Highly specialized and fully orthogonal translation system

The rRNA-mRNA chimera addresses the challenge of synthesizing proteins with non-canonical amino acids by enabling orthogonal translation, ensuring normal cellular protein synthesis is not impaired, and allowing for the production of specialized proteins with desired properties.

WO2026072527A1PCT designated stage Publication Date: 2026-04-02THE BOARD OF TRUSTEES OF THE UNIV OF ILLINOIS
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-23
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Existing ribosome systems struggle to synthesize proteins with non-proteinogenic amino acids without impairing normal cellular protein synthesis, leading to incomplete orthogonality and cellular sickness.

Method used

Development of an rRNA-mRNA chimera that forms a scaffold for the ribosomal subunit and presents a protein coding sequence, allowing engineered ribosomes to exclusively translate specific mRNA molecules, thereby producing proteins with non-canonical amino acids while avoiding interference with endogenous translation.

Benefits of technology

The rRNA-mRNA chimera enables the production of specialized proteins with non-canonical amino acids without disrupting normal cellular protein synthesis, achieving orthogonal translation and optimizing the incorporation of designer amino acids into peptides or proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025047444_02042026_PF_FP_ABST
    Figure US2025047444_02042026_PF_FP_ABST
Patent Text Reader

Abstract

A rRNA-mRNA chimera comprising a mRNA molecule, a small rRNA molecule, and a linker covalently linking the rRNA molecule and the mRNA molecule. Nucleic acid constructs, ribosomes, hosts cells, and kits comprising the rRNA-mRNA chimera, and method of producing a proteinaceous product by covalently linking via a linker a rRNA molecule to a mRNA encoding the proteinaceous product.
Need to check novelty before this filing date? Find Prior Art

Description

HIGHLY SPECIALIZED AND FULLY ORTHOGONAL TRANSLATION SYSTEMREFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority fromU . S . Provisional Application Serial Numbers 63 / 699 , 515 , filedSeptember 26 , 2024 , and 63 / 816, 759 , filed June 3 , 2025 , the contents of which are incorporated herein by reference in their entireties .REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (name :UIC0113WO_ST2 6 . xml ; size : 130 , 544 bytes ; and date of creation :September 18 , 2025 ) is herein incorporated by reference in its entirety .STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0003] This invention was made with government support under grant no . R35 GM127134 awarded by the National Institutes ofHealth and grant number 2345648 awarded by the NationalScience Foundation . The government has certain rights in this invention .BACKGROUND

[0004] The ribosome is a ribonucleoprotein machine responsible for protein synthesis . In all kingdoms of life it is composed of two subunits , each built on its own ribosomalRNA ( rRNA) scaffold . Messenger RNA (mRNA) brings genetic information to the ribosome and the ribosome reads this information and polymerizes amino acids into proteins according to the sequence of codons in mRNA . Any cellular ribosome can translate any of the thousands of different mRNAmolecules . Ribosomes have been evolutionary optimized for polymerizing 20 natural proteinogenic amino acids into polypeptides .

[0005] The ability of the ribosome to synthesize biopolymers (proteins ) according to the genetic information can be expanded to include a broader array of amino acids or even non-amino acid monomers . However, this requires altering the properties of the ribosome which often results in its inability to synthesize normal cellular proteins and is deadly for the cell . The solution is to have in the cell a subpopulation of ' orthogonal ' ribosomes that are excluded from production of cellular proteins and are fully dedicated to the production of the desired polypeptide . Although some progress has been achieved in the past by producing ribosomes with an altered mRNA recognition element , the orthogonality( functional isolation ) of such ribosomes was incomplete resulting in poorly growing and generally sick cells .

[0006] Needed in the art is a fully orthogonal translation system for expressing specialized proteins , e . g. , proteins with non-proteinogenic amino acids , in a cell without diminishing normal cellular protein synthesis . The present invention addresses this need in the art .SUMMARY OF THE INVENTION

[0007] The invention provides a rRNA-mRNA chimera comprising a mRNA molecule ; a small rRNA molecule ; and a linker covalently linking the small rRNA molecule and the mRNA molecule . Also provided are ribosomes and host cells comprising the rRNA-mRNA chimera , and kits and nucleic acid constructs encoding the rRNA-mRNA chimera .

[0008] The invention also provides a kit comprising ( a ) nucleic acids encoding a small rRNA molecule and a linkersequence downstream of the nucleic acids encoding the small rRNA molecule ; (b) PGR reagents for amplifying nucleic acids encoding a mRNA of interest ; and (c) reagents for in vi tro transcription and in vi tro translation of the mRNA of interest .

[0009] Further provided is a method producing a proteinaceous product comprising covalently linking a rRNA molecule to a mRNA encoding the proteinaceous product via a linker to produce a rRNA-mRNA chimera and translating the mRNA of the rRNA-mRNA chimera thereby producing the proteinaceous product .BRIEF DESCRIPTION OF DRAWINGS

[0010] FIG . 1 . Testing of individual clones from different libraries for sensitivity of fluorescence to spectinomycin( spc) when grown in the presence or absence of spc . F / ODeoo, fluorescence over optical density 600 . The graph shows various candidate ( CAN) chimeras including HP1 , HP2 , CAN1 , CAN11 , etc .

[0011] FIG . 2 . Inactivating mutations (C18A, G530A,A787C / C795G) in the 16S sequence of 16S rRNA-HP2 linker-sfGFP mRNA chimera (HP2-GFP) result in loss of fluorescence, indicating the orthogonal translation of the attached sfGFP mRNA by the 16S rRNA to which it is attached .

[0012] FIG . 3 . A 16S rRNA-HP2 linker-HiBiT mRNA chimera (HP2-HB) is orthogonally translated to form a functional Nano-Luc enzyme in the presence of LgBiT . Asterisk indicates a 16S inactivating mutation (G530A) in HiBiT . RLU, Relative luminescent units .

[0013] FIG . 4 . Two 16S-rRNA-HP2 linker-mRNA constructs (HP2-HB and HP2-LgBiT ) are functional and orthogonal in the same cell simultaneously . Translation of HiBiT is compatible with the translation of the LgBiT protein . Asterisk indicates a 16Sinactivating mutation (G530A) . RLU, Relative luminescent units .

[0014] FIG . 5 . Purified 16S rRNA-linker-mRNA constructs (HP2-HB) are active and orthogonal in vi tro .

[0015] FIG . 6. Ribo-M-GFP expressing cells (E. coli BL21 ) are fluorescent .

[0016] FIG . 7 . SQ110 cells that are eryR(A2058G in chromosomal 23S ) or spcR(C1192U in chromosomal 16S ) are used to confirm orthogonality of Ribo-M-GFP . The presence of ery or spc inhibits the 50S or 30S subunit of the Ribo-M construct , respectively, while the wild-type 30S and 50S are resistant and remain functional . A decrease in fluorescence upon antibiotic treatment is indicative of Ribo-M orthogonality with respect to both subunits .

[0017] FIG . 8 . Ribo-M-HiBiT is functional and orthogonal when expressed in E . coli BL21 cells .DETAILED DESCRIPTION OF THE INVENTION

[0018] The present invention is based, in part , on the development of an engineered ribosome that incorporates into its structure the one and only mRNA it will translate . The invention is achieved by engineering a rRNA-mRNA chimera that first serves as a scaffold for the assembly of the small ribosomal subunit and then presents the protein coding sequence for translation by the ribosome that the rRNA-mRNA chimera is a component of . The chimeric molecule and methods herein have the capacity to exclude the engineered ribosomes from translation of endogenous cellular proteins and prevent endogenous cellular ribosomes from translating mRNA of the rRNA-mRNA chimeric molecule . Advantageously, the ' one ribosome-one gene ' design allows for the generation of multiple , independent rRNA-mRNA chimera molecules in one cell ,each dedicated to the translation of a single peptide or protein species . Each of the engineered ribosomes may be optimized for incorporation of different 'designer' amino acids ( e . g. , non-proteinogenic amino acids or non-canonical amino acids ) into a peptide or protein product with desired properties .

[0019] Accordingly, the disclosure herein provides a rRNA- mRNA chimera comprising a mRNA molecule ; a rRNA molecule( e . g. , small rRNA molecule ) ; and a linker covalently linking the rRNA molecule and the mRNA molecule . The disclosure also provides a nucleic acid construct encoding the rRNA-mRNA chimera, a ribosome comprising the rRNA-mRNA chimera , a host cell comprising the rRNA-mRNA chimera , ribosome , and / or nucleic acid construct , and a method and kit of preparing and using the rRNA-mRNA chimera in the synthesis of a proteinaceous product .

[0020] The indefinite articles "a" and "an, " as used herein in the specification and in the claims , unless clearly indicated to the contrary, should be understood to mean "at least one . " Further, a range includes each individual member .Thus , for example , a group having 1-3 members refers to groups having 1 , 2 , or 3 members .

[0021] The disclosure herein provides nucleic acid molecules , i . e . , RNA and DNA molecules , and their corresponding nucleotide sequences . As used herein, the term "RNA" or "RNA molecule" refers to a polymer of ribonucleotide bases . The term "DNA" or "DNA molecule" refers to a polymer of deoxyribonucleotide bases . Nucleic acid molecules may be read from the 5 ' (upstream) end to the 3 ' ( downstream) end . The nomenclature used herein is in line with the requirements of the WIPO standard ST26 Annex 1 . By convention, the nucleotide sequences herein are provided with sequence identifiers andare disclosed with reference to only one strand . In the context of double- stranded molecules of DNA, the complementary sequences ( 1 • e . , the sequences of the complementary strand) , also referred to in the art as the reverse complementary sequences , are within the scope of the invention and are expressly intended to be within the scope of the subj ect matter claimed . Sequences presented herein in the form DNA are not limited to DNA and are intended to encompass a correspondingRNA sequence . In the context of double-stranded DNA, a corresponding RNA sequence may correspond to the complementary strand or reverse complementary strand .

[0022] Ribosomes are ribonucleoproteins which are present in both prokaryotes and eukaryotes . Ribosomes are the cellular organelles responsible for protein synthesis . During gene expression, ribosomes translate the genetic information encoded in a messenger RNA into protein . Ribosomes comprise two nonequivalent ribonucleoprotein subunits . The larger subunit ( known in the art as the "large ribosomal subunit , "" large rRNA subunit , " "large rRNA, " "23S rRNA" ( in prokaryotes ) , or "28S rRNA" ( in eukaryotes ) is about twice the size of the smaller subunit ( known in the art as the "small ribosomal subunit , " " small rRNA subunit , " "small rRNA, " "16S rRNA" ( in prokaryotes ) , or "18S rRNA" ( in eukaryotes ) . The small ribosomal subunit binds messenger RNA (mRNA) and mediates the interactions between mRNA and transfer RNA (tRNA) anticodons on which the fidelity of translation depends . The large ribosomal subunit catalyzes peptide bond formation, the peptidyl-transf erase reaction of protein synthesis . The ribosome also includes one or more binding sites for protein factors that assist in the initiation, elongation, and termination phases of protein synthesis . The large and small ribosomal subunits behave independently during the initiationphase of protein synthesis ; however, they assemble into complete ribosomes when elongation is about to begin .Accordingly, as used herein, the term "ribosome" refers to a complex comprising a large ribosomal subunit and small ribosomal subunit . The 503 and 303 are the large and small ribosomal subunits , respectively, found in prokaryotic cells , forming a 703 ribosome . In contrast , eukaryotic cells contain larger ribosomes , with a 60S and 403 subunit that assemble into an 803 ribosome .

[0023] As used herein, unless otherwise stated, the term"transcribe, " "transcription, " or grammatical variations thereof , refers to the synthesis of RNA from a DNA template .The term "translate , " "translation, " or grammatical variations thereof , refers to the synthesis of a polypeptide from an mRNA template .

[0024] As used herein, "rRNA" or "ribosomal RNA" refers to a type of non-coding RNA, which is the primary component of ribosomes . rRNA carry out protein synthesis in ribosomes .

[0025] As used herein, "mRNA" or "messenger RNA" refers to a type of single-stranded RNA that may be read by a ribosome in the process of synthesizing a peptide or protein . Genetic information in mRNA is provided by codons consisting of three ribonucleotides each . Each codon codes for a specific amino acid, except the stop codons , which terminate protein synthesis .

[0026] The terms "peptide , " "polypeptide, " and "protein" refer to a polymeric form of amino acids of varying length, which may include coded and non-coded amino acids , chemically or biochemically modified or derivatized amino acids , and polypeptides having modified peptide backbones . In some embodiments , a peptide may be composed of about 2 to about 100 amino acids , ( e . g. , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 20 , 30 , 40 ,50 , 60 , 70 , 80 , 90 or 100 amino acids ) . In some embodiments , a polypeptide or protein may be composed of more than about100 amino acid residues .

[0027] As used herein, the term "chimera, " "chimeric molecule, " " fusion, " or grammatical variations thereof , refer to a single molecule produced by fusing a first nucleic acid molecule to a second nucleic acid molecule , where neither first nor second nucleic acid molecule would normally be found in that configuration, i . e . , fused to the other . The chimeric molecule is thus a new molecule not otherwise normally found in nature .

[0028] An "engineered" or "recombinant" molecule refers to a molecule that would not normally be found in nature and as such was created by human intervention . Such human intervention may produce a recombinant DNA molecule, a recombinant RNA molecule or recombinant peptide or protein .An example of a recombinant RNA molecule is a rRNA-mRNA chimera described herein resulting from covalent linking of a mRNA molecule and a rRNA molecule via a linker, which may ultimately result in the expression of a recombinant peptide or protein molecule in an organism.

[0029] In one aspect , the rRNA-mRNA chimera of the disclosure is composed of a mRNA molecule . In some embodiments , the mRNA encodes a natural biopolymer . In some embodiments , the mRNA encodes a non-natural biopolymer . In some embodiments , the mRNA encodes a proteinaceous product . In some embodiment , the mRNA molecule encodes a peptide . In some embodiments , the mRNA molecule encodes a protein . In some embodiments , the peptide or protein is an antimicrobial peptide or protein ( e. gr. , an antibiotic, antiviral , or antifungal peptide or protein) , antigenic peptide or protein, antibody or antigen binding fragment thereof , or hormone . In some embodiments , the mRNAencodes an amino acid sequence . In some embodiments , the amino acid sequence comprises natural amino acid residues . As used herein, a natural amino acid residue is a proteinogenic amino acid encoded directly by a codon of the universal genetic code . In some embodiments , the amino acid sequence comprises at least one unnatural amino acid residue . As used here , an unnatural amino acid is a nonproteinogenic amino acid .Examples of unnatural amino acids include , but are not limited to, a p-acetyl-L-phenylalanine , a p-iodo-L-phenylalanine , anO-methyl-L-tyrosine, 3 p-propargyloxyphenylalanine , a p- propargyl -phenylalanine , an L-3- ( 2-naphthyl ) alanine , a 3- methyl -phenylalanine , an O-4 -allyl-L-tyrosine , a 4-propyl-L tyrosine , a tri-O-acetyl-GlcNAcpp-serine , an L-Dopa , a fluorinated phenylalanine , an isopropyl-L-phenylalanine , a p- azido-L-phenylalanine, a p-acyl-L-phenylalanine, a p-benzoyl-L-phenylalanine , an L-phosphoserine , a phosphonoser ine, a phosphonotyrosine , a p-bromophenylalanine , a p-amino-L- phenylalanine , an isopropyl -L-phenylalanine , an unnatural analogue of a tyrosine amino acid; an unnatural analogue of a glutamine amino acid; an unnatural analogue of a phenylalanine amino acid; an unnatural analogue of a serine amino acid; an unnatural analogue of a threonine amino acid; an unnatural analogue of a methionine amino acid; an unnatural analogue of a leucine amino acid; an unnatural analogue of a isoleucine amino acid; an alkyl , aryl , acyl , aazziiddoo,, cyano, halo, hydrazine , hydrazide , hydroxyl , alkenyl , alkynl , ether, thiol , sulfonyl , seleno, ester, thioacid, borate, boronate , phospho, phosphono, phosphine, heterocyclic, enone , imine , aldehyde , hydroxylamine, keto, or amino substituted amino acid, or a combination thereof ; an amino acid with a photoactivatable cross-linker; a spin-labeled amino acid; a fluorescent amino acid; a metal binding amino acid; a metal-containing aminoacid; a radioactive amino acid; a photocaged and / or photoisomeri zable amino acid; a biotin or biotin-analogue containing amino acid; a keto containing amino acid; an amino acid comprising polyethylene glycol or polyether; a heavy atom substituted amino acid; a chemically cleavable or photocleavable amino acid; an amino acid with an elongated side chain; an amino acid containing a toxic group; a sugar substituted amino acid; a carbon-linked sugar-contalning amino acid; a redox-active amino acid; an a-hydroxy containing acid; an amino thio acid; an a, a disubstituted amino acid; a p-amino acid; a D-amino acid; a y-amino acid, a cyclic amino acid other than proline or histidine , and an aromatic amino acid other than phenylalanine , tyrosine or tryptophan .

[0030] In another aspect , the rRNA-mRNA chimera of the disclosure is composed of a rRNA molecule, in particular a small rRNA molecule, i . e . , a small ribosomal subunit . In some embodiments , the rRNA molecule is a small ribosomal subunit of a prokaryotic ribosome , in particular a 16S rRNA. In some embodiments , the rRNA molecule is a small ribosomal subunit of a eukaryotic ribosome, in particular a 18S rRNA . Nucleic acid molecules encoding the large and small ribosomal subunits of prokaryotic and eukaryotic ribosomes are well-known in the art and readily available from databases such as GENBANK,UNIPROT, SILVA, GreenGenes , EzBioCould, and the RibosomalDatabase Proj ect . Exemplary nucleotide sequence encoding 16S ribosomal sequences are available under GENBANK Accession Nos .J01859 . 1 and MH145363 . Exemplary nucleotide sequence encoding18S ribosomal sequences are available under GENBANK AccessionNos . NR003286. 4M 11188 . 1 and X00686. 1 . While aspects of the disclosure are directed to the use of a small rRNA subunit , a large rRNA subunit may also be used in some aspects .

[0031] In another aspect , the rRNA-mRNA chimera of the disclosure is composed of a linker covalently linking the rRNA molecule (small rRNA molecule) and the mRNA molecule. As used herein, a linker refers to a chemical moiety in a molecule comprising a covalent bond or a chain of atoms that covalently attaches one moiety or molecule to another, e . g. , a rRNA to a mRNA. In embodiments of the invention, the linker is not endogenous to the mRNA or rRNA of the chimera, i.e. , the linker is not derived from or otherwise obtained or originated from the mRNA or rRNA of the chimera. In this respect, the linker is exogenous to the rRNA and mRNA of the chimera . In some embodiments , a linker of the disclosure may comprise a nucleotide sequence . In some embodiments , a linker of the disclosure may comprise a nucleotide sequence having a length of about 2 to about 200 nucleotides, e.g. , 2, 3, 4 , 5, 6, 7,8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130,140, 150, 160, 170, 180, 190, 200, or any length or range therebetween . In some embodiments, a linker of the disclosure comprises about 2 to 30 nucleotides, e.g. , 2 to 6, 4 to 7, 6 to 8 , 7 to 9, 8 to 10, 2 to 15, 2 to 20, 2 to 25, 2 to 30, 6 to 7 , 6 to 8 , 6 to 9, 6 to 10, 6 to 15, 6 to 20, 6 to 25, 6 to 30, 8 to 15, 8 to 20, 8 to 25, or 8 to 30 nucleotides. In some embodiments, the linker comprises a sequence that forms a hairpin structure. In some embodiments , a linker of the disclosure comprises the nucleotide sequence NNNNN(N) 1-5, e.g. ,NNNNNN, NNNNNNN, NNNNNNNN, NNNNNNNNN, or NNNNNNNNNN, whereinN may at any position may be A, C, T or G . In some embodiments, a linker of the disclosure comprises the nucleotide sequenceGAAGAGTCCGCTCTTCNNNNNNN (SEQ ID NO: 1) orAGATGAGGATCACCCATCTNNNNNNN (SEQ ID NO:2) , wherein N may at any position may be A, C, T or G . In some embodiments, the linker a linker of the disclosure comprises the nucleotide sequenceGAAGAGCCGCTCTTCGGTTCCA ( SEQ ID NO : 3 ) , GAAGAGTCCGCTCTTCGGTTCCA( SEQ ID NO : 4 ) , or GAGTTTAA .

[0032] In some aspects , the rRNA-mRNA chimera of the disclosure is a component of a ribosome . In some aspects , the disclosure provides a nucleic acid construct encoding the rRNA-mRNA chimera . As used herein a "nucleic acid construct" refers to a nucleic acid molecule or polynucleotide encoding a rRNA-mRNA chimera . In some embodiments , a nucleic acid construct is a linear naked molecule or a vector, e . g. , a plasmid, a bacmid, a phagemid, a cosmid, a phage , a virus , or an artificial chromosome . In some embodiments , a nucleic acid construct is a plasmid comprising regulatory sequences , e . g. , a promoter ( s ) and terminator ( s ) , that facilitate expression of the rRNA-mRNA chimera in a cell . In some embodiments , a nucleic acid construct comprises nucleic acids encoding a rRNA-mRNA chimera of the disclosure . In some embodiments , a nucleic acid construct comprises nucleic acids encoding a rRNA-mRNA chimera of the disclosure and further comprises nucleic acids encoding components of a large ribosomal subunit . In some embodiments , components of a large ribosomal subunit may include , but are not limited to, 5S rRNA and 23S rRNA of the prokaryotic large ribosomal subunit or 5S rRNA,5 . 8S rRNA and 28S rRNA of the eukaryotic large ribosomal subunit .

[0033] In some aspects , the disclosure also provides a host cell , e . g. , a prokaryotic or eukaryotic cells , comprising one or more rRNA-mRNA chimeric molecules and / or one or more nucleic acid constructs encoding one or more rRNA-mRNA chimeric molecules .

[0034] In another aspect , kits are provided for preparing and using a rRNA-mRNA chimeric molecule of the disclosure to produce a proteinaceous product . In one aspect , a kit of thedisclosure comprises a nucleic acid construct encoding a rRNA' mRNA chimera, the mRNA of which encodes a proteinaceous product. In some embodiments, a kit of disclosure comprises a vector (e. g. , plasmid) comprising nucleic acids encoding a rRNA-mRNA chimera. In another aspect, a kit of the disclosure comprises a nucleic acid encoding a rRNA (e.g. , small rRNA molecule) and a linker sequence downstream of the nucleic acids encoding the small rRNA molecule.

[0035] In some embodiments, a kit may include a nucleic acid construct (e.g. , plasmid) encoding a rRNA-mRNA chimera, host cells , and optionally reagents (e.g. , buffers, trans format ion / trans feet ion reagents, and growth media) for facilitating transformation of the host cells, growth of the hosts cells , and / or transcription and translation of a proteinaceous product in vivo. In accordance with this embodiment , the kit may further include reagents for lysing host cells and isolating and optionally purifying a proteinaceous product from host cell lysates.

[0036] In some embodiments, a kit may include a nucleic acid construct (e.g. , amplicon or plasmid) encoding a small rRNA molecule and a linker sequence downstream of the small rRNA molecule coding sequence. By way of illustration, the kit may include a plasmid having the nucleotide sequence of SEQ IDNO: 28 (pAM_HP_GFP) , wherein NNNNNNN comprises the sequenceGGTTCCA and nucleic acid sequences encoding sfGFP are replaced with nucleic acids encoding a proteinaceous product of interest . In accordance with this embodiment, the kit may further include PGR reagents for amplifying nucleic acids encoding a mRNA of interest and optionally in-frame insertion of the same downstream of the linker and / or restriction enzymes . In other embodiments, a kit of the disclosure may include reagents for in vitro transcription (e.g. , NTPs, RNApolymerase , and / or buffers ) , in vi tro translation ( e . g. , natural and / or non-natural amino acids , tRNAs , translation factors , ATP / GTP, and / or RNase inhibitor) , and optionally reagents for purifying a proteinaceous product .

[0037] In embodiments of any of the kits of the disclosure , the kit may further include other active or inactive ingredients , carriers , diluents , and the like . Such kits may be provided with all necessary materials and ingredients contained therein, or they may contain instructions for using or making materials or components that must be obtained independently by the user .

[0038] Another aspect of the disclosure provides method of producing a proteinaceous product comprising covalently linking via a linker a rRNA molecule to a mRNA encoding the proteinaceous product to produce a rRNA-mRNA chimera and translating the mRNA of the rRNA-mRNA chimera thereby producing the proteinaceous product . In some embodiments , the linker comprises the nucleotide sequence NNNNN (N ) 1-5,GAAGAGTCCGCTCTTCNNNNNNN ( SEQ ID NO : 1 ) , orAGATGAGGATCACCCATCTNNNNNNN ( SEQ ID NO : 2 ) . In some embodiments , the linker comprises the nucleotide sequenceGAAGAGCCGCTCTTCGGTTCCA ( SEQ ID NO : 3 ) , GAAGAGTCCGCTCTTCGGTTCCA( SEQ ID NO : 4 ) , or GAGTTTAA . In other embodiments , the proteinaceous product comprises natural amino acid residues , unnatural amino acid residue , and a combination thereof , as described herein . In some embodiments , the proteinaceous product is produced in vi tro . In some embodiments , the proteinaceous product is produced in vi vo . In some embodiments , the rRNA-mRNA chimera is encoded by a nucleic acid construct , e . g. , a plasmid and the proteinaceous product is produced in vivo.

[0039] The following non-limiting examples are provided to further illustrate the present invention .Example 1 : 16S rRNA- 1 inker - s f GFP mRNA Chimera LibraryPreparation

[0040] To identify a linker of use in a rRNA-mRNA chimeric molecule , a model 16S rRNA-sfGFP mRNA chimera was generated .The construct for expressing this chimeric molecule included a ribosomal RNA ( rRNA) operon in which the Shine-Dalgarno and anti-Shine-Dalgarno were removed . Subsequently, libraries of linkers were inserted into the model chimeric molecule and expression of sfGFP was analyzed . The linker libraries included an unstructured linker comprising a 6-10 randomized nucleotides ( SL library) , a linker with a hairpin followed by seven random nucleotides (HP library) , and a MS2 coat protein binding linker including seven random nucleotides (MS2 library) .

[0041] To generate the model chimeric molecule , the pAM552 plasmid (pBR552 ori , AmpR, Orelle et al . ( 2015 ) Na ture 524 : 119-124 ) carrying the rRNA operon with an A2058G EryRmutation in the 23S rRNA sequence was first digested with Notl and Acc65I restriction enzymes to replace the PL promoter upstream of the rRNA operon with an araC-PsAD promoter for tighter regulation of expression . The araC-PBAD sequence was PGR amplified from the pApi plasmid (Baliga et al . ( 2019 ) Proc . Na tl . Acad. Sci .USA 118 ( 10 ) : e2026465118 ) with primers KA 9 ( forward :CGCGGCCGCAAAAAAGCCCGCTCATTAGGCGGGCTACTCCGTCAAGCCGTCAATTG;SEQ ID NO : 5 ) and KA10( reverse : CCCGGTACCCAAAAAAACGGGTATGGAGAAACAGTAGAGAGTTGCGATAAAAAGCGTCAGGTAGGATCGGCTAATC ; SEQ ID NO : 6 ) . Simultaneously, theBamHI restriction site contained in the araC-PBAD sequence was mutated from GGATCC to CGATCC using Kll ( CCGCGGCCGCAAAAAAGC;SEQ ID NO: 7) and K12 ( CCCGGTACCCAAAAAAAC ; SEQ ID NO: 8) primers. The Barnin -site-free promoter sequence resulting from the 4-primer (K9-K12) PGR reaction was treated with Bpnl (to reduce the background of parental plasmid) , purified, digested with Notl and Kpnl , and ligated into previously digested pBR552 . The ligation mix was directly transformed into BL21 cells and recovered on Amp (100 pg / ml) + L-glucose (0.2%) plates. The resulting plasmid was named pAM_BAD.

[0042] The 16S gene on the pAM_BAD plasmid was mutated at position 1534 from GGATCA to GGATCC to introduce a BamHI cut site . To do this , the forward primer KAI 3(TTACCACTTTGTGATTCATGACTGGGGTGAAGTCGTAACAAGGTAACCGTAGGGGAACCTGCGGTTGGATCcCCTCC ; SEQ ID NO: 9) , which is complementary to the 3' end of 16S with a mismatch, and the reverse primer KA14( CCTCTAGACGAAGGGGACACGAAAATTGCTTAT ; SEQ ID NO:10) were used to introduce this mutation by PGR (Bralll and Xbal cut sites are in bold, mismatched nucleotide is lower case) . The PGR product was purified and treated with Dpnl . The original plasmid pAM_ BAD and the PGR product were digested with restriction enzymes Bralll and Xbal and ligated. The ligation mixture was transformed into electrocompetent BL21 cells and recovered on plates containing Amp (100 pg / ml) + L-glucose(0.2%) . The resulting plasmid was purified, sequence verified (Plasmidsaurus) , and named pAM_BAD_BAM and is provided herein under SEQ ID NO: 11 and comprises the features listed in Table1.TABLE 1_ pAM BAD BAM Feature Position* AraC sequence _ 72-950 ara02 operator _ 980-995 araOl operator _ 1137-1148 pBAD promoter _ 1224-1252 16S rRNA sequence _ 1452-2993 23S rRNA sequence 3434-6337G2058 mutation _ 54915S rRNA sequence 6431-6549T1 terminator _ 6553-6596T2 terminator _ 6728 -6756 beta-lactamase (bla ) 6921-7781 replication origin 7845-8541* Position with reference to SEQ ID NO : 11 .

[0043] For the rRNA-mRNA chimera, the sequence of a super folder green fluorescent protein ( sfGFP ) gene, excluding its first 5 nucleotides , was PCR-amplif ied from the pGFPl plasmid( e . g. , available from Clontech) using primers KAI 5( GMACCGTAGGGGAACCTGCGGTTGGATCCAAAGGTGAAGAACTGTTTACCGG; SEQID NO : 12 , wherein italici zed nucleotides are complementary to pAM_BAD_ _BAM for Gibson Assembly and bold nucleotides are complementary to sfGFP sequences ) and KAI 6( CGCTTCTTTAAGGTAAGGAGGGCGGCCGTTTCCGGCCGCCTTTGTTAGCAGCCGGTCGAC; SEQ ID NO : 13 , wherein italicized nucleotides are complementary to pAM BAD BAM for Gibson Assembly and bold nucleotides are hairpin-forming sequences ) such that the stop codon of GFP (TAA) was followed by a 21-nucleotide spacer and a strong RNA hairpin forming sequence . The resulting amplicon was inserted into the BamHI-digested pAM_BAD_BAM plasmid viaGibson Assembly . The resulting plasmid, designated pAM_BAD_BAM_ GFP , is provided herein under SEQ ID NO : 14 and comprises the features listed in Table 2 .TABLE 2_ pAM BAD BAM GFP Feature Position* AraC sequence _ 72-950 pBAD promoter _ 1224-12525' end of the 16S rRNA sequence 1452-2984 GFP sequence (minus first 5 2985-3702 nucleotides ) _ protection hairpin 3724 -374016S-23S intergenic region _ 3741-374923S rRNA sequence 4190-7093G2058 mutation 62475S rRNA sequence 7187-7305T1 terminator 7309-7352T2 terminator 7484-7512 beta-lactamase (bla ) 7676-8536 replication origin 8600-9296* Position with reference to SEQ ID NO : 14 .

[0044] For the MS2 library, the sequence of the MS2 coat protein was provided as a geneblock ( SEQ ID NO : 15 ) fromIntegrated DNA Technologies ( IDT ) , amplified (while adding aPirc promoter and ribosome binding site upstream and a tryptophan terminator sequence downstream) , and assembled viaGibson assembly . The resulting plasmid, designated pAM__BAD_BAM_GFP_MS2 , is provided herein under SEQ ID NO : 16 and comprises the features listed in Table 3 .TABLE 3_ pAM BAD BAM GFP MS2 Feature _ Position* AraC sequence _ 72-950 pBAD promoter 1224 -1252 5 ' end of the 16S rRNA sequence _ 1452-2984GFP sequence (minus first 5 2985-3702 nucleotides ) protection hairpin _ 3724 -374016S-23S intergenic region 3741-374923S rRNA sequence _ 4190-7093G2058 mutation 62475S rRNA sequence 7187-7305T1 terminator 7309-7352T2 terminator 7484-7512 pTrc promoter _ 7571-7600 natural ribosome binding site (RBS ) _ 7643-7668MS2 coat protein sequence _ 7669-8061Ttrp terminator _ 8093-8117 beta-lactamase (bla ) _ 8253-9113 replication origin 9177- 9873 r Position with reference to SEQ ID NO : 16.

[0045] The oligonucleotides shown in Table 4 were synthesized by IDT and made double-stranded through PGR to later createthe linker region in the resulting libraries . Each oligonucleotide in Table 4 Included the 16S rRNA sequenceCGTAGGGGAACCTGCGGTTGGA (SEQ ID NO: 17) at its 5' end, the sfGFP sequence GTGAGCAAAGGTGAAGAACTGTTT (SEQ ID NO: 18; start codon in bold) or GTGAGCAAAGGTGAAGAACTGTTTA (SEQ ID NO : 19 ; start codon in bold) at its 3' end, and the designated linker between the 16S rRNA and sfGFP sequences.TABLE 4Library Sequence (5' -3' ) Linker CGTAGGGGAACCTGCGGTTGGANNNNNNGTGSL AGCAAAGGTGAAGAACTGTTT (SEQ ID NNNNNN (length 6) NQ:20) _CGTAGGGGAACCTGCGGTTGGANNNNNNNGTSL GAGCAAAGGTGAAGAACTGTTT (SEQ ID NNNNNNN (length 7) NO: 21) _CGTAGGGGAACCTGCGGTTGGANNNNNNNNGSL TGAGCAAAGGTGAAGAACTGTTT (SEQ ID NNNNNNNN (length 8) NO: 22) _CGTAGGGGAACCTGCGGTTGGANNNNNNNNNSL GTGAGCAAAGGTGAAGAACTGTTT (SEQ NNNNNNNNN (length 9) ID NO:23) _CGTAGGGGAACCTGCGGTTGGANNNNNNNNNSL NGTGAGCAAAGGTGAAGAACTGTTT (SEQ NNNNNNNNNN (length 10) ID NO:24) _CGTAGGGGAACCTGCGGTTGGATGAAGAGTCGAAGAGTCCGCTCTTCNNNHP CGCTCTTCNNNNNNNGTGAGCAAAGGTGAAGNNNN (SEQ ID NO: 1) AACTGTTTA (SEQ ID NO: 25) _CGTAGGGGAACCTGCGGTTGGATAGATGAGG AGATGAGGATCACCCATCTMS2 ATCACCCATCTNNNNNNNGTGAGCAAAGGTG NNNNNNN (SEQ ID AAGAACTGTTTA (SEQ ID NO:26) NO: 2)SL: Simple linker, HP: Hairpin, MS2 : MS2 coat protein bindingHP.

[0046] The resulting double- stranded DNA molecules were introduced into the BamHI-digested pAM_BAD_BAM_GFP by Gibson assembly to insert the linker sequences upstream of the sfGFP coding sequence, while re-introducing the first five missing nucleotides of sfGFP. The plasmids for each library type contained an engineered 16S rRNA-linker-sfGFP mRNA construct(as well as the rest of the rRNA operon) under the expressionof an araC-PBAD promoter. The resulting plasmids, designated pAM_SL_GFP (unstructured linker comprising a 6-10 randomized nucleotides) , pAM HP GFP (a linker comprising a hairpin (SEQID NO: 25) ) , pAM_MS2_GFP (a MS2 coat protein binding linker(SEQ ID NO:26) ) and provided herein under SEQ ID NOs: 27-29, comprise the features listed in Tables 5-7, respectively.TABLE 5_ pAM SL GFP Feature _ Position* _ AraC sequence _ 72-950 pBAD promoter _ 1224-12525' end of the 16S rRNA sequence _ 1452-2982Sequence encompassing linker _ 2983-2997GFP sequence (minus first 5 nucleotides) 2998-3715 protection hairpin _ 3737-375423S rRNA sequence _ 4204-7107G2058 mutation _ 6261 _5S rRNA sequence _ 7201-7319T1 terminator _ 7323-7366T2 terminator _ 7498-7526 beta-lactamase (bla) _ 7690-8550 replication origin 8614-9310* Position with reference to SEQ ID NO: 27. For simple linkers with lengths of 6, 7, 8, or 9, one or more of nucleotides 2983-2986 may be absent.TABLE 6 pAM HP GFP Feature Position*AraC sequence 72-950 pBAD promoter 1224-12525' end of the 16S rRNA sequence 1452-2982Sequence encompassing linker 2983-3011GFP sequence (minus first 5 nucleotides) 3012-3729 protection hairpin 3751-376823S rRNA sequence 4218-7121G2058 mutation 62755S rRNA sequence 7215-7333T1 terminator 7337-7380T2 terminator 7512-7540 beta-lactamase (bla) 7704-8564 replication origin 8628-9324*7Position with reference to SEQ ID NO: 28.TABLE 7 pAM MS2 GFP Feature Position*AraC sequence 72- 950 pBAD promoter 1224-12525 ' end of the 16S rRNA sequence 1452-2979Sequence encompassing linker 2984 -3010GFP sequence (minus first 5 nucleotides ) 3015-3732 protection hairpin 3754 -377023S rRNA sequence 4220-71235S rRNA sequence 7217-7335T1 terminator 7339-7382T2 terminator 7514-7542 pTrc promoter 7601-7630Natural RBS 7673-7698MS2 Coat Protein 7699-8091Ttrp terminator 8123-8147 beta-lactamase (bla ) 8283- 9143 replication origin 9207- 9903*rPosition with reference to SEQ ID NO : 29 .

[0047] The Gibson Assembly mix for each library was directly transformed into XL-10 Gold Ultracompetent Cells (Agilent ) according to the vendor' s transformation protocol . The cells were recovered, with as good colony spacing and uniformity as possible, on large ( Falcon Bacteriological Petri dish 151cm2,Fisher Scientific) petri dishes containing LB-agar supplemented with Amp ( 100 pg / ml ) and L-glucose ( 0 . 2% ) . Three dilutions of the transformation mix were also plated on regular petri dishes with the same content . Subsequently, the total library transformant count was estimated and recorded from the dilution plates , and a few colonies were picked and analyzed via colony PGR followed by Sanger sequencing (UICGenome Research Core ) to verify library diversity at the randomized sequences of the 16S-mRNA linker regions . The transformant colonies were then washed off with LB and thefinal plasmid library pool was purified using High PurePlasmid isolation kit ( SigmaAldrich) .Example 2 : Screening for Successful cis -Translation byEngineered 16S rRNA-linker-sfGFP mRNA Chimeras

[0048] E. coll strain SQllO-ATolC is a derivative of the strain MG1655 ( ilvG rfb-50 rph-1) that has all but one ( rznE) ribosomal RNA operons removed (ArrnGADBHC) and carries the essential pTRNAlOO-aadA plasmid (pACYC ori , SpcR) that supplies the missing tRNA genes . To render this strain sensitive to Spc, pTRNAlOO-aadA plasmid was replaced with pTRNAl 00-dhfr in which the aadA gene was replaced with the dhfr gene that provides resistance to Trimethoprim (Tmp ) .Briefly, the plasmid was linearized by inverse PPCCRR with primers KAI ( GGCGAAGTAATCGCAACAT ; SEQ ID NO : 30 ) and KA2(CTGTCCCTCCTGTTCAGCTA; SEQ ID NO : 31 ) , treated with Dpnl , and purified . The dhfr gene was amplified from the pTJl plasmid using primers KA3( GTCAGTAGCTGAACAGGAGGGACAGATCCCCTGATTCCCTTTGTCAAC ; SEQ IDNO : 32 ) and KA4(AATGCGGATGTTGCGATTACTTCGCCCAGAGCGCTTTTGAAGCTGATG; SEQ IDNO : 33 ) to add complementary flanks , treated with Dpnl , andGibson Assembled into the linearized vector . The resulting pTRNA100-dh.fr plasmid ( sequence verified by Plasmidsaurus ) was transformed into electrocompetent SQ110-ATo2C / pTRNA100-aadA cells , the cells were then recovered on plates containing LB- agar + Tmp ( 10 pg / ml ) and passaged for six generations in the presence of Tmp but absence of Spc at 37°C in order to lose the original pTRNAlOO-aadA plasmid . AAfftteerr tthhee last passage, the culture was diluted and plated on LB-agar + Tmp ( 10 pg / ml) to obtain about 200 colonies . Approximately 50 colonies were replica-plated on Tmp ( 10 pg / ml ) and Spc ( 30 pg / ml) separatelyto confirm the loss of Spc resistance . A colony that grew on the Tmp plate but did not grow on the Spc plate was selected as SQ110-ATo2C7pTRNA100-dh.fr.

[0049] SQ110-A To2C / pTRNA100-dhfr cells were made SpcRby plating ( 1 ml of ODeoo : l ) of an overnight culture on LB-agar +150 pg / ml Spc to select for Spc RRmutations (C1192T) in their sole 16S rRNA gene . Six recovered mutants were characterized by colony PGR using primers KA5( AAATTGAAGAGTTTGATCATGGCTCAGATT ; SEQ ID NO : 34 ) and KA 6( GCGCCATTGTAGCACGTGTG ; SEQ ID NO : 35 ) to amplify the region spanning nucleotides 1-1245 of 16S rRNA followed by Sanger sequencing (UIC Genome Research Core ) of the purified amplicon using primer KA6 . One colony was identified with the C1192T mutation and stored as SQ110-ATo2C / pTRNA100-dhfr / SpcR.

[0050] The SQ110-A To2C / pTRNA100-dhfr / SpcRstrain was transformed with the plasmid pools expressing each library of16S rRNA-linker-sfGFP mRNA chimeras (pAM_SL_GFP, pAM_HP_ GFP, and pAM_MS2_GFP) individually . For each screening experiment , a dilution of the transformation mix wwaass plated to yield approximately 100-500 colonies per 150x15mm Petri dish on LB- agar supplemented with ampicillin ( 100 pg / ml ) , and L-arabinose( 0 . 2% here and throughout ) . Plates were incubated overnight at 37°C . The plates were subsequently imaged using a Bio-RadChemiDoc imaging system with a Cy2 filter to identify fluorescent colonies expressing sfGFP . To verify cis- translation, two 96-well plates (black, clear bottom; FisherScientific ) were prepared with : (a ) wells filled with 100 pl of LB supplemented with ampicillin, spectinomycin ( spc, 1024 pg / ml ) , and L-arabinose , aanndd (b) wells filled with 100 pl ofLB supplemented with ampicillin and L-arabinose (no spc ) . Each fluorescent colony was inoculated into both of the 96-well plates from the previous step . Both plates were grownovernight on a shaker at 37°C . The next day, each plate was recorded in a TECAN Infinite 200 PRO plate reader to measure fluorescence ( F) and optical density ( ODeoo ) ■ For each well(originating from an individual fluorescent colony) , fluorescence over optical density ( F / ODeoo ) was calculated and graphed in the presence and absence of spc to visualize the decrease in fluorescence upon spc treatment . The colonies with the biggest decrease of F / ODeoo when comparing Spc ( - ) to Spc ( + ) conditions were grown from the Spc (+ ) 96-well plate and glycerol stocked for further evaluation .

[0051] In this assay, there is the population of wild-type ribosomes that translate all the cellular proteins and are resistant to spc . The engineered 16S rRNA-linker-mRNA chimeric molecules are sensitive to spc and should only translate the covalently linked mRNA encoding the reporter gene ( sfGFP) . If sfGFP is translated from the 16S rRNA-linker-mRNA chimera and not by wild-type ribosomes , translation of sfGFP should be diminished if the cells are treated with spc . Approximately1000 individual constructs were tested, which identified a number of candidate chimeras showing the desired activity( FIG . 1 ) . Two of these chimeras , designated HP2 chimera (with an insert oligonucleotide sequence ofAGGGGAACCTGCGGTTGGATGAAGAGCCGCTCTTCGGTTCCAGTGAGCAAAGGTGAAGAACTGT ( SEQ ID NO : 36 ) and corresponding HP2 linker sequenceGAAGAGCCGCTCTTCGGTTCCA ( SEQ ID NO : 3 ) ) , and SL1 chimera (with an insert oligonucleotide sequence ofAGGGGAACCTGCGGTTGGAGAGTTTAAGTGAGCAAAGGTGAAGAACTGT ( SEQ IDNO : 37 ) and corresponding unstructured linker sequenceGAGTTTAA) , exhibited sensitivity to spc . Chimeras with the HP2 linker were further analyzed .Example 3 : Orthogonal Mode of Translation by the 16S rRNA- linker- sfGFP mRNA Chimera

[0052] To verify in cis ( orthogonal ) mode of translation of the 16S rRNA-mRNA chimera, inactivating mutations were introduced into the 16S sequence of the 16S rRNA-HP2 linker- sfGFP mRNA chimera (HP2-GFP chimera ) by Q5 site-directed mutagenesis . The plasmid encoding HP2-GFP was linearized by inverse-PCR using primers KA39 ( GTAACCGTAGGGGAACCTG ; SEQ IDNO : 38 ) and KA40 ( AACGGGTATGGAGAAACAGTAG ; SEQ ID NO : 39 ) to remove the 16S gene in such a way that 50 nucleotides (the 23- nucleotide HP2 linker and 27 nucleotides at the 16S 3' end) upstream of sfGFP start codon were left to serve as its RBS .The PGR product was purified and ligated using the KLD reaction mix from the Q5 site directed mutagenesis kit (New EnglandBiolabs ) according to vendor' s protocol . The resulting plasmid was named pHP2A16S-GFP .

[0053] The G530A lethal mutation in the 16S gene was introduced into plasmids using primers KA41(AGCAGCCGCGATAATACGGAG; SEQ ID NO : 40 , containing G>A mutation) and KA42 ( GGCACGGAGTTAGCCG ; SEQ ID NO : 41 ) with the Q5 site directed mutagenesis kit (New England Biolabs ) according to vendor' s protocol .

[0054] The G530A construct , as well as C18A mutant construct ,A787C / C795G mutant construct , and HP2A16S-GFP construct , were then tested for fluorescence signal in E. coli BL21 cells , as described above . In this assay, loss of fluorescence indicated orthogonal translation of the attached sfGFP mRNA by the 16S rRNA to which it is attached ( FIG . 2 ) .Example 4 : Compatibility of 16S rRNA-linker-mRNA with DiverseProteins

[0055] To demonstrate the compatibility of the 16S rRNA- linker-mRNA design with other proteins , the sfGFP mRNA sequence of the HP2-GFP chimera was replaced with mRNA encoding HiBiT ( Promega ) (plus the first 5 codons of sfGFP 5 ' end) . Initially, pTRNAlOO-aadA plasmid was linearized in an inverse-PCR reaction with primers KA35 (TGTCGACGGGCATAAATAGG;SEQ ID NO : 42 ) and KA36 (GGAAAGGAAAGAGATCTCGGA; SEQ ID NO : 43 ) to remove its tRNA genes . GB2 ( SEQ ID NO : 44 ) which contains an operon expressing LgBiT and HiBiT (with the first 5 codons of sfGFP at its 5 ' end) under the pTrc promoter was then GibsonAssembled into the linearized vector to create plasmid plOO-HiBiT-LgBiT . The Gibson mix was transformed into chemically competent DH5a cells . The transformants were recovered on plates containing LB-agar supplemented with Tmp ( 10 pg / ml ) . plOO-HiBiT-LgBiT ( sequence verified, Plasmidsaurus ) was then amplified by inverse-PCR using primers KA37(GCTGTTCAAGAAGATTAGCTAA; SEQ ID NO : 44 ) and KA38( TTAACTGTTGATGGTTACTCGG ; SEQ ID NO : 45 ) to remove its LgBiT sequence and re-ligated using the KLD reaction mix from theQ5 site-directed mutagenesis kit (New England Biolabs ) according to vendor' s protocol .

[0056] Plasmids pHP2-GFP was lineari zed by inverse-PCR using primers KA21 (GTCGACCGGCTGCTAACA; SEQ ID NO : 46 ) and KA22 ( SEQID NO : 48 ) , removing the sfGFP sequence and its GTG start codon, and the PCR product was treated with Dpnl . The sequence ofHiBiT ( containing the first 5 codons of sfGFP at the 5 ' end) was PCR-amplif led from plOO-HiBiT-LgBiT plasmid using primersKA33 ( TTCCGGCCGCCTTTGTTAGCAGCCGGTCGACTTAGCTAATCTTCTTGAACAGC ;SEQ ID NO : 47 ) and KA34( CGGTTGGATGAAGAGCCGCTCTTCGGTTCCAATGAGCAAAGGTGAAGAAGT ; SEQ IDNO : 48 ) , Dpnl treated, and Gibson Assembled into the linearized pHP2-GFP . The Gibson Assembly mix was directly transformedinto chemically competent DH5a cells . The transformants were recovered on plates containing LB-agar supplemented with Amp ( 50 pg / ml ) and glucose ( 0 . 2% ) . The resulting plasmid, referred to as pHP2-HB, which encoded the 16S rRNA-HP2 linker-HiBiT mRNA chimera ("HP2-HB" or "HiBiT chimera" ) was purified and sequence verified ( Plasmidsaurus ) .

[0057] The HP2-HB chimera was expressed in E. coli BL21 cells , which express LgBiT from another plasmid ( trimethoprimR) under pTrc promoter . The cells were grown overnight inLB / ampicillin / trimethoprim / O . 2% glucose , centrifuged and resuspended in fresh LB , then diluted inLB / ampicillin / trimethoprim / 1% L-arabinose / 0 . 2 mM IPTG 1 : 100 and grown to exponential phase . The exponentially growing culture was directly added ( 1 : 1 ) to Fruimazine ( Promega ) and the mixture was recorded in a TECAN Infinite 200 PRO plate reader for luminescence ( FIG . 3 ) . The strong luminescence signal , which is lost upon the introduction of an inactivating mutation (G530A) in the 16S sequence of HP2-HB chimera, showed the functionality and orthogonality of this design in translating the HiBiT protein ( FIG . 3 ) .

[0058] As indicated herein, previous attempts in the art to alter ribosome activity have been detrimental to cell viability . Expression of the HP2-GFP and HP2-HB chimeras in two strains of E. coli (BL21 and SQ110 ) had a negligible impact on cell viability .

[0059] In addition, a 16S rRNA- linker -mRNA encoding the typeII dihydrofolate reductase protein ( DHFR chimera ) was generated in a ^manner similar to that of the HiBiT chimera .If successfully translated, the DHFR chimeric molecule would cause resistance to the antibiotic trimethoprim (tmp) . The minimum inhibitory concentration (MIC) of tmp in E. coli BL21 cells expressing 16S rRNA-HP2 linker-DHFR mRNA chimera and itsvariant with a 163 inactivating mutation ( G530A) was measured .The expression of 16S rRNA-HP2 linker-DHFR mRNA chimeric molecule caused a 1000-fold increase in MIC, but this resistance was almost entirely absent when the inactivating mutation was present in the 163 sequence of the 163 rRNA-HP2 linker-DHFR mRNA chimeric molecule . This analysis demonstrated the functionality and orthogonality of the 163-1 in ker-mRNA design with the translation of DHFR, a protein with a selectable phenotype which can significantly facilitate laboratory evolution experiments .Example 5 : Integrity of the Full-Length 16S rRNA-linker-mRNAConstruct in vivo

[0060] To test whether the full-length 16S rRNA-linker-mRNA construct remains intact in the cell , rRNA was extracted from the 703 ribosomes isolated from lysates of cells expressing the HP2-GFP chimera and HP2-HB chimera by sucrose gradient centrifugation . The extracted rRNA was then separated on a 2% agarose gel . The appearance of the band corresponding to theHP2-HB chimera confirmed that rRNA with the attached HiBiT mRNA was present in the cell . While the HP2-GFP chimera was not visualized on the agarose gel (due to lower abundance ) , it could be detected by northern blot experiments where radio- labelled primers complementary to the sequence of GFP were used . Specifically, total RNA from cells expressing the HP2-GFP chimera was loaded on a denaturing agarose gel , the sample was transferred to a positively- charged nylon membrane( Roche ) , and the membrane was hybridized with the radiolabeled primer . Radiography showed the presence of the RNA species corresponding to the intact 16S rRNA-HP2 linker-sfGFP mRNA chimera in the cell .

[0061] In addition, extension of a sfGFP-annealing primer by reverse transcriptase on rRNA samples isolated form cells expressing the HP2-GFP chimera by sucrose gradient centrifugation, demonstrated assembly and maturation of the hybrid 165 rRNA-mRNA chimeric molecule into the 305 subunit and 705 ribosome . In addition, primer extension beyond the linker confirmed integrity of the rRNA-mRNA linker .Example 6 : Coexpression of Two 16S rRNA-linker-mRNA ChimericMolecules in the Same Cell

[0062] The plasmid encoding the 165 rRNA-linker-mRNA design whose mRNA encodes HiBiT (plus the first 5 codons of sfGFP 5 ' end) and another plasmid encoding another 165 rRNA-linker-mRNA design whose mRNA encodes LgBiT (plus the first 5 codons of sfGFP 5' end) were co-transformed into E. coli BL21 cells . To confirm orthogonality of each 165 rRNA-linker-mRNA with respect to each other and to wild-type (WT) ribosomes , variants of each 165 rRNA-linker-mRNA with 165 inactivating mutations were created and co-transformed into E. coll BL21 cells in all possible combinations . The luminescence was recorded as described in Example 4 ( FIG . 4 ) . Appearance of a strong luminescence signal only when neither of the two engineered constructs carried the ribo some -inactivating mutation confirmed that protein products (LgBiT and HiBiT ) encoded by the two constructs coexpressed simultaneously in the cell in an orthogonal fashion, verifying the applicability of the system for the concurrent and orthogonal expression of more than one protein .Example 7 : Purification of 16S rRNA-linker-mRNA Chimeras

[0063] To purify 165 rRNA-mRNA constructs from cells in which they were expressed, the plasmid encoding the HP2-HB chimerawas introduced into ArecA host cells . The rec A gene was inactivated in the SQ110-ATolC / pTRNA100-dhfr / SpcRhost strain by Pl phage transduction using strain BW25113 recA: :cat as the donor . Pl phage transduction was carried out according to the standard protocol except that the recovery incubation was 3 hours instead of 1 hour before plating the transduced cels on LB-agar plates supplemented with Spc (30 pg / ml) and 1.2 pg / ml chloramphenicol (Chi) . Finally, the cat gene was deleted from this strain by exploiting the flanking FRT sites according to standard protocols. Briefly, the cells were transformed with the pCP20 plasmid (temperature sensitive Orf Amp:ChlR) that encodes the Flp recombinase and recovered at 30°C in 1 ml SOC media, followed by selection overnight at 30°C on LB-agar plates supplemented with Spc (30 pg / ml) and Amp (50 pg / ml) .One to two colonies were then grown in LB-Amp (50 pg / ml) to exponential phase at 30°C, diluted 1000-fold in LB with Spc(30 pg / ml) and Tmp (10 pg / ml) , and grown to exponential phase at 42°C. Dilutions were plated on LB-agar plates with Spc (30 pg / ml) and Tmp (10 pg / ml) to recover single colonies at 37°C.Removal of the cat gene and the pCP20 plasmid were verified by replica plating the recovered clones on LB / agar / Spc3CT9 / mi, LB-agar / Spc309g / ml / Amp5°iJ9 / ml, aanndd LB / agar / Spc3°iKhml / Chl1plates. The final strain was further verified to have lost the cat gene by PCR using primers KA 7 (ATAATTGCTTCAACAGAACATATTG; SEQ ID NO: 49) and KA 8 (TACAACTTAAAAAAGCAAAAGGGC; SEQ ID NO: 50) that flank the recA gene and named SQllO-ATolC / ArecA / pTRNAlOO- dhfr / SpcR.

[0064] Total ribosomes were first prepared by pelleting the cell lysate through a sucrose cushion. The total ribosome prep was then incubated with a -100X molar excess of a biotinylated oligonucleotide (5' BioTin-TEG) (IDT) complementary to the 16SrRNA-mRNA sequence around the stop codon of mRNA(AAAAAAAAAAAAAAACTTTGTTAGCAGCCGGTCGACTTAGCTAATC ; SEQ IDNO : 51 ) . The sample was then incubated with streptavidin agarose beads (ThermoFisher Scientific ) . Beads were washed, and the 16S rRNA-linker-mRNA : : biotinylated oligo complex was eluted by treatment with DNase I . The level of enrichment of the preparation with the engineered ribosomes was demonstrated and confirmed by primer extension .Example 8 : Activity and Orthogonality of 16S rRNA-linker-mRNAChimeras in vitro

[0065] The purified 16S-rRNA-mRNA constructs ( encoding HiBiT ) were confirmed to be active in in vi tro translation reactions(New England Biolabs A Ribosome PURExpress kit ) . The translation reactions were carried out according to manufacturer' s protocol with the addition of the purified engineered ribosomes or wild-type ribosome and incubation for one hour at 37°C . The reaction was then diluted 3X with H2O and the NANO-GLO® Extracellular Reagent ( Promega) containing the LgBiT protein was added . Luminescence was recorded in aTECAN Infinite 200 PRO plate reader . The results showed high levels of expression of HiBiT protein from (and by) the engineered ribosomes . The orthogonality of 16S-rRNA-mRNA chimera ( spc sensitive ) was verified by co-incubation with100X excess of spc-resistant wild-type ribosomes with or without spc addition ( 5 mM) ( FIG . 5 ) . The absence of any effect upon addition of wild-type ribosomes confirms the robustness of 16S rRNA-linker-mRNA design in maintaining orthogonality .Example 9 : Incorporation of the 16S rRNA-linker-mRNA Chimera into Ribo-T to create Ribo-M

[0066] The plasmid encoding 16S rRNA-linker-mRNA was engineered to match the previously reported ribosome with tethered subunits (Ribo-T version2 (RiboTv2 ) ) construct(Orelle et al . (2015) Nature 524 : 119-124; Carlson et al .(2019) Nature Commun . 10:320) . Briefly, the 23S rRNA was removed from this plasmid by inverse PCR using primers KA25( GCTTAAGCTTACAACGCCGAA; SEQ ID NO: 52) and KA2 6( TCACAACCCGAAGATGTTTCT ; SEQ ID NO: 53) followed by GibsonAssembly . The linearized plasmid was re-ligated, sequence verified (Plasmidsaurus) , and named pHP2-GFP-A23S. Next , pRiboTv2 was used as template in a Q5 site-directed mutagenesis reaction (New England Biolabs) with primers KA27(GGCAAGACGGAAAGACCCCGTGA; SEQ ID NO: 54, containing G-A mismatch) and KA28 ( GCGGGTACACTGCATCTTCAC ; SEQ ID NO : 55 ) according to vendor' s protocol to revert the A2058G EryRmutation. The resulting plasmid was used as template in a PCR reaction with primers KA29 (GGGAGTGGGTTGCAAAAG; SEQ ID NO: 56) and KA30 ( CCCAGTCATGAATCACAAAG ; SEQ ID NO: 57) , which anneal35 nucleotides upstream and downstream of the tether sequences flanking the circularly permutated 23S region (cp23S) . The resulting PCR product was purified, Dpnl treated, and GibsonAssembled into the pHP2-GFP-A23S plasmid that had been linearized using PCR primers KA31 ( GGAGGGCGCTTACCACT ; SEQ IDNO: 58) and KA32 (GGTTAAGCTACCTACTTCTTTTG; SEQ ID NO: 59) . The resulting plasmid was sequence verified ( Plasmidsaurus ) and named pRibo-M-GFP. The pRibo-M-GFP plasmid sequence is provided herein under SEQ ID NO: 60 and comprises inter alia the features listed in Table 8.TABLE 8 pRibo-M-sfGFP Feature Position*AraC sequence _ 72-950 pBAD mutation _ 1215 pAra promoter 1224-125216S rRNA sequence 1452-2900 cp23S 2916-2964GAGA sequence 2958-296123S rRNA sequence 2965-5817HP2 + 5 nts of GFP 5906-5933GFP sequence (minus first 5 nucleotides ) 5934- 66515S rRNA sequence 7241-7359T1 terminator 7363-7406T2 terminator 7538 -7566 beta-lactamase (bla ) 7730-8590 replication origin 8654-9350* Position with reference to SEQ ID NO : 60 .

[0067] To create pRibo-M-HiBiT , plasmid pRibo-M-GFP was linearized by inverse-PCR using primers KA21 and KA22 , removing the sfGFP sequence and its GTG start codon, and thePGR product was treated with Dpnl . The sequence of HiBiT( containing the first 5 codons of sfGFP at the 5 ' end) wasPCR-amplif led from plOO-HiBiT-LgBiT plasmid using primers KA33 and KA34 , Dpnl treated, and Gibson Assembled into the linearized pRibo-M-GFP . The Gibson Assembly mix was directly transformed into chemically competent DH5a cells . The transformants were recovered on plates containing LB-agar supplemented with Amp ( 50 pg / ml ) and glucose ( 0 . 2% ) .

[0068] The resulting plasmid was sequence verified( Plasmidsaurus ) and named pRibo-M-HiBiT . The pRibo-M-HiBiT plasmid sequence is provided herein under SEQ ID NO : 61 and comprises inter alia the features listed in Table 9 .TABLE 9 pRibo-M-HiBiT Feature Position*AraC sequence 72-950 pBAD mutation 1215 pAra promoter 1224 -125216S rRNA sequence 1452-2900 cp23S 2916-2964GAGA sequence 2958-296123S rRNA sequence 2965-5817HP2 5906-5928GFP first 5 codons + HiBiT _ 5929-59825S rRNA sequence _ 6572-6690T1 terminator 6694 -6737T2 terminator _ 6869-6897 beta-lactamase (bla ) 7061-7921 replication origin 7985-8681* Position with reference to SEQ ID NO : 61 .Example 10 : Functionality and Orthogonality of cp23S-16S-rRNA- linker-mRNA (Ribo-M) Constructs

[0069] E. coll BL21 cells expressing Ribo-M-GFP were grown overnight in the presence of the inducer (L-arabinose ) or repressor ( glucose ) of the promoter regulating the expression of Ribo-M-sfGFP from plasmid pRibo-M-sf GFP . The resulting cultures were recorded in a TECAN Infinite 200 PRO plate reader for fluorescence and ODeoo to calculate F / ODeoo normalized values ( FIG . 6 ) . Fluorescence of the cells when grown in the presence of the inducer confirms expression of sfGFP from theRibo-M-sfGFP construct . To confirm orthogonality of Ribo-M-GFP, SQ110 cells that are erythromycin ( ery) resistant (A2058G in chromosomal 23S ) or spc resistant (C1192U in chromosomal16S ) were transformed with pRibo-M-GFP . The cells were then grown in the presence and absence of 1 mg / ml ery or spc and the F / ODeoo of the resulting cultures was measured as described above . The decrease in fluorescence in the presence of the 50S( ery) or 30S ( spc ) targeting antibiotics in cells whose wild type ribosomal subunits are resistant to these drugs is indicative of the orthogonal mode of action of the Ribo-M construct in translating its attached sfGFP -encoding mRNA( FIG . 7 ) .

[0070] E. coll BL21 cells ( in which LgBiT is expressed from a separate plasmid as described herein) expressing Ribo-MHiBiT and its mutant variant containing an inactivating mutation in its 16S sequence (G530A) were tested forluminescence as described above ( FIG . 8 ) . Luminescence of the cells expressing HiBiT from the pRibo-M-HiBiT construct and the reduction of this signal upon the introduction of the inactivating mutation in the 16S rRNA segment of Ribo-M confirmed that HiBiT was expressed orthogonally by Ribo-MHiBiT .

Claims

WHAT IS CLAIMED IS:

1. A rRNA-mRNA chimera comprising a mRNA molecule; a small rRNA molecule; and a linker covalently linking the rRNA molecule and the mRNA molecule.

2. The rRNA-mRNA chimera of claim 1, wherein the linker comprises the nucleotide sequence NNNNN (N) 1-5,GAAGAGTCCGCTCTTCNNNNNNN (SEQ ID NO: 1) , orAGATGAGGATCACCCATCTNNNNNNN (SEQ ID NO : 2 ) .

3. The rRNA-mRNA chimera of claim 1, wherein the linker comprises the nucleotide sequence GAAGAGCCGCTCTTCGGTTCCA (SEQID N0:3) , GAAGAGTCCGCTCTTCGGTTCCA (SEQ ID NO : 4 ) , or GAGTTTAA.

4. The rRNA-mRNA chimera of claim 1, wherein the mRNA encodes a proteinaceous product.

5. The rRNA-mRNA chimera of claim 4, wherein the proteinaceous product is an antimicrobial peptide or protein, antigenic peptide or protein, antibody or antigen binding fragment thereof, or hormone.

6. A ribosome comprising the rRNA-mRNA chimera of claim1.

7. A nucleic acid construct encoding the rRNA-mRNA chimera of claim 1.

8. A host cell comprising one or more rRNA-mRNA chimera of claim 1.

9. A host cell comprising the nucleic acid construct of claim 7.

10. A kit for preparing the rRNA-mRNA chimera of claim 1 comprising a nucleic acid construct encoding the rRNA-mRNA chimera of claim 1.

11. The kit of claim 10, further comprising host cells and optionally reagents for facilitating transformation of the host cells, growth of the hosts cells, and / or transcription and translation of a proteinaceous product encoded by the mRNA of the rRNA-mRNA chimera.

12. A kit comprising(a) nucleic acids encoding a small rRNA molecule and a linker sequence downstream of the small rRNA molecule encoding sequence;(b) PCR reagents for amplifying nucleic acids encoding a mRNA of interest; and(c) reagents for in vitro transcription and in vitro translation of the mRNA of interest.

14. A method of producing a proteinaceous product comprising covalently linking via a linker a rRNA molecule to a mRNA encoding the proteinaceous product to produce a rRNA mRNA chimera and translating the mRNA of the rRNA-mRNA chimera thereby producing the proteinaceous product.

15. The method of claim 14, wherein the linker comprises the nucleotide sequence NNNNN(N) GAAGAGTCCGCTCTTCNNNNNNN(SEQ ID N0:l) , or AGATGAGGATCACCCATCTNNNNNNN (SEQ ID NO:2) .

16. The method of claim 14, wherein the linker comprises the nucleotide sequence GAAGAGCCGCTCTTCGGTTCCA (SEQ ID NO: 3) ,GAAGAGTCCGCTCTTCGGTTCCA (SEQ ID NO: 4) , or GAGTTTAA.

17. The method of claim 14, wherein the proteinaceous product comprises natural amino acid residues, unnatural amino acid residue, and a combination thereof.

18. The method of claim 14, wherein the proteinaceous product is produced in vivo or in vitro.

Citation Information

Patent Citations

  • RNA-protein compound and application thereof

    CN117106097A

  • Ribonucleic acid (RNA) interactions

    US11597968B2