uses thereof

    US10273491B2

  • Promoter and use thereof

    US10584338B2