Method for preparing fructose by using thermostable xylose isomerase
The use of xylose isomerase from Caldibacillus debilis strain addresses low conversion and stability issues in fructose production, achieving efficient and scalable fructose syrup production with high fructose content.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- DAESANG CORP
- Filing Date
- 2025-04-01
- Publication Date
- 2026-04-23
AI Technical Summary
Existing methods for producing fructose from glucose suffer from low conversion rates and lack thermal stability, limiting their efficiency and scalability.
Utilizing a xylose isomerase derived from the Caldibacillus debilis strain with high conversion activity and thermal stability, the method involves isomerizing glucose to fructose in a glucose-containing solution under optimized conditions, including specific metal ions, pH, and temperature, followed by purification to achieve high fructose content.
The method achieves a high conversion rate of glucose to fructose, enabling continuous production of high-quality fructose syrup with a fructose content of 45% (w/w) or more, suitable for commercial high fructose corn syrup production.
Smart Images
Figure KR2025004306_23042026_PF_FP_ABST
Abstract
Description
Method for producing fructose using heat-resistant xylose isomerase
[0001] The present invention relates to a method for producing fructose, and more specifically, to a method for producing fructose from glucose at a high conversion rate using a specific xylose isomerase with excellent thermal stability.
[0002] Fructose is a component found abundantly in honey, flowers, vegetables, and especially fruits; it is also called fruit sugar and is a white, crystalline solid with no odor. As a monosaccharide with a strong sweet taste, fructose is used in the food industry to enhance the flavor of food and beverages, and recently, it is also used as a raw material for the production of allulose.
[0003] Commercially, fructose is produced by isomerizing glucose with glucose isomerase and is mainly sold in the form of high-fructose syrup, which is a type of liquid fructose. The liquid fructose is a mixture of glucose and fructose in which starch is hydrolyzed with a starch-degrading enzyme or acid, and then a portion of the glucose isomerized into fructose using an isomerase.
[0004] Regarding technology for producing fructose through enzymatic isomerization, U.S. Patent Publication No. 4410627 discloses a method for producing a fructose-glucose mixed syrup by contacting a glucose-containing solution with a glucose isomerase obtained from a Streptomyces strain. Additionally, Korean Patent Publication No. 10-0112889 discloses a method for producing xylose isomerase from a Streptomyces murinus colony strain and a method for producing fructose from glucose using said xylose isomerase.
[0005] The present invention is derived from the prior art background, and the objective of the present invention is to provide a method for producing fructose from glucose with a high conversion rate using xylose isomerase.
[0006] The inventors of the present invention searched for xylose isomerase genes from the genomes of various strains and produced five types of xylose isomerases using recombinant DNA technology. In addition, the inventors added the five types of xylose isomerases to a solution containing glucose as a substrate and reacted them, then measured the conversion rate of glucose to fructose. As a result, they confirmed that the conversion activity of the xylose isomerase derived from the Caldibacillus debilis strain was significantly higher than that of other xylose isomerases, and that the thermal stability of the xylose isomerase derived from the Caldibacillus debilis strain was also excellent, thereby completing the present invention.
[0007]
[0008] One example of the present invention provides a method for producing fructose comprising the step of adding a xylose isomerase having the amino acid sequence of SEQ ID NO. 1 to a glucose-containing solution and carrying out an isomerization reaction.
[0009] In a method for producing fructose according to one example of the present invention, the xylose isomerase composed of the amino acid sequence of SEQ ID NO. 1 is an enzyme derived from the strain Caldibacillus debilis, and has very high activity for converting glucose into fructose and excellent thermal stability.
[0010] In a method for producing fructose according to an example of the present invention, the glucose-containing solution corresponds to a substrate solution, and as the isomerization reaction proceeds, glucose is converted into fructose. The type of the glucose-containing solution is not significantly limited; however, considering commercial aspects, it is preferable that the glucose content be 90% (w / w) or higher based on the weight of the sugar solids, and more preferable that it be 95% (w / w) or higher. When the glucose content of the glucose-containing solution is 90% (w / w) or higher based on the weight of the sugar solids, commercially marketable high fructose corn syrup can be easily produced using the manufacturing method of the present invention. For example, the glucose-containing solution may be a starch saccharified liquid obtained by hydrolyzing a starch liquid with γ-amylase. The starch saccharified liquid generally has a glucose content of 97% (w / w) or higher based on the weight of the sugar solids. The above starch liquid is preferably a product obtained by adding a heat-resistant alpha-amylase to a starch suspension and performing a hydrolysis reaction.
[0011] In a method for producing fructose according to an example of the present invention, the glucose-containing solution may preferably further include metal ions. The type of metal ion is not significantly limited as long as it acts as a co-catalyst for the enzyme reaction, and may be selected from, for example, magnesium ions, cobalt ions, etc., and it is preferable to be magnesium ions when considering the synergistic effect of the conversion activity of xylose isomerase. The concentration of the metal ion in the glucose-containing solution is not significantly limited and may be selected in the range of, for example, 0.1 to 15 mM.
[0012] In a method for producing fructose according to one example of the present invention, the type of glucose-containing solution is not significantly limited, such as a solution prepared by dissolving glucose in water, and it is preferable to be a buffer solution containing glucose when considering the stable maintenance of the reaction pH. The buffer solution can be selected from various known buffer solutions, such as Tris-HCl buffer solution and PBS (Phosphate-buffered saline) buffer solution, and it is preferable to be a PBS (Phosphate-buffered saline) buffer solution when considering the conversion activity of xylose isomerase.
[0013] In the fructose production method according to one example of the present invention, the reaction temperature during the isomerization reaction is not significantly limited; however, considering the conversion activity of xylose isomerase, it is preferable to have a temperature of 60 to 90°C, and more preferable to have a temperature of 70 to 85°C. For example, when producing a large amount of fructose from a glucose-containing solution within a short period of time, the reaction temperature may be selected at 70 to 85°C. Additionally, from a commercial perspective, when continuously producing fructose from a glucose-containing solution over a long period without replacing the xylose isomerase, the reaction temperature may be selected at 60 to 75°C. Furthermore, the reaction pH during the isomerization reaction is not significantly limited; considering the conversion activity of xylose isomerase, it is preferable to have a pH of 6.0 to 7.5, and more preferable to have a pH of 6.5 to 7.25.
[0014] In addition, a fructose production method according to an example of the present invention may further include the step of filtering and purifying the isomerization reaction product to obtain a fructose-containing solution. The fructose content of the fructose-containing solution produced through the fructose production method according to an example of the present invention is not significantly limited, but considering commercial utility, it is preferable that it be 40% (w / w) or more based on the total weight of the sugar solids, and 45% (w / w) or more. For example, the fructose content of the fructose-containing solution produced through the fructose production method according to an example of the present invention may be 40-55% (w / w) based on the total weight of the sugar solids. When the fructose content of the fructose-containing solution is 45% (w / w) or more, a commercially marketable high fructose corn syrup can be easily produced by concentrating the fructose-containing solution. According to the Korean Industrial Standard (KS), high fructose corn syrup has a fructose content of 42% (w / w) or more and a moisture content of 30% (w / w) or less based on the total weight of the sugar solids.
[0015] When using the fructose production method according to one example of the present invention, high-yield fructose can be produced from glucose. The xylose isomerase used in the fructose production method according to one example of the present invention has excellent thermal stability, so fructose can be produced continuously for a long time.
[0016] Figure 1 is the result of measuring the conversion rate of glucose to fructose for each of the five types of xylose isomerases in Example 4 of the present invention.
[0017] Figure 2 is the result of measuring the relative activity of xylose isomerase derived from the Caldibacillus debilis strain according to the reaction pH in an embodiment of the present invention.
[0018] Figure 3 is the result of measuring the relative activity of xylose isomerase derived from the Caldibacillus debilis strain according to the reaction temperature in an embodiment of the present invention.
[0019] Figure 4 shows the results of measuring the relative activity of xylose isomerase derived from the Caldibacillus debilis strain according to the type of metal ion acting as a cocatalyst in an embodiment of the present invention.
[0020] Figure 5 is the result of investigating thermal stability by leaving the xylose isomerase derived from the Caldibacillus debilis strain at various temperatures and then reacting it in an embodiment of the present invention.
[0021] The present invention will be explained in detail below through examples. However, the following examples are intended only to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.
[0022]
[0023] Example 1: Obtaining a polynucleotide fragment encoding xylose isomerase
[0024] Xylose isomerase genes present in the genomes of Caldibacillus debilis, Novibacillus thermophiles, Paragiobacillus caldoxylosilyticus, Paragiobacillus thermoglucosidasius, and Anoxybacillus tepidamans strains were searched from the NCBI database, and the amino acid sequences of a total of five xylose isomerases derived from each strain and the nucleotide sequences of the polynucleotides encoding them were identified (see GenBank: KYD21901.1, AQS56035.1, ACO55082.1, OAT71591.1, MBB5325489.1).
[0025] The xylose isomerase derived from the strain Caldibacillus debilis consists of the amino acid sequence of SEQ ID NO. 1, and the polynucleotide encoding it consists of the nucleotide sequence of SEQ ID NO. 2. Additionally, the xylose isomerase derived from Novibacillus thermophiles consists of the amino acid sequence of SEQ ID NO. 3, and the polynucleotide encoding it consists of the nucleotide sequence of SEQ ID NO. 4. Additionally, the xylose isomerase derived from Paragiobacillus caldoxylosilyticus consists of the amino acid sequence of SEQ ID NO. 5, and the polynucleotide encoding it consists of the nucleotide sequence of SEQ ID NO. 6. In addition, the xylose isomerase derived from Paragiobacillus thermoglucosidasius consists of the amino acid sequence of SEQ ID NO. 7, and the polynucleotide encoding it consists of the base sequence of SEQ ID NO. 8. In addition, the xylose isomerase derived from Anoxybacillus tepidamans consists of the amino acid sequence of SEQ ID NO. 9, and the polynucleotide encoding it consists of the base sequence of SEQ ID NO. 10.
[0026] Based on the nucleotide sequences of the five types of xylose isomerases encoded by the above polynucleotides, primers for amplifying the five types of xylose isomerases encoded by the polynucleotides were designed using the GIBSON ASSEMBLY method as shown in Table 1 below.
[0027] Primer Name Primer Description Primer Base Sequence (5'→3') Sequence List No. CdGI_F Forward Primer CCGCGCGGCAGCCATATGATGGCGTATTTCGAAAACGT11CdGI_R Reverse Primer GTGGTGGTGCTCGAGTTATTTTGCAAAAGCGGTCAAT12NtGI_F Forward Primer CCGCGCGGCAGCCATATGTCTTATTTCAAGAACATATCGA13NtGI_R Reverse Primer GTGGTGGTGCTCGAGCTAATCGACACGCATGATGTACCGA14PcGI_F Forward Primer CCGCGCGGCAGCCATATGTCTTATTTCAACACCATCAACG15PcGI_R Reverse Primer GTGGTGGTGCTCGAGTTAACGGGTTGCACAAACTTC16PtGI_F Forward Primer CCGCGCGGCAGCCATATGCCTTATTTCAACAACATCCGC17PtGI_R Reverse Primer GTGTGGTGGTGCTCGAGTTAACGGGTTGCGCAAAC18AtGI_F Forward Primer CCGCGCGGCAGCCATATGGCTTATTTCCCAAATATCGAG19AtGI_R Reverse Primer GTGGTGGTGCTCGAGTTATCGCGCTGCGCAAACG20
[0028] * Forward primer restriction enzyme site: NdeI
[0029] * Reverse primer restriction enzyme site: XhoI
[0030] In Table 1 above, CdGI_F and CdGI_R are a primer set for amplifying the xylose isomerase gene derived from the Caldibacillus debilis strain and consisting of the amino acid sequence of SEQ ID NO. 1; NtGI_F and NtGI_R are a primer set for amplifying the xylose isomerase gene derived from the Novibacillus thermophiles strain and consisting of the amino acid sequence of SEQ ID NO. 3; PcGI_F and PcGI_R are a primer set for amplifying the xylose isomerase gene derived from the Paragiobacillus caldoxylosilyticus strain and consisting of the amino acid sequence of SEQ ID NO. 5; and PtGI_F and PtGI_R are a primer set derived from the Paragiobacillus thermoglucosidasius strain and SEQ ID NO A primer set for amplifying a xylose isomerase gene consisting of the amino acid sequence of 7, and AtGI_F and AtGI_R are primer sets for amplifying a xylose isomerase gene derived from the Anoxybacillus tepidamans strain and consisting of the amino acid sequence of SEQ ID NO. 9.
[0031]
[0032] Subsequently, polymerase chain reaction (PCR) was performed using the genomic DNA of each of the following strains as templates: Caldibacillus debilis, Novibacillus thermophiles, Paragiobacillus caldoxylosilyticus, Paragiobacillus thermoglucosidasius, and Anoxybacillus tepidamans, respectively, and the primer set listed in Table 1 above. Analysis of the nucleotide sequences of the obtained amplification products confirmed that they matched the nucleotide sequences provided by the NCBI database.
[0033]
[0034] Example 2: Preparation of a recombinant expression vector for xylose isomerase expression and a transformed recombinant strain
[0035] Five types of recombinant expression vectors were constructed by ligating each of the five polynucleated fragments encoding xylose isomerases obtained in Example 1 to the restriction enzyme sites of the plasmid expression vector pET28(+)a(Novagen). Subsequently, each of the five types of recombinant expression vectors was introduced into E. coli and transformed to produce five types of recombinant E. coli. A 20% glycerin solution was added to the produced recombinant E. coli, and they were frozen and stored at -70°C before culture for enzyme expression.
[0036]
[0037] Example 3: Preparation of xylose isomerase
[0038] The recombinant E. coli prepared in Example 2 was inoculated into LB medium (Luria-Bertani broth) containing a select marker antibiotic and cultured at a stirring condition of 200 rpm and a temperature of 37°C. Subsequently, when the absorbance of the culture medium at 600 nm reached 0.6 to 0.8, IPTG (Isopropyl-β-D-1-thiogalactopyranoside) was added to a concentration of 0.1 mM to induce overexpression of the target enzyme. From the point of overexpression induction, the culture was maintained for approximately 16 hours under conditions of 16°C and 150 rpm. Afterward, the culture medium of the recombinant strain was centrifuged at 13,000 rpm and 4°C for 30 minutes to remove the supernatant, and the recombinant strain cells were recovered. Subsequently, the recovered recombinant strain cells were washed twice with 0.85% saline solution. Subsequently, the cells of the recombinant strain were suspended in a buffer solution and lysed using a press device. Afterward, the lysed cell solution was centrifuged at 13,000 rpm and 4°C for 10 minutes to obtain the supernatant, and the obtained supernatant was filtered through a 0.45 µm syringe filter. The enzymes present in the filtered supernatant were His-Tag purified using Ni-NTA resin and Sephadex G-25 resin (Cytiva, USA), and five types of enzymes were obtained.
[0039]
[0040] Example 4: Measurement of the glucose-to-fructose conversion activity of xylose isomerase
[0041] The xylose isomerase obtained in Example 3 was added to a Tris-HCl buffer solution (pH 7.0) containing 100 mM glucose and 10 mM magnesium ions (derived from MgSO4) at a concentration of 0.5 mg / mL, and the reaction was carried out at 60°C for 12 hours. Afterward, the amount of fructose present in the reaction product was analyzed by HPLC, and the conversion rate of glucose to fructose was calculated.
[0042] Figure 1 shows the results of measuring the conversion rate of glucose to fructose for each of the five types of xylose isomerases in Example 4 of the present invention. The meanings of the abbreviations listed on the X-axis of Figure 1 are as follows.
[0043] * CdGI: Xylose isomerase derived from the strain Caldibacillus debilis and composed of the amino acid sequence of SEQ ID No. 1
[0044] * NtGI: Xylose isomerase derived from the Novibacillus thermophiles strain and composed of the amino acid sequence of SEQ ID No. 3
[0045] * PcGI: Xylose isomerase derived from the strain Paragiobacillus caldoxylosilyticus and composed of the amino acid sequence of SEQ ID No. 5
[0046] * PtGI: Xylose isomerase derived from the strain Paragiobacillus thermoglucosidasius and composed of the amino acid sequence of SEQ ID No. 7
[0047] * AtGI: Xylose isomerase derived from the strain Anoxybacillus tepidamans and composed of the amino acid sequence of SEQ ID No. 9
[0048]
[0049] As shown in Figure 1, the xylose isomerase derived from the Caldibacillus debilis strain and composed of the amino acid sequence of SEQ ID NO. 1 exhibited a significantly higher conversion rate of glucose to fructose compared to xylose isomerase derived from other strains. Subsequently, the characteristics of CdGI, a xylose isomerase derived from the Caldibacillus debilis strain, were investigated.
[0050]
[0051] Example 5: Confirmation of Biological Characteristics of Xylose Isomerase Derived from Caldibacillus debilis Strain
[0052] (1) Optimal reaction pH
[0053] To determine the optimal reaction pH of xylose isomerase derived from the Caldibacillus debilis strain, a buffer solution having a specified pH range was prepared as follows.
[0054] * Phosphate-buffered saline buffer (pH 6.0–7.0); Tris-HCl buffer (pH 7.0–8.0)
[0055] Subsequently, xylose isomerase derived from the Caldibacillus debilis strain was added to a buffer solution containing 100 mM glucose and 10 mM magnesium ions at a concentration of 0.5 mg / mL, and the reaction was carried out at 60°C for 15 minutes. Afterward, hydrochloric acid was added to the reaction product at a concentration of 1 g / L to terminate the reaction, and the relative activity of the xylose isomerase was calculated by measuring the amount of fructose present in the reaction product. Figure 2 shows the results of measuring the relative activity of xylose isomerase derived from the Caldibacillus debilis strain according to the reaction pH in an example of the present invention. As shown in Figure 2, the optimal reaction pH of the xylose isomerase derived from the Caldibacillus debilis strain was found to be 6.0 to 7.5, preferably 6.5 to 7.25.
[0056]
[0057] (2) Optimal reaction temperature
[0058] Xylose isomerase derived from the Caldibacillus debilis strain was added to a phosphate-buffered saline buffer solution (pH 7.0) containing 100 mM glucose and 10 mM magnesium metal ions at a concentration of 0.5 mg / mL and reacted for 15 minutes at various temperatures. Afterward, hydrochloric acid was added to the reaction product at a concentration of 1 g / L to terminate the reaction, and the relative activity of the xylose isomerase was calculated by measuring the amount of fructose present in the reaction product. Figure 3 shows the results of measuring the relative activity of xylose isomerase derived from the Caldibacillus debilis strain according to the reaction temperature in an example of the present invention. As shown in Figure 3, the optimal reaction temperature of the xylose isomerase derived from the Caldibacillus debilis strain was found to be 60 to 90°C, preferably 70 to 85°C.
[0059]
[0060] (3) Optimum metal ion
[0061] Xylose isomerase derived from the Caldibacillus debilis strain was added to a phosphate-buffered saline buffer solution (pH 7.0) containing 100 mM glucose and 10 mM metal ion precursors at a concentration of 0.5 mg / mL, and the reaction was carried out at 85°C for 15 minutes. The metal ions used were divalent metal ions, including magnesium, cobalt, manganese, zinc, calcium, and iron. Subsequently, hydrochloric acid was added to the reaction product to a concentration of 1 g / L to terminate the reaction, and the relative activity of the xylose isomerase was calculated by measuring the amount of fructose present in the reaction product. Figure 4 shows the results of measuring the relative activity of xylose isomerase derived from the Caldibacillus debilis strain according to the type of metal ion acting as a cocatalyst in an embodiment of the present invention. As shown in Figure 4, the optimal reaction cocatalyst for xylose isomerase derived from the Caldibacillus debilis strain is magnesium ions (Mg 2+ ) and cobalt ions (Co 2+ It was confirmed that it is ).
[0062]
[0063] Example 6: Investigation of the thermal stability of xylose isomerase derived from the Caldibacillus debilis strain
[0064] Xylose isomerase derived from the Caldibacillus debilis strain was added to a phosphate-buffered saline buffer solution (pH 7.0) containing 10 mM magnesium metal ions at a concentration of 0.5 mg / mL and left at preset temperatures (60℃, 65℃, 70℃, 75℃, 80℃) and for preset times. Subsequently, glucose was added to the phosphate-buffered saline buffer solution (pH 7.0) at a concentration of 100 mM and reacted at 85℃ for 15 minutes. Afterward, hydrochloric acid was added to the reaction product at a concentration of 1 g / L to terminate the reaction, and the relative activity of xylose isomerase was calculated by measuring the amount of fructose present in the reaction product. Figure 5 shows the results of investigating thermal stability by reacting a xylose isomerase derived from the Caldibacillus debilis strain after leaving it at various temperatures in an embodiment of the present invention. In Figure 5, the X-axis represents the time (hr) during which the xylose isomerase is left at a given temperature, and the Y-axis represents the relative activity of the xylose isomerase. As shown in Figure 5, the half-life at which the activity of the xylose isomerase derived from the Caldibacillus debilis strain is reduced by half was found to be approximately 9 hr at 70°C, approximately 4.5 hr at 75°C, and approximately 1.5 hr at 80°C.
[0065]
[0066] Although the present invention has been described above through the embodiments, the scope of protection of the present invention is not necessarily limited thereto, and it is understood that various modifications are possible within the scope and spirit of the present invention. Accordingly, the scope of protection of the present invention is not limited to the specific embodiment disclosed as the best mode, but should be interpreted to include all embodiments falling within the scope of the claims appended to the present invention.
Claims
1. A method for producing fructose comprising the step of adding a xylose isomerase consisting of the amino acid sequence of SEQ ID NO. 1 to a glucose-containing solution and carrying out an isomerization reaction.
2. A method for producing fructose according to claim 1, characterized in that the glucose-containing solution has a glucose content of 90% (w / w) or more based on the weight of the sugar solids.
3. A method for producing fructose according to claim 2, characterized in that the glucose-containing solution is a starch saccharification solution obtained by hydrolyzing a starch liquefaction solution with γ-amylase.
4. A method for producing fructose according to claim 1, characterized in that the isomerization reaction temperature is 60 to 90°C and the reaction pH is 6.0 to 7.
5.
5. A method for producing fructose according to claim 1, characterized in that the glucose-containing solution comprises magnesium ions or cobalt ions as a co-catalyst.
6. A method for producing fructose according to claim 1, characterized in that the glucose-containing solution is a PBS (Phosphate-buffered saline) buffer solution containing glucose or a Tris-HCl buffer solution containing glucose.
7. A method for producing fructose according to claim 1, further comprising the step of filtering and purifying the isomerization reaction product to obtain a fructose-containing solution.
8. A method for producing fructose according to claim 7, characterized in that the fructose-containing solution has a fructose content of 40% (w / w) or more based on the total weight of the sugar solids.