Gradient microfluidic chip for drug screening for fabry disease kidney organoids

The gradient microfluidic chip system addresses the limitations of existing organoid culture by inducing angiogenesis and differentiation, improving physiological functions and drug sensitivity, enabling effective drug screening for Fabry disease.

WO2026084234A1PCT designated stage Publication Date: 2026-04-23THE CATHOLIC UNIV OF KOREA IND ACADEMIC COOP FOUND
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
THE CATHOLIC UNIV OF KOREA IND ACADEMIC COOP FOUND
Filing Date
2025-08-26
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Existing organoid culture methods lack cellular diversity and organization, hindering their utility as accurate disease models or drug screening platforms, and fail to replicate organ function at a human level, especially for rare diseases like Fabry disease, due to limitations in replicating organ function and long-term culture.

Method used

A gradient microfluidic chip system that cultures organoids at four constant drug concentration gradients with a continuous flow, inducing angiogenesis and differentiation, enhancing physiological functions, and facilitating nutrient and drug supply, enabling high drug sensitivity and concentration-dependent therapeutic effect confirmation.

Benefits of technology

The system improves the differentiation, maturation, and functional potential of renal organoids, enhancing drug sensitivity and allowing rapid and effective drug screening, with applications in drug screening and treatment of Fabry disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025012996_23042026_PF_FP_ABST
    Figure KR2025012996_23042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a gradient microfluidic chip for drug screening, a drug screening method using same, and a drug screening method for preventing or treating Fabry disease by using same. More specifically, the present invention relates to a gradient microfluidic chip having a structure capable of culturing and differentiating organoids at four constant drug concentration gradients together with continuous medium flow. When the gradient microfluidic chip for drug screening according to the present invention is used, the physiological function of organoids is improved by inducing the vascularization and differentiation of the organoids, thereby enabling reproduction of an organ at a human body level better than existing organoids, nutrients and various concentrations of a drug are smoothly supplied, and drug permeability is increased. Thus, a concentration-dependent therapeutic effect of a drug can be confirmed with high drug sensitivity, and therefore the gradient microfluidic chip enables rapid and effective drug screening.
Need to check novelty before this filing date? Find Prior Art

Description

Gradient microfluidic chip for drug screening of Fabry disease kidney organoids

[0001] This patent application claims priority to Korean Patent Application No. 10-2024-0141984, filed with the Korean Intellectual Property Office on October 17, 2024, the disclosures of said patent application are incorporated herein by reference.

[0002] The present invention relates to a gradient microfluidic chip for drug screening, a drug screening method using the same, and a drug screening method for the prevention or treatment of Fabry disease using the same.

[0003] The complex functions of the renal system are essential for maintaining homeostasis within the human body, regulating fluid balance and electrolyte levels, and eliminating metabolic waste. Understanding the physiology and pathophysiology of the kidneys is crucial for developing effective treatments for kidney diseases. However, existing in vitro models have often been insufficient to replicate the complexity of kidney tissue.

[0004] Over the past few years, the development of renal organoids has revolutionized the ability to model renal diseases in vitro, providing a physiologically relevant platform for investigating disease mechanisms and screening potential therapies. These miniaturized three-dimensional (3D) structures provide a holistic model for studying complex disease processes by reproducing key aspects of renal physiology, including nephron-like structures, podocytes, tubular epithelial cells, and endothelial cells. Furthermore, renal organoids serve as a valuable platform for high-throughput screening of potential therapeutic agents and offer a more physiologically relevant context than traditional cell culture models. Consequently, the ability to reproduce the cellular diversity and functional complexity of the natural kidney has established renal organoids as an indispensable tool for enhancing our understanding of renal diseases and accelerating the development of new therapeutic methods.

[0005] Unfortunately, existing organoid culture methods still have limitations. These cultures often lack the cellular diversity and organization found in native organs, hindering their utility as accurate disease models or drug screening platforms. Furthermore, scalability, reproducibility, and long-term maintenance remain significant challenges for conventional organoid culture systems. To overcome these limitations, new methods utilizing microfluidic technology have garnered attention in recent years. Microfluidic systems are capable of simulating biomechanical stimuli, such as electrical signals, shear stress, and mechanical stretching, which are crucial for inducing cell maturation and development. Additionally, microfluidic systems enable precise control of the organoid microenvironment, facilitating nutrient delivery, waste removal, and the establishment of physiological gradients. Many researchers have demonstrated that culturing organoids within microfluidic devices can enhance the fidelity of disease models and improve drug responses with greater physiological relevance by replicating the dynamic interactions between cells and soluble factors found in vivo. Physiological relevance is a critical parameter for investigating complex disease mechanisms, such as abnormal crosstalk between endothelial cells, tubular epithelial cells, and other cell types in disease models. Therefore, research results obtained from physiologically relevant models enhance reliability and increase the likelihood of successful transition from the laboratory to clinical settings. Furthermore, studying diseases within a relevant context allows for the discovery of new drug treatment strategies and enables the mitigation of potential drug-induced risks as well as therapeutic efficacy.

[0006] Fabry disease is a rare genetic metabolic disorder inherited in an X-linked recessive manner, classified as a lysosomal storage disorder caused by the deficiency or absence of α-galactosidase A (GAL), a hydrolytic enzyme found in lysosomes. Although further exploration into the pathological mechanisms of Fabry disease affecting the kidney and the development of new drugs are necessary, research is not actively being conducted due to the small number of patients associated with the rare nature of the disease. For this reason, a Fabry disease kidney organoid was developed by combining gene editing technology and organoid technology; however, despite the advantages of organoids in specifically mimicking organs, several limitations exist. It fails to replicate organ function to the level of a real human body, and long-term culture is not possible due to the lack of blood vessels, which prevents a smooth supply of nutrients. Consequently, drug sensitivity is also low, making it difficult to introduce them into drug screening.

[0007] There is a need to develop a platform that can overcome these limitations of organoids while simultaneously enabling rapid and effective drug screening.

[0008] [Prior Art Literature]

[0009] [Non-patent literature]

[0010] (Non-patent Document 1) Stamerra CA, Del Pinto R, di Giosia P, Ferri C, Sahebkar A. Anderson-Fabry Disease: From Endothelial Dysfunction to Emerging Therapies. Adv Pharmacol Pharm Sci. 2021 May 13;2021:5548445. (Publication date 2021-05-13)

[0011] (Non-patent Document 2) Charbonier FW, Zamani M, Huang NF. Endothelial Cell Mechanotransduction in the Dynamic Vascular Environment. Adv Biosystem. 2019 Feb;3(2):e1800252. doi: 10.1002 / adbi.201800252. Epub 2018 Nov 25. (Published date 2018-11-25)

[0012] Accordingly, the inventors developed a gradient microfluidic chip structure capable of culturing and differentiating organoids at four constant drug concentration gradients along with a continuous flow of culture medium, thereby inducing angiogenesis and differentiation of organoids to improve their physiological functions and ensuring a smooth supply of nutrients and drugs, and thus completing the development of a gradient microfluidic chip platform for drug screening that can confirm concentration-dependent therapeutic effects with high drug sensitivity.

[0013] Accordingly, the object of the present invention is to provide a gradient microfluidic chip for drug screening comprising a culture medium inlet, a drug inlet, a gradient channel forming a fluid with a constant drug concentration gradient, an organoid culture channel, a microchannel, and an outlet.

[0014] Another objective of the present invention is to provide a drug screening method using the gradient microfluidic chip for drug screening described above.

[0015] Another objective of the present invention is to provide a drug screening method for the prevention or treatment of Fabry disease using the gradient microfluidic chip for drug screening described above.

[0016] Another objective of the present invention is to provide a method for manufacturing a gradient microfluidic chip for drug screening according to the present invention.

[0017] The present invention relates to a gradient microfluidic chip for drug screening, a drug screening method using the same, and a drug screening method for the prevention or treatment of Fabry disease using the same. More specifically, the invention relates to a gradient microfluidic chip having a structure capable of culturing and differentiating organoids at four constant drug concentration gradients along with a continuous flow of culture medium. When using the gradient microfluidic chip for drug screening according to the present invention, the angiogenesis and differentiation of the organoid are induced to improve the physiological function of the organoid, thereby enabling the organ to be reproduced at a human level compared to existing organoids (improved reproducibility). Furthermore, by facilitating the smooth supply of nutrients and drugs of various concentrations and increasing drug permeability, the concentration-dependent therapeutic effect of the drug can be confirmed with high drug sensitivity, thereby enabling rapid and effective drug screening.

[0018] In addition, the gradient microfluidic chip according to the present invention can analyze three organoids per concentration at four constant drug concentrations, thereby enabling the simultaneous analysis of a total of 12 organoids.

[0019] In addition, the gradient microfluidic chip according to the present invention i) can be mass-produced due to a simple manufacturing method, allowing multiple organoids to be cultured simultaneously; ii) can precisely reproduce the physiological functions of human organs by efficiently inducing differentiation and maturation of organoids; iii) can also mimic the pathological characteristics of Fabry disease similarly to the human body; iv) can improve drug sensitivity compared to existing organoids through organoids within the gradient microfluidic chip, enabling more accurate drug screening; v) can be used in future research on new treatments or therapeutic drugs for Fabry disease through the present invention, and can be applied to basic research, disease research, new drug discovery, and drug screening of kidney organoids induced with Fabry disease as well as other diseases, and organoids reproducing various other organs such as the heart, brain, and skin.

[0020] The development of kidney organoids provides a biochemical platform for investigating disease mechanisms and drug screening. These three-dimensional (3D) constructs summarize key aspects of the human kidney, aiding in the study of complex disease processes. However, existing in vitro models do not fully reflect the complexity of native tissues. To address this issue, it is necessary to develop a new culture system that supports the differentiation of physiologically enhanced kidney organoids.

[0021] The present invention provides a gradient microfluidic chip system capable of enhancing the differentiation, maturation, and function of normal and Fabry disease renal organoids. Efficacy verification confirmed that fluid flow culture conditions promote superior angiogenesis, glucose uptake, and gene expression related to renal maturation compared to static culture conditions. Furthermore, the increased expression of specific markers and the upregulation of renal-related genes in the gradient microfluidic chip system of the present invention effectively enhanced the differentiation, maturation, and functional potential of normal and Fabry disease renal organoids. Additionally, the gradient microfluidic chip system of the present invention demonstrates enhanced sensitivity in detecting therapeutic effects, such as the recovery of physiological characteristics following enzyme replacement therapy (ERT) and oxidative stress treatment. Moreover, the gradient microfluidic chip developed in the present invention promotes physiological improvement in the differentiation and maturation of normal and Fabry disease renal organoids. Therefore, the physiologically enhanced renal organoid model of the present invention can be used as a novel in vitro culture system for drug screening applications.

[0022] The present invention will be described in more detail below.

[0023] One embodiment of the present invention is a culture medium injection port (100) into which a culture medium is injected;

[0024] A drug injection port (200) into which a drug is injected;

[0025] A gradient channel (300) comprising at least two micro-branching channels (311, 314) respectively connected to the culture medium inlet (100) and the drug inlet (200), and at least one micro-branching channel (312, 313) joined and connected to the culture medium inlet (100) and the drug inlet (200), and at least three micro-mixing channels (351, 352, 353) respectively connected to the micro-branching channels (311, 312, 313, 314), forming a fluid with a constant drug concentration gradient;

[0026] An organoid culture channel (400) connected to the gradient channel (300), wherein a microchannel (450) connected to each of the micromixing channels (351, 352, 353) is disposed at the bottom of the organoid culture channel (400), and each of the microchannels (450) comprises at least three microwells (402) (411, 412, 413) (421, 422, 423) (431, 432, 433) (441, 442, 443) disposed along the longitudinal direction of the microchannel; and

[0027] An outlet (500) connected to the above microchannel (450) and through which the fluid is discharged;

[0028] It is a gradient microfluidic chip (1) for drug screening that includes

[0029] In one embodiment of the present invention, the micro-branched channels may be 3 to 10, 4 to 10, 4 to 8, 4 to 6, 3, 4, 6, 8, or 10.

[0030] In one embodiment of the present invention, the micromixing channels may be at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3, or 4.

[0031] In the present invention, the micromixing channels (351, 352, 353) include micro-protrusions (360) that are arranged alternately on the left and right sides of the inner wall of the micromixing channel, forming an angle of 30° to 60°, 30° to 50°, 35° to 60°, 35° to 55°, 35° to 50°, 40° to 60°, 40° to 55°, 40° to 50°, 30°, 35°, 40°, 45°, 50°, 55°, or 60° with respect to the fluid flow direction.

[0032] In one embodiment of the present invention, the thickness of the micro-protrusion (360) may be 10 to 500 μm, 10 to 400 μm, 10 to 300 μm, 10 to 200 μm, 50 to 500 μm, 50 to 400 μm, 50 to 300 μm, 50 to 200 μm, for example, 100 μm, and the spacing between the micro-protrusions may be 50 to 600 μm, 50 to 500 μm, 50 to 400 μm, 50 to 300 μm, 50 to 200 μm, 100 to 600 μm, 100 to 500 μm, 100 to 400 μm, 100 to 300 μm, 100 to 200 μm, for example, It can be 140 μm.

[0033] In the present invention, the micromixing channels (351, 352, 353) have a structure bent in a 'ㄹ' pattern or a zigzag pattern.

[0034] In the present invention, the culture medium inlet (100) is connected to the first and second micro-branching channels (311, 312), and the drug inlet (200) is connected to the third and fourth micro-branching channels (313, 314). The first and fourth micro-branching channels (311, 314) are each connected to the first and third micro-mixing channels (351, 353), respectively. The second micro-branching channel (312) connected to the culture medium inlet (100) and the third micro-branching channel (313) connected to the drug inlet (200) merge and are connected to the second micro-mixing channel (352).

[0035] In the present invention, the first micromixing channel (351) is additionally connected to the fifth and sixth microbranching channels (315, 316), the second micromixing channel (352) is additionally connected to the seventh and eighth microbranching channels (317, 318), and the third micromixing channel (353) is additionally connected to the ninth and tenth microbranching channels (319, 320).

[0036] The fifth micro-branching channel (315) is connected to the fourth micro-mixing channel (354), the sixth and seventh micro-branching channels (316, 317) merge to be connected to the fifth micro-mixing channel (355), the eighth and ninth micro-branching channels (318, 319) merge to be connected to the sixth micro-mixing channel (356), and the tenth micro-branching channel (320) is connected to the seventh micro-mixing channel (357).

[0037] In the present invention, the gradient channel (300) has at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3, or 4 constant concentration gradient points in the fluid within the channel.

[0038] In one embodiment of the present invention, the gradient channel (300) may have three concentration gradient points corresponding to 100%, 50%, and 0% of the drug concentration injected into the drug infusion port (200). For example, when a drug is injected into the drug infusion port at a concentration of 3 μg / mL, the gradient channel may have concentration gradient points of 3, 1.5, and 0 μg / mL.

[0039] In a preferred embodiment of the present invention, the gradient channel (300) may have four concentration gradient points corresponding to 100%, 75%, 25%, and 0% of the drug concentration injected into the drug infusion port (200). For example, when a drug is injected into the drug infusion port at a concentration of 3 μg / mL, the gradient channel may have concentration gradient points of 3, 2.25, 0.75, and 0 μg / mL.

[0040] In the present invention, the microfluidic chip (1) is connected to the culture medium inlet (100) and the drug inlet (200) and further comprises a pump that supplies fluid to the microchannel (450) at a flow rate of 9 to 15 μL / min, 9 to 14 μL / min, 9 to 13 μL / min, 10 to 15 μL / min, 10 to 14 μL / min, 10 to 13 μL / min, 11 to 15 μL / min, 11 to 14 μL / min, 11 to 13 μL / min, 9, 12, or 15 μL / min.

[0041] In the present invention, the micro-branching channels (311-320) and micro-mixing channels (351-357) have a height of 50 to 500 μm, 50 to 400 μm, 50 to 300 μm, 100 to 500 μm, 100 to 400 μm, 100 to 300 μm, 150 to 500 μm, 150 to 400 μm, 150 to 300 μm, 200 to 500 μm, 200 to 400 μm, or 200 to 300 μm, for example, 250 μm.

[0042] In the present invention, the organoid culture channel (400) (410, 420, 430, 440) has a diameter of 0.5 to 5 mm, 0.5 to 4 mm, 0.5 to 3 mm, 1 to 5 mm, 1 to 4 mm, or 1 to 3 mm, for example, 2 mm, and a height of 5 to 15 mm, 5 to 14 mm, 5 to 13 mm, 5 to 12 mm, 5 to 11 mm, 7 to 15 mm, 7 to 14 mm, 7 to 13 mm, 7 to 12 mm, 7 to 11 mm, 9 to 15 mm, 9 to 14 mm, 9 to 13 mm, 9 to 12 mm, 9 to 11 mm, for example, 10 mm.

[0043] In the present invention, the microchannel (450) has a diameter of 1 to 11 mm, 1 to 9 mm, 1 to 7 mm, 1 to 5 mm, 1 to 4 mm, 2 to 11 mm, 2 to 9 mm, 2 to 7 mm, 2 to 5 mm, or 2 to 4 mm, for example, 3 mm, and a height of 50 to 500 μm, 50 to 400 μm, 50 to 300 μm, 100 to 500 μm, 100 to 400 μm, 100 to 300 μm, 200 to 500 μm, 200 to 400 μm, or 200 to 300 μm, for example, 250 μm.

[0044] In the present invention, the organoid culture channel (400) (410, 420, 430, 440) is connected to one identical micromixing (351-357) channel and includes at least three microwells (402) (411, 412, 413) (421, 422, 423) (431, 432, 433) (441, 442, 443) arranged in a row and connected to each other, and the microwells are connected to each other through a microchannel (450) arranged below the organoid culture channel (400) (410, 420, 430, 440).

[0045] In the present invention, the discharge outlets (500) are at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3, or 4.

[0046] In one embodiment of the present invention, the gradient microfluidic chip (1) for drug screening may be made of glass, plastic resin, or polydimethylsiloxane (PDMS). The glass may be, for example, silicate glass, phosphate glass, or borosilicate glass, but is not limited thereto. The plastic resin may be, for example, polydimethylsiloxane, polyurethane, polyvinyl chloride, ABS, polyacetal, polypropylene, polyethylene, modified polyphenylene oxide, polybutylene terephthalate, phenolic resin, fluoropolymer, polyester, polyimide, polyamide, or polycarbonate, but is not limited thereto. When polydimethylsiloxane is used in the fabrication of the gradient microfluidic chip, the polydimethylsiloxane may be a monomer to curing agent mixture with a ratio of 5:1 to 15:1, but is not limited thereto.

[0047] In one embodiment of the present invention, the culture medium inlet (100) and the drug inlet (200) are passages through which culture medium and drug are supplied from a peristaltic pump to a microfluidic chip, respectively, and may have a height and width such as a micro-branched channel so that fluid can be supplied at a constant flow rate and velocity without leakage, and may be selected without limitation as long as the shape allows the culture medium to be stably injected.

[0048] In one embodiment of the present invention, the discharge port (500) is a passage through which a drug, culture medium, or a mixture thereof that has passed through the gradient microfluidic chip (1) is discharged, and can be selected without limitation as long as it is a shape that can generate a flow of fluid within the gradient microfluidic chip (1) and discharge the fluid at a constant flow rate and velocity without leakage.

[0049] In one embodiment of the present invention, the microwells (411, 412, 413)(421, 422, 423)(431, 432, 433)(441, 442, 443) are places for culturing organoids, and the organoid to be cultured can be cultured by placing the organoid to be cultured in the microwells (450) at the bottom and supplying a culture medium, a drug, or a mixture thereof.

[0050] Another aspect of the present invention is a drug screening method using the above-described gradient microfluidic chip (1) for drug screening, comprising the following steps:

[0051] A step of culturing an organoid in the above organoid culture channel; and

[0052] Step of injecting a test drug into the above drug injection port.

[0053] In the present invention, the organoid may be treated with at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3, or 4 different drug concentrations in an organoid culture channel (400).

[0054] In the present invention, the organoid may be one or more organoids selected from the group consisting of kidney, brain, skin, heart, optic cup, liver, pancreas, bile duct, neural tube, stomach, large intestine, small intestine, prostate, breast, salivary gland, endometrium, mammary gland, thyroid, tongue, esophagus, lung, blood vessel, muscle and adrenal cortex.

[0055] In the present invention, the organoid may be a Fabry disease-mimicking kidney organoid obtained by culturing stem cells in which the GLA (galactosidase alpha) gene has been knocked out.

[0056] In one embodiment of the present invention, the method may further include an organoid generation and differentiation step in which stem cells isolated from a target prior to the culture step are cultured in a feeder-free culture medium containing an extracellular matrix.

[0057] In one embodiment of the present invention, the medium may further comprise a GSK-3 inhibitor and / or a B27 supplement. The GSK-3 inhibitor may be CHIR or CHIR 99021.

[0058] In one embodiment of the present invention, the extracellular matrix may be a basement membrane extract comprising one or more selected from the group consisting of laminin, collagen IV, entactin, and heparin sulfate proteoglycan, for example, Geltrex.

[0059] In one embodiment of the present invention, the organoid generation and differentiation step may be performed for 10 to 20 days, 10 to 18 days, 12 to 20 days, 12 to 18 days, 14 to 20 days, 14 to 18 days, 15 to 20 days, 15 to 19 days, 15 to 18 days, 15 to 17 days, 14 days, 15 days, 16 days, 17 days, or 18 days.

[0060] In one embodiment of the present invention, the subject is a mammal. In another embodiment of the present invention, the subject is a human. In yet another embodiment of the present invention, the subject may be any one selected from the group consisting of a mouse, a rat, a dog, a cat, a rabbit, a cow, a sheep, a pig, a goat, and a monkey.

[0061] In one embodiment of the present invention, the gradient microfluidic chip for drug screening may be coated with an extracellular matrix of 1 to 10%, 2 to 10%, 4 to 10%, 1 to 8%, 2 to 8%, 4 to 8%, 1 to 6%, 2 to 6%, or 4 to 6% for 30 minutes to 4 hours, 30 minutes to 3 hours, or 1 hour to 3 hours.

[0062] In one embodiment of the present invention, the extracellular matrix may be a basement membrane extract comprising one or more selected from the group consisting of laminin, collagen IV, entactin, and heparin sulfate proteoglycan, for example, Geltrex.

[0063] Another aspect of the present invention is a drug screening method for the prevention or treatment of Fabry disease using the gradient microfluidic chip for drug screening described above, comprising the following steps:

[0064] A step of culturing a Fabry disease-mimicking kidney organoid obtained by culturing stem cells in which the GLA (galactosidase alpha) gene has been knocked out in the above organoid culture channel;

[0065] A step of injecting a test drug into the above drug injection port; and

[0066] A step of measuring the accumulation of Gb3 (globotriaosylceramide), mitochondrial activity, or the production of reactive oxygen species (ROS) in the above Fabry disease-mimicking kidney organoid.

[0067] In the present invention, the method may further include the step of determining the test drug as a candidate drug for the prevention or treatment of Fabry disease if, compared to an organoid not treated with the test drug, the amount of Gb3 accumulation decreases, mitochondrial activity decreases, or the amount of reactive oxygen species produced decreases in an organoid treated with the test drug.

[0068] In one embodiment of the present invention, knocking out the GLA gene may be done by knocking out the GLA gene in stem cells through CRISPR / Cas9 genome editing.

[0069] In one embodiment of the present invention, knocking out the GLA gene can be achieved by transfecting a stem cell with a gRNA comprising a nucleotide sequence represented by SEQ ID NO. 1 specific to the GLA gene and a Cas9 nuclease.

[0070] In one embodiment of the present invention, the stem cells may be induced pluripotent stem cells, embryonic stem cells, mesenchymal stem cells (MSCs), adult stem cells, or stem cells derived from kidney tissue.

[0071] In this invention, the term "Fabry disease mimicking kidney organoid," also referred to as "Fabry disease kidney organoid" in this invention, means a kidney organoid that reproduces the characteristics of Fabry disease by knocking out the GLA (galactosidase alpha) gene.

[0072] Another aspect of the present invention is a method for manufacturing the above-described gradient microfluidic chip (1) for drug screening, comprising the following steps:

[0073] A culture medium inlet (100); a drug inlet (200); a gradient channel (300) comprising at least two micro-branching channels (311, 314) respectively connected to the culture medium inlet (100) and the drug inlet (200), and at least one micro-branching channel (312, 313) joined and connected to the culture medium inlet (100) and the drug inlet (200), and comprising at least three micro-mixing channels (351, 352, 353) respectively connected to the micro-branching channels (311, 312, 313, 314), forming a fluid with a constant drug concentration gradient; at least three organoid culture channels (400) respectively connected to the at least three micro-mixing channels (351, 352, 353); and a microchannel (450) disposed below the organoid culture channels (400). A step of producing a photomask such that it is equipped with an outlet (500) connected to the organoid culture channel (400) and through which the fluid is discharged;

[0074] Step of depositing photoresist on a silicon wafer;

[0075] A step of placing the photomask on the photoresist and exposing it to UV light;

[0076] A step of developing the above photoresist to produce a master mold;

[0077] The step of pouring polydimethylsiloxane (PDMS) into the above master mold and curing it; and

[0078] A step of separating the silicon wafer and attaching the generated polydimethylsiloxane (PDMS) cured product to a glass substrate.

[0079] In one embodiment of the present invention, the polydimethylsiloxane (PDMS) may be a mixture of monomer and curing agent in a ratio of 5:1 to 15:1.

[0080] In one embodiment of the present invention, after the step of attaching to the glass substrate, the step of forming a culture medium inlet, a drug inlet, and an outlet in the polydimethylsiloxane (PDMS) cured product may be further included.

[0081] In one embodiment of the present invention, after the step of forming the culture medium inlet, drug inlet, and outlet, the step of coating the gradient microfluidic chip (1) for drug screening with an extracellular matrix may be further included.

[0082] In one embodiment of the present invention, the extracellular matrix may be a basement membrane extract comprising one or more selected from the group consisting of laminin, collagen IV, entactin, and heparin sulfate proteoglycan, for example, Geltrex.

[0083] The present invention relates to a gradient microfluidic chip for drug screening, a drug screening method using the same, and a drug screening method for the prevention or treatment of Fabry disease using the same. More specifically, the invention relates to a gradient microfluidic chip having a structure capable of culturing and differentiating organoids at four constant drug concentration gradients along with a continuous flow of culture medium. When using the gradient microfluidic chip for drug screening according to the present invention, the angiogenesis and differentiation of organoids are induced to improve the physiological functions of the organoids, thereby enabling the reproduction of organs at a human level compared to existing organoids. Furthermore, by facilitating the smooth supply of nutrients and drugs of various concentrations and increasing drug permeability, the concentration-dependent therapeutic effect of the drug can be confirmed with high drug sensitivity, thereby enabling rapid and effective drug screening.

[0084] FIG. 1 is a schematic diagram of a gradient microfluidic chip for drug screening of organoids according to one embodiment of the present invention.

[0085] FIG. 2 is an enlarged view of a gradient channel according to one embodiment of the present invention.

[0086] Figures 3a and 3b are enlarged views of an organoid culture channel according to one embodiment of the present invention.

[0087] FIG. 4a is a schematic diagram of a method for inducing differentiation and maturation of normal or Fabry disease kidney organoids using a gradient microfluidic chip for drug screening according to an embodiment of the present invention. Normal kidney organoids and CRISPR / Cas9 gene-edited Fabry disease kidney organoids were induced and differentiated, respectively. The two types of kidney organoids were placed in a gradient microfluidic coated with 5% Geltrex, and then a culture medium flow was applied.

[0088] FIG. 4b is a schematic diagram of a method for culturing kidney organoids according to one embodiment of the present invention. Differentiation, maturation, and precise culture conditions were optimized to form physiologically relevant kidney organoids on a gradient microfluidic chip.

[0089] FIG. 4c is a figure confirming the accumulation of Gb3 in normal or Fabry disease kidney organoids according to one embodiment of the present invention. As a result of comparing normal and Fabry disease kidney organoids, it was found that Gb3 accumulates in the Fabry disease kidney organoid. The scale bar is 50 μm.

[0090] FIG. 4d is a figure showing a computational fluid dynamics (CFD) simulation illustrating the concentration distribution of ERT treatment along the gradient channel of a gradient microfluidic chip according to one embodiment of the present invention.

[0091] Figure 4e shows the results of a CFD simulation according to one embodiment of the present invention, and is a graph showing the velocity streamlines of four organoid culture channels and the entire microchannel located below the organoid culture channels.

[0092] FIG. 4f is a histogram showing the relative concentration distribution (0-100%) across four organoid culture channels of a gradient microfluidic chip according to one embodiment of the present invention.

[0093] FIG. 4g is a figure showing the CFD simulation results of velocity profiles and shear stress gradients under various flow conditions (static, 3, 6, 9, 12, 15 μL / min) in an organoid culture channel according to one embodiment of the present invention. The central circle indicates the estimated size of the elongated organoid.

[0094] FIG. 4h is a linear graph showing the correlation between the organoid culture channel number and the relative concentration of ERT of a gradient microfluidic chip according to one embodiment of the present invention.

[0095] FIG. 4i is a linear graph showing the relationship between the flow rate and the average velocity in the organoid culture channel of a gradient microfluidic chip according to one embodiment of the present invention.

[0096] FIG. 4j is a figure showing a linear graph of the average shear stress on the surface of an organoid in an organoid culture channel of a gradient microfluidic chip according to one embodiment of the present invention.

[0097] Figures 5a to 5g confirm the effect of fluidic flow culture conditions on the differentiation of normal kidney organoids, and confirm that kidney organoids cultured under fluidic flow conditions showed enhanced differentiation and maturation.

[0098] FIG. 5a is a figure showing a representative immunofluorescence staining image of a normal kidney organoid cultured for 5 days under static or flow conditions according to one embodiment of the present invention. Cells were stained with PECAM1 (platelet endothelial cell adhesion molecule), NHPS1 (nephrin), LTL (lotus tetragonolobus lectin), and DAPI (nucleus). The scale bar is 50 μm.

[0099] FIG. 5b is a figure showing an image of FITC-dextran infiltration in a normal kidney organoid cultured under static or flow culture conditions according to one embodiment of the present invention. The scale bar is 50 μm.

[0100] FIG. 5c is a figure showing the results of quantitative analysis of a kidney antibody-specific marker (PECAM) in normal kidney organoids cultured under static and fluid flow culture conditions according to one embodiment of the present invention.

[0101] FIG. 5d is a figure showing the results of quantitative analysis of a kidney antibody-specific marker (NPHS1) in normal kidney organoids cultured under static and fluid flow culture conditions according to one embodiment of the present invention.

[0102] FIG. 5e is a figure showing the results of quantitative analysis of kidney antibody-specific markers (LTL) in normal kidney organoids cultured under static and fluid flow culture conditions according to one embodiment of the present invention.

[0103] Figure 5g is a graph showing the results of qRT-PCR analysis of NPHS1 (nephrosis 1), WT1 (Wilms' Tumor), GGT1 (gamma-glutamyltransferase 1), and ECAD (E-cadherin) in normal kidney organoids differentiated under static and fluid flow culture conditions (n=3) according to one embodiment of the present invention. Values ​​were expressed as mean ± SEM, and statistical significance was indicated as *p<0.05, **p<0.01, ***p<0.001, and measured by an unpaired Student's t-test.

[0104] Figures 6a to 6g confirm the effects of fluidic flow and static culture conditions on the differentiation of Fabry disease kidney organoids. It is a figure confirming that Fabry disease kidney organoids showed enhanced differentiation and physiological improvement under fluidic flow culture conditions compared to static culture conditions.

[0105] FIG. 6a is a figure showing representative images of immunofluorescence staining of PECAM1 (vascular network), NHPS1 (podocytes), and LTL (proximal tubules) in Fabry disease renal organelles cultured under static and fluid flow culture conditions according to one embodiment of the present invention. The scale bar is 50 μm.

[0106] FIG. 6b is a figure showing the infiltration of FITC-dextran into Fabry disease kidney organoids under static and fluid flow culture conditions according to one embodiment of the present invention. The scale bar is 50 μm.

[0107] FIG. 6c is a figure showing the results of a quantitative analysis of immunofluorescence images of PECAM1 captured in Fabry disease kidney organoids cultured under static and fluid flow culture conditions according to one embodiment of the present invention.

[0108] FIG. 6d is a figure showing the results of quantitative analysis of immunofluorescence images for NPHS1 captured in Fabry disease kidney organoids cultured under static and fluid flow culture conditions according to one embodiment of the present invention.

[0109] FIG. 6e is a figure showing the results of a quantitative analysis of immunofluorescence images of LTLs captured in Fabry disease kidney organoids cultured under static and fluid flow culture conditions according to one embodiment of the present invention.

[0110] Figure 6f is a figure showing the results of a quantitative analysis of FITC-dextran infiltration in Fabry disease kidney organoids cultured under static and fluid flow conditions according to one embodiment of the present invention.

[0111] Figure 6g shows the results of qRT-PCR analysis of NPHS1, WT1, GGT1, and ECAD in Fabry disease kidney organoids differentiated under static and fluid flow culture conditions (n=3) according to one embodiment of the present invention. Values ​​are expressed as mean ± SEM, and statistical significance was measured by an unpaired Student's t-test and indicated as *p<0.05, **p<0.01, and ***p<0.001.

[0112] Figures 7a and 7b confirm that ERT improved structural changes and reduced Gb3 accumulation in Fabry disease kidney organoids.

[0113] Figure 7a shows representative images of immunofluorescence staining of Gb3, NPHS1, and LTL in Fabry disease renal organoids treated with human recombinant galactosidase-α (rhα-GLA) as ERT according to one embodiment of the present invention. In the stained images, the arrow in the row of NPHS1 indicates the linear pattern of NPHS1, the arrows in columns 1, 4, and 5 of the row of LTL indicate tubular polarization, and the arrow in column 2 of the row of LTL indicates disrupted tubular polarization. The scale bar is 50 μm.

[0114] FIG. 7b is a graph showing the results of quantifying the percentage of Gb3 positive regions (n=3) according to one embodiment of the present invention. Values ​​are expressed as mean ± SEM, and statistical significance was determined by one-way analysis of variance using Bonferroni multiple comparison test and indicated as *p<0.05, **p<0.01, ***p<0.001.

[0115] Figure 7c is a graph showing the results of quantifying the percentage of NPHS1-positive regions (n=3) according to one embodiment of the present invention. Values ​​are expressed as mean ± SEM, and statistical significance was determined by one-way analysis of variance using Bonferroni multiple comparison test and indicated as *p<0.05, **p<0.01, ***p<0.001.

[0116] FIG. 7d is a graph showing the results of quantifying the percentage of LTL-positive regions (n=3) according to one embodiment of the present invention. Values ​​are expressed as mean ± SEM, and statistical significance was determined by one-way analysis of variance using Bonferroni multiple comparison test and indicated as *p<0.05, **p<0.01, ***p<0.001.

[0117] FIGS. 8a to 8c are figures confirming the effect of ERT alleviating oxidative stress in Fabry disease kidney organoids according to one embodiment of the present invention.

[0118] FIG. 8a shows a representative image of immunofluorescence staining with MitoSOX Red for the detection of mitochondrial peroxide (ROS) and a representative image of immunofluorescence staining with MitoTracker for mitochondrial staining according to one embodiment of the present invention.

[0119] FIG. 8b is a graph showing the results of quantifying the fluorescence intensity of the MitoSOX Red positive region as a percentage according to one embodiment of the present invention. Values ​​are expressed as mean ± SEM, and statistical significance was determined by one-way analysis of variance using Bonferroni multiple comparison test and is indicated as *p<0.05, **p<0.01, ***p<0.001. The scale bar is 50 μm.

[0120] FIG. 8c is a graph showing the results of quantifying the fluorescence intensity of the MitoTracker positive region as a percentage according to one embodiment of the present invention. Values ​​are expressed as mean ± SEM, and statistical significance was determined by one-way analysis of variance using Bonferroni multiple comparison test and is indicated as *p<0.05, **p<0.01, ***p<0.001. The scale bar is 50 μm.

[0121] The present invention comprises: a culture medium inlet for injecting a culture medium; and a drug inlet for injecting a drug.

[0122] The present invention relates to a gradient microfluidic chip for drug screening, comprising: at least two microbranching channels each connected to a culture medium inlet and a drug inlet, and at least one microbranching channel joined and connected to the culture medium inlet and the drug inlet, and at least three micromixing channels each connected to the microbranching channels, forming a fluid with a constant drug concentration gradient; an organoid culture channel connected to the gradient channel, wherein at least one microchannel connected to each micromixing channel is disposed at the bottom of the organoid culture channel, and at least three microwells disposed along the longitudinal direction of each microchannel; and an outlet connected to the microchannel and through which the fluid is discharged.

[0123] The present invention will be explained in more detail below through the following examples. However, these examples are merely illustrative of the invention, and the scope of the invention is not limited by these examples.

[0124] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight)% for solid / solid, (weight / volume)% for solid / liquid, and (volume / volume)% for liquid / liquid, unless otherwise noted.

[0125]

[0126] Example 1: Experimental Materials and Experimental Methods

[0127] The inventors developed a microfluidic chip capable of rapid and effective drug screening by overcoming the limitations of existing organoids, by supplying nutrients through a continuous flow of medium after supplying extracellular matrix to effectively differentiate and mature Fabry disease kidney organoids and improve drug sensitivity, thereby inducing angiogenesis in kidney organoids and improving kidney function, and by forming four different drug concentrations into gradient channels for concentration-based drug screening and enabling simultaneous analysis of three organoids per concentration.

[0128] 1-1. Design and Manufacturing Method of Gradient Microfluidic Chip for Drug Screening

[0129] A microfluidic chip design capable of implementing efficient differentiation and maturation of Fabry disease-induced kidney organoids and a gradient drug screening platform was devised, and a photomask was fabricated. A master mold for the PDMS (Polydimethylsiloxane)-based microfluidic chip was prepared by depositing photoresist on a silicon wafer using a two-step photolithography process.

[0130] The design of the gradient microfluidic chip was performed using computer-aided design (CAD) software (AutoCAD, Autodesk, USA). As can be seen in FIG. 1, the microfluidic chip of the present invention is designed to include two inlets (culture medium inlet (100), drug inlet (200)), a gradient channel (300), an organoid culture channel (400), and four outlets (500).

[0131] As can be seen in FIGS. 1 and 2, the microfluidic chip is designed to include a gradient channel (300) having a tree-like structure to form a constant drug concentration gradient. The tree-like structure of the gradient channel (300) includes 10 micro-branching channels (311-320) and 7 micro-mixing channels (351-357), and 4 of the 7 micro-mixing channels (354, 355, 356, 357) have 4 final drug concentration gradients. The micro-mixing channels are designed to easily mix the medium and the drug and include micro-protrusions (360) arranged alternately on the left and right sides of the inner wall of the micro-mixing channel at an angle of 45° to the fluid flow direction, and have a structure bent in an L-shape or zigzag pattern. The height of the micro-branching channel and the micro-mixing channel is 250 μm. The thickness of the micro-protrusion (360) is 100 μm, and the spacing between the micro-protrusions is 140 μm.

[0132] Specifically, as can be seen in FIG. 2, one end of the first and second micro-branching channels (311, 312) is connected to the culture medium inlet (100), and one end of the third and fourth micro-branching channels (313, 314) is connected to the drug inlet (200). Again, the other ends of the first and fourth micro-branching channels (311, 314) are connected to one end of the first and third micro-mixing channels (351, 353), respectively, and the other ends of the second and third micro-branching channels (312, 313) are joined and connected to one end of the second micro-mixing channel (352). Again, the other end of the first micromixing channel (351) is additionally connected to one end of the fifth and sixth micro-branching channels (315, 316), the other end of the second micromixing channel (352) is additionally connected to one end of the seventh and eighth micro-branching channels (317, 318), and the other end of the third micromixing channel (353) is additionally connected to one end of the ninth and tenth micro-branching channels (319, 320). Again, the other end of the fifth micro-branching channel (315) is connected to one end of the fourth micro-mixing channel (354), the other ends of the sixth and seventh micro-branching channels (316, 317) are joined and connected to one end of the fifth micro-mixing channel (355), the other ends of the eighth and ninth micro-branching channels (318, 319) are joined and connected to one end of the sixth micro-mixing channel (356), and the other end of the tenth micro-branching channel (320) is connected to one end of the seventh micro-mixing channel (357).

[0133] As can be seen in FIG. 1, the other ends of the four fourth, fifth, sixth, and seventh micromixing channels (354, 355, 356, 357) are connected to the four first, second, third, and fourth organoid culture channels (400) (410, 420, 430, 440). As can be seen in FIG. 3a and 3b, the organoid culture channels have a diameter of 2 mm and a height of 10 mm, and a microchannel (450) is positioned at the bottom of the organoid culture channels (400) so that a uniform fluid flow of culture medium is applied below the organoids. The microchannel has a diameter of 3 mm and a height of 250 μm. Each organoid culture channel (400) (410, 420, 430, 440) is designed to contain three aligned cylindrical microwells (411, 412, 413) (421, 422, 423) (431, 432, 433) (441, 442, 443), respectively. The microwells are patterned with a diameter of 2 mm and a height of 250 μm. One organoid can be cultured in each microwell, allowing for the culture of three organoids at the same concentration. The organoid culture channels of the present invention can culture three organoids per concentration at four concentrations, i.e., 12 organoids at a time. Four organoid culture channels (400) (410, 420, 430, 440) are connected to four outlets (500), and fluid is discharged through the outlets.

[0134] To fabricate the channel as designed, negative photoresist (SU8-100, MicroChem, USA) was spin-coated onto a silicon wafer at 500 rpm for 30 seconds, and then baked on a hot plate (HP-20D, Daehan Science, Korea) at 65°C and 95°C for 30 and 90 minutes, respectively. The wafer was placed on a mask aligner (MDA-400LJ, Midas System, Korea) and exposed to UV light for 32 seconds. An additional post-exposure bake was performed using a hot plate at 95°C for 30 minutes, followed by development with SU8 developer for 20 minutes. The wafer was washed with isopropanol (IPA, Sigma Aldrich, USA) and dried with nitrogen gas. PDMS (Sylgard 184, Sigma Aldrich, USA) was mixed with monomer and curing agent in a ratio of 10:1 and poured onto the wafer after degassing. Then, the mixed polymer was cured at 85°C for 2 hours to complete the curing process. After that, the resulting mold was separated from the wafer, and the microfluidic chip mold made of PDMS with a total height of 1 cm was attached to a slide glass (600) after oxygen plasma treatment (Femto Scientific, Korea). Afterward, an organoid was injected into the microfluidic platform with the coating pretreatment completed, and the entire organoid channel was sealed using PCR tape to prevent external leakage of the medium and to ensure continuous flow.

[0135] The gradient microfluidic chip of the present invention has two inlets, namely a culture medium inlet (100) and a drug inlet (200), connected to peristaltic pumps so that the organoid is exposed to a constant flow of culture medium under fluid flow culture conditions. Additionally, the two inlets (100, 200) and four outlets (500) are connected to tygon tubes, through which they can be connected to a medium reservoir, and the top of the microfluidic chip can be sealed with PCR tape.

[0136] 1-2. CFD (Computational Fluid Dynamics) Simulation Methods

[0137] CFD simulations were performed using finite element analysis software (Multiphysics 6.0, COMSOL, USA). The microfluidic channel was modeled using 3D CAD software (Inventor, Autodesk, USA) and imported into the CFD model. The mesh consisted of approximately 40,000 tetrahedral elements, and boundary conditions were set according to experimental conditions. The fluid was assumed to be incompressible, and the velocity field of the domain was calculated using the Navier-Stokes equation represented by Equation 1 below.

[0138] [Formula 1]

[0139]

[0140]

[0141] In the above formula 1, p is pressure, μ is the dynamic viscosity of the fluid, and u is the velocity vector.

[0142] To investigate the concentration gradient within the microfluidic channel, species transport was calculated using the convection-diffusion equation represented by Equation 2 below.

[0143] [Formula 2]

[0144]

[0145] In the above formula 2, c is the concentration of the species and D is the diffusion coefficient of the species.

[0146] Result data, including flow rate and concentration profiles, were processed and extracted using tools embedded in the software.

[0147] 1-3. Method for Human Induced Pluripotent Stem Cell (hiPSC) Culture and Kidney Organoid Differentiation

[0148] WTC11 human induced pluripotent stem cells (hiPSCs) were used between passages 40 and 50. As can be seen in Figure 4b, kidney organoids were differentiated in the following manner. On day 0 (D0), hiPSCs were plated at a density of 5,000 / well in a 24-well plate (LabTek, CA, USA) coated with 0.1% GelTrex (Thermo Fisher Scientific, MA, USA) and mTeSR1 medium (Stem Cell Technologies, CA, USA) containing 10 μM Y27632 (LC Laboratories, MA, USA). The medium was exchanged with mTeSR1 containing 0.1% GelTrex (Day 2), mTeSR1 (Day 3) (D3), RPMI containing 12 μM CHIR99021 (Tocris, Britol, UK) (Thermo Fisher Scientific, MA, USA) (Day 4.5) (D4.5), or RPMI containing B27 supplement (Thermo Fisher Scientific, MA, USA) (Day 5). The cells were fed every 2 or 3 days to promote the differentiation of kidney organoids. Organoids on Day 16 of culture were used in a microfluidic chip.

[0149] 1-4. Method for Generating Fabry Disease Kidney Organoids

[0150] As can be seen in Figure 4a, human Fabry disease kidney organoids were generated from hiPSCs through CRISPR / Cas9 genome editing of galactosidase alpha (GLA), the causative gene of Fabry disease.

[0151] First, GLA-KO human iPSCs were generated. An all-in-one CRISPR / Cas9 carrying GFP and gRNA was purchased from Life Technologies (Cat.A21174, GeneArt CRISPR Nuclease Vector Kit). The human GLA-specific gRNA sequence was provided by Invitrogen Life Technologies and is indicated as Sequence No. 1 in Table 1 below. Oligo annealing and subcloning into the Cas9 nuclease reporter vector were performed according to the manufacturer's instructions.

[0152] Sequence No. Name Sequence (5' - 3') 1GLA gRNA sequence TTGGCAAGGACGCCTACCAT

[0153]

[0154] An all-in-one Cas9 nuclease reporter vector expressing Cas9 containing gRNAs for GLA and GFP was transfected into hiPSCs (WTC11) via electroporation and cultured for 7 to 10 days. GFP-expressing cells were isolated using FACS (fluorescence-activated cell sorting), seeded as single cells in 96-well plates, and cultured until a pure clonal state was reached. A total of six GFP-expressing clones were obtained and analyzed using Sanger sequencing. In hiPSC clones with a knockout (KLA) galactosidase alpha (GLA) gene (GLA-KO), modifications were identified in genetic lesions targeted using GLA-specific sgRNA-mediated CRISPR / Cas9 and used for Western blot analysis. Chromatographic analysis was performed, and mutations were confirmed using immunoblot analysis. Then, the GLA-KO hiPSCs were differentiated into kidney organoids by the method described in Examples 1-3 above.

[0155] 1-5. Method for preparing a microfluidic chip for kidney organoid culture

[0156] The microfluidic chip was coated with 5% Geltrex (Thermo Fisher Scientific, MA, USA) for 1 hour to enhance the adhesion of the organoids. After coating, the organoids were seeded into the microfluidic chip and stabilized for 2 hours. The top portion of the microfluidic chip was sealed with PCR (polymerase chain reaction) tape (Thermo Fisher Scientific, MA, USA) to create a constant flow and prevent leakage of the medium. The inlet (100, 200) and outlet (500) of the microfluidic chip were connected to a Tygon tube (ID. 0.02 inch, OD. 0.06 inch) and a 15 mL conical tube (Corning, NY, USA) medium reservoir. Advanced RPMI 1640 medium supplemented with 1X Glutamax (Thermo Fisher Scientific, MA, USA), B-27, and penicillin-streptomycin (Thermo Fisher Scientific, MA, USA) was perfused at a rate of 12 μL / min for 3 days in a microfluidic chip system using a peristaltic pump.

[0157] To demonstrate the therapeutic effect of recombinant human α-Gal A on Fabry disease kidney organoids in a microfluidic chip system, four different concentrations of enzyme rhα-GLA (recombinant human α-Gal A, Prospec, ENZ-926, Rishon LeTsiyon, Israel) at 0, 0.75, 2.25, and 3 μg / mL were used to treat microfluidic chips in which Fabry disease kidney organoids were cultured using the gradient channels of the microfluidic chip.

[0158] 1-6. Immunofluorescence Analysis Method

[0159] For immunofluorescence analysis, organoids were fixed on day 19. For fixation, samples were washed three times with PBS, and then equal amounts of phosphate-buffered saline (PBS) (Thermo Fisher Scientific, MA, USA) and 8% paraformaldehyde (Electron Microscopy Sciences) were added to the medium for 10 minutes. The fixed organoids were blocked with PBS containing 5% donkey serum (Millipore, MA, USA) and 0.3% Triton X-100, and incubated overnight in PBS containing 3% bovine serum albumin (BSA, Sigma-Aldrich, MO, USA) and the primary antibody. Then, the cells were incubated with the Alexa Fluor secondary antibody (Invitrogen, MA, USA) and stained with DAPI (4',6-diamidino-2-phenylindole). Images were acquired using a Zeiss LSM 700 confocal microscope (Carl Zeiss, Jena, Germany) and ZEN 3.1 software. The following primary antibodies were used: anti-globotriaosylceramide (Gb3) (TCI A2506, 1:200, Huizhou, China), anti-NPHS1 (R&D AF4269, 1:200, Cambridge, UK), anti-Pecam1 (Abcam ab9498, 1:200, Cambridge, UK), and anti-LTL (Vector Labs FL-1321, 1:200, CA, USA).

[0160] 1-7. Quantitative RT-PCR Method

[0161] Kidney organoids were harvested from a microfluidic chip, and RNA was extracted using TRIzol (Invitrogen, MA, USA) according to the manufacturer's instructions. RNA concentration was measured using NanoDrop (MicroDigital Co., Ltd., Korea), and cDNA was synthesized from 1 μg of total RNA using the PrimeScript first strand cDNA Synthesis Kit (TAKARA, Japan). Gene expression was analyzed using real-time PCR (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). qRT-PCR was performed in triplicate, and relative mRNA expression levels were 2 -ΔΔCt It was determined using the method. The primer sequences used for gene expression analysis are shown in Table 2 below.

[0162] Sequence number name sequence (5' - 3')2NPHS1 forward primerGGCTCCCAGCAGAAACTCTT3NPHS1 reverse primerCACAGACCAGCAACTGCCTA4WT1 forward primerGCGGAGCCCAATACAGAATA5WT1 reverse primerGATGCCGACCGTACAAGAGT6GGT1 ​​forward primerAGGGCTGCTTTTTAACTCTGGT7GGT1 reverse primerCCCCACTTGATTTTGGAGGGA8ECAD forward primerCGAGAGCTACACGTTCAGG9ECAD reverse primerGGGTGTCGAGGGAAAAATAGG

[0163]

[0164] 1-8. Mitochondrial Staining and Reactive Oxygen Species (ROS) Detection Method

[0165] For mitochondrial staining, 5 mM MitoTracker (Thermo Fisher Scientific, MA, USA) and 200 mM Hoechst (Thermo Fisher Scientific, MA, USA) were added to the microfluidic chip. For the detection of reactive oxygen species (ROS), 5 μM MitoSOX Red (Thermo Fisher Scientific, MA, USA) and 200 mM Hoechst (Thermo Fisher Scientific, MA, USA) were added to the microfluidic chip. After incubation for 1 hour, the cells were washed three times with PBS, and fluorescence images were obtained using a fluorescence microscope.

[0166] 1-9. Statistical Analysis Methods

[0167] Each experiment was performed at least three times to ensure reproducibility and reliability. All results were expressed as mean ± mean standard error (SEM). Statistical analysis compared the significance between experimental groups using one-way ANOVA with unpaired Student's t-test and Bonferroni multiple comparison test (GraphPad Prism version 8.0, GraphPad Software Inc., CA, USA). Differences between groups were considered statistically significant at *p<0.05, **p<0.01, and ***p<0.001. The black line on the histogram represents the comparison between groups.

[0168]

[0169] Example 2: Generation of Fabry disease kidney organoids in a microfluidic chip

[0170] As can be seen in Figure 4a, normal kidney organoids were derived from hiPSCs, whereas Fabry disease kidney organoids were generated from hiPSCs through CRISPR / Cas9 gene editing. Gb3 accumulation was prominently observed in GLA mutant kidney organoids, which is consistent with the phenotype of human kidney cells affected by Fabry disease. As can be seen in Figure 4c, noticeable Gb3 accumulation was observed in Fabry disease kidney organoids compared to normal kidney organoids.

[0171] As can be seen in FIGS. 4a and 4b, to facilitate the physiological improvement of these two organoids, a gradient microfluidic chip with aligned cylindrical microwells was fabricated by modifying the culture platform previously established as a kidney-on-a-chip. Conventional kidney-on-a-chip devices were mostly implemented by stacking various cells capable of constituting a kidney rather than directly culturing kidney organoids. However, in the gradient microfluidic chip of the present invention, the organoid culture channel is optimized to culture organoids with a diameter of 6 mm and a height of 10 mm, allowing for the cultivation of organoids approximately 500 μm in size. In the present invention, instead of applying a medium flow over the organoid, a microchannel (450) is placed below to apply the fluid flow of the culture medium to the microfluidic chip. This approach of the present invention ensures that a uniform flow affects the entire kidney organoid. In addition, the microfluidic chip of the present invention is designed with two inlets (culture medium inlet (100), drug inlet (200)) and four outlets (500) to create a stable concentration gradient (gradient) of drug concentration. The gradient microfluidic chip designed in the present invention not only facilitates the differentiation and maturation of physiologically improved kidney organoids but also can establish various drug concentration gradients, making it highly suitable for drug toxicity and screening analysis.

[0172] In addition, numerical simulations were performed to predict the performance of the gradient microfluidic chip of the present invention before conducting cell experiments. The simulation results of the concentration distribution along the gradient channel (300) can be seen in FIG. 4d. The drug and the medium passed through the continuous micro-branching channels (311-320) and micro-mixing channels (351-357), creating four concentration gradients in the four micro-mixing channels (354, 355, 356, 357).

[0173] As can be seen in Fig. 4f, relative concentrations were measured at the outlet (500) and the uniformity of the distribution was verified. As can be seen in Fig. 4h, independent distributions were generated for each outlet channel, and the variance increased slightly from 0% to 100%. This is presumably due to the slow diffusion rate of the high molecular weight (approx. 49 kDa) drug. Nevertheless, as can be seen in Fig. 4h, the concentration gradient showed a high correlation coefficient (R 2 It was generated with =0.9999, confirming that diffusion-based mixing was successfully performed in the gradient channel.

[0174] Since the gradient microfluidic chip of the present invention successfully implements a concentration gradient as described above, it can be usefully employed to evaluate the response of Fabry disease kidney organoids and normal kidney organoids to drugs of various concentrations and to evaluate the efficacy of therapeutic agents.

[0175] As can be seen in Fig. 4e, the flow distribution across the entire organoid culture channel of the microfluidic chip of the present invention is shown. As can be seen in Fig. 4g, the velocity profile and shear stress within the organoid culture channel were analyzed at various flow rates (0, 3, 6, 9, 12, and 15 μL / min) to identify optimal conditions for angiogenesis in the organoid. Upon entering the organoid culture channel, the fluid flow transitioned from laminar flow to shear flow, accompanied by an irregular velocity profile. In particular, a uniform velocity profile in the central region and shear stress on the organoid surface were observed at a flow rate of 12 μL / min, indicating that an effective and uniform shear force can be induced on the organoid surface. Therefore, the inventors confirmed that a flow rate of at least 12 μL / min is required to apply uniform shear stress to the elongated organoid.

[0176] As can be seen in Figures 4i and 4j, the average velocity and shear stress increased linearly with the flow rate, and the correlation coefficient was 0.9999. It is worth noting that the gradient microfluidic chip of the present invention can control the shear stress of the organoid simply by adjusting the flow rate.

[0177]

[0178] Example 3: Confirmation of improved differentiation and maturation of normal kidney organoids under fluid culture conditions

[0179] The inventors first confirmed the differentiation and maturation of normal kidney organoids in the gradient microfluidic chip of the present invention, and then analyzed the effect of fluid flow culture conditions on kidney organoids.

[0180] As can be seen in Figures 5a and 5c to 5e, immunofluorescence staining analysis of the renal organoids showed a significant improvement, exhibiting a marked increase in specific markers, particularly those related to angiogenesis and renal tubules (*p<0.05). In vivo, developing blood vessels are exposed to various mechanical signals, ranging from the viscoelastic properties of the surrounding extracellular matrix to traction stress exerted by perivascular cells. Endothelial cells (ECs) form an interface between the bloodstream and surrounding tissues, receiving mechanical stimuli such as shear stress induced by pulsatile or unidirectional blood flow and interstitial flow. Therefore, the importance of mechanical factors in organoid angiogenesis is increasingly recognized, and many studies have demonstrated that mimicking fluid flow can enhance organoid angiogenesis.

[0181] The inventors provide a method for culturing kidney organoids under in vitro fluid flow conditions, and the invention confirmed that a gradient microfluidic chip promotes the formation and maturation of an endothelial cell (EC) network.

[0182] Therefore, the inventors confirmed that shear stress induced by fluid flow promotes the differentiation of endothelial progenitor cells within the organoid, leading to differentiation and self-organization into a vascular network within the organoid, and in some cases, differentiation into a glomerular structure closely associated with tubules.

[0183] As can be seen in Figures 5b and 5f, furthermore, it was confirmed that the absorption capacity of the fluorescent substance (FITC) in other organoids increased by more than twofold under fluidic culture conditions compared to static culture conditions.

[0184] This observation that fluorophores penetrate the internal regions of kidney organoids more effectively in fluid culture suggests that the accessibility of nutrients, growth factors, and signaling molecules within organoids is enhanced under dynamic conditions. This increased uptake may be attributed to the improved angiogenesis and maturation observed in fluid culture.

[0185] As can be seen in Fig. 5g, quantitative PCR results demonstrated the upregulation of genes expressed in kidney organoids, and significantly significant upregulation was observed in NPHS1 (*p<0.05), WT1 (**p<0.01), and GGT1 (*p<0.05). Compared to control kidney organoids cultured under static conditions, kidney organoids cultured under fluidic perfusion for 5 days improved overall maturation of the kidney organoids, including the upregulation of genes related to kidney organoid differentiation, improved angiogenesis, and tubular structure development. Therefore, it is thought that fluid flow played an important role not only in the maturation of vascular structures but also in the physiological improvement of kidney organoids.

[0186]

[0187] Example 4: Confirmation of the effect of a continuous flow of medium enhancing the differentiation and maturation of Fabry disease kidney organoids

[0188] According to previous research results, the differentiation and maturation of kidney organoids were promoted under fluid flow culture conditions compared to static culture conditions. Several researchers have observed enhanced differentiation and maturation by culturing various organoids using microfluidic chip systems, which aligns with the research results of the present invention. Advanced cell culture technology is an essential tool in both basic and clinical research, providing new methods for rapidly and reliably predicting the safety and efficacy of drugs, which are vital for effective drug development. While various approaches have emerged to address these challenges, they typically fail to provide the organ-level functionality required to develop meaningful disease models. In recent years, 3D organoid-based culture systems have been used to study various disease states, personalized drug screening, and the safety and efficacy of novel drugs, providing physiologically more relevant information and predictive data for in vivo testing compared to conventional methods. Despite the potential for using organoids cultured on microfluidic chips, significant research progress in the establishment and differentiation of disease model organoids using microfluidic systems remains a challenging task.

[0189] Accordingly, in the present invention, Fabry disease kidney organoids were applied to a gradient microfluidic chip constructed to analyze the effects of fluid flow culture conditions on the differentiation and gene expression of kidney organoids. First, on the 5th day, immunofluorescence staining and quantitative PCR analysis were performed on Fabry disease kidney organoids cultured in a microfluidic chip system.

[0190] As can be seen in Figure 6a, the proportion of cells expressing PECAM (Platelet endothelial cell adhesion molecule) and NPHS1 (Congenital nephrotic syndrome of the Finnish type) increased under fluidic flow culture conditions compared to static culture conditions.

[0191] As can be seen in Figures 6c and 6d, upon closer examination, it was observed that the proportion of PECAM-positive cells increased by about 2.6 times, and the proportion of NPHS1-positive cells increased by about 2.2 times under flow culture conditions compared to static culture conditions.

[0192] Vascular complications of Fabry disease have been partially elucidated, and it has been reported that angiogenesis in Fabry disease renal organoids is limited. Consistent with previously reported results, angiogenesis in the present invention was limited under static culture conditions, whereas Fabry disease renal organoids cultured under dynamic conditions exhibited relatively enhanced angiogenesis. Furthermore, the upregulation of NPHS1 during the process of renal structural and functional development generally implies enhanced development and maturation of renal organoids. However, in the context of disease modeling, the upregulation of NPHS1 in Fabry disease renal organoids is interpreted as a compensatory mechanism, an attempt to maintain or restore the integrity of the glomerular filtration barrier in response to the disease. On the other hand, as can be seen in Figure 6e, the proportion of cells expressing LTL did not change depending on the culture conditions.

[0193] In addition, as can be seen in Figures 6b and 6f, FITC-dextran uptake analysis was performed in a microfluidic chip system to determine whether Fabry disease renal organoids exhibit physiologically relevant characteristics. Fabry disease renal organoids cultured under static and fluid conditions were exposed to 100 μg / mL FITC-dextran 70 kDa on day 5. 24 hours after FITC-dextran treatment, the endocytic uptake of 70 kDa FITC-dextran in LTL+ proximal tubule epithelial cells was significantly increased in Fabry disease renal organoids cultured under fluid conditions. Therefore, the inventors suggest that the enhanced expression of vascular and nephron markers under fluid flow conditions may have contributed to the improvement of the reabsorption function of proximal tubule epithelial cells in Fabry disease renal organoids.

[0194] As can be seen in Fig. 6g, subsequent quantitative PCR analysis results showed that the expression of podocyte genes (NPHS1, WT1), renal cell marker (GGT1), and distal tubule marker (ECAD) in Fabry disease renal organoids cultured under fluid culture conditions was significantly upregulated compared to static culture conditions, indicating improved functional potential.

[0195] Overall, the results of the present invention suggest that the microfluidic chip system can enhance the differentiation, maturation, and functional potential of Fabry disease kidney organoids and can be used as a powerful tool for disease modeling and drug development research.

[0196]

[0197] Example 5: Confirmation of the effect of ERT in reducing Gb3 accumulation and attenuating structural and transcriptional changes in Fabry disease renal organoids in the gradient microfluidic chip of the present invention

[0198] Physiologically and structurally enhanced disease model organoids are essential for understanding disease mechanisms and drug screening. Organoids, which closely mimic in vivo human tissues, enable accurate drug screening, helping to identify potential drug candidates more efficiently and accurately predict efficacy and potential side effects. Fabry disease is an X-linked genetic disorder caused by a deficiency or absence of the lysosomal enzyme alpha-galactosidase A (GLA), resulting in defects in glycosphingolipid metabolism and the accumulation of Gb3. This accumulation occurs in various renal cells, including podocytes, glomerular endothelial cells, mesangial cells, tubular epithelial cells, and vascular endothelial cells, ultimately leading to end-stage renal disease.

[0199] In the present invention, the inventors constructed physiologically and structurally enhanced Fabry disease renal organoids by introducing flow into them using a microfluidic gradient chip. Additionally, the inventors investigated whether the therapeutic effects of enzyme replacement therapy (ERT) using recombinant human alpha-galactosidase A (rhα-GLA) could be reproduced in a Fabry renal organoid model using the gradient microfluidic chip system of the present invention. ERT is a major treatment option for patients with Fabry disease. If started relatively early, Fabry disease-related symptoms can be improved and renal damage can be delayed. Fabry disease renal organoids were treated with enzyme rhα-GLA at concentrations of 0, 0.75, 2.25, and 3 μg / mL for 3 days.

[0200] As can be seen in Figures 7a and 7b, Gb3 accumulation in Fabry disease renal organoids decreased in a dose-dependent manner after ERT treatment. Gb3 accumulation was still prominent at ERT concentrations of 2.25 and 3 μg / mL. However, the difference in Gb3 accumulation compared to normal organoids was not statistically significant. In addition, Gb3 accumulation was significantly reduced when compared to the group that did not receive ERT treatment.

[0201] In previous treatment studies using Fabry disease kidney organoids, Gb3 accumulation was observed to significantly decrease when the concentration exceeded 3 μg / mL. However, in the present invention, the inventors demonstrated that ERT showed efficacy at a concentration of 0.75 μg / mL or higher in the gradient microfluidic chip of the present invention.

[0202] As indicated by the arrow in the NPSH1 row in Fig. 7a, the expression of NPHS1 at the podocyte base was significantly reduced in Fabry disease renal organoids compared to normal organoids, and the linear pattern of NPHS1 expression was not organized in Fabry disease renal organoids. After ERT treatment, NPHS1 expression increased in a dose-dependent manner. In particular, as shown in Fig. 7c, a significant increase in NPHS1 expression was observed at an ERT concentration of 3 μg / mL compared to Fabry disease organoids at an ERT concentration of 0 μg / mL. Additionally, as shown in Fig. 7a, when the ERT concentration was 2.25 μg / mL or higher, the linear pattern of NPHS1 expression, characteristic of normal organoids, was restored. LTL expression in Fabry disease renal organoids was significantly reduced compared to normal organoids. However, as can be seen in Fig. 7d, LTL expression after ERT treatment was significantly increased at a concentration of 3 μg / mL compared to the untreated ERT group. Furthermore, immunofluorescence staining results showed that tubular polarization was observed in normal kidney organoids (arrows in columns 1, 4, and 5 of the LTL row in Fig. 7a), but was disrupted in Fabry disease kidney organoids (arrow in column 2 of the LTL row in Fig. 7a). However, it demonstrated that tubular polarization was restored after ERT treatment.

[0203] These results suggest that the gradient microfluidic chip of the present invention has higher sensitivity in detecting therapeutic effects in a Fabry disease kidney organoid model. Furthermore, the inventors emphasized that the efficacy of ERT can be obtained even at relatively low doses, which indicates the potential to mitigate the risk of side effects associated with high-dose drug treatment.

[0204]

[0205] Example 6: Confirmation of the effect of ERT in alleviating oxidative stress and mitochondrial dysfunction in Fabry disease kidney organoids in the gradient microfluidic chip of the present invention

[0206] Fabry disease exhibits signs of oxidative stress, evidenced by elevated levels of inflammatory cytokines observed in plasma and specific markers associated with oxidative stress. In renal organoids, GLA knockout (GLA-KO) leads to intracellular calcium accumulation. This accumulation results in increased ROS production and decreased mitochondrial signaling. Consequently, the expression of several nephron markers is reduced. There is substantial evidence suggesting that oxidative stress may indeed play a role in the pathophysiology of Fabry disease. Notably, potent antioxidants (e.g., ascorbic acid) have been shown to reduce hypoperfusion in Fabry disease patients receiving ERT treatment. Furthermore, excessive detection of cutaneous vascular nitrotyrosine, a marker of oxidative stress, has been observed in Fabry disease patients. Gb3 has been observed to increase ROS production and the expression of adhesion molecules in Fabry disease endothelial cells. Therefore, changes in oxidative stress and ROS levels before and after ERT treatment in a Fabry disease kidney organoid model were investigated using the gradient microfluidic chip system of the present invention. Mitochondrial superoxide was analyzed using MitoSOX Red staining. Mitochondrial superoxide emits red fluorescence when oxidized.

[0207] As can be seen in Fig. 8a, MitoSOX fluorescence (Mitotracker) increased in Fabry disease renal organoids, but MitoSOX fluorescence decreased significantly in a concentration-dependent manner after ERT treatment. In particular, as can be seen in Fig. 8b, there was no significant difference in MitoSOX expression when Fabry disease renal organoids treated with ERT at a concentration of 3 μg / mL were compared to normal renal organoids. As can be seen in Figs. 8a and 8c, the decreased MitoTracker fluorescence intensity in Fabry disease renal organoids recovered after ERT treatment. However, it remained weak compared to normal renal organoids. These results confirm that mitochondrial oxidative stress is increased in Fabry disease using the gradient microfluidic chip of the present invention, and demonstrate that oxidative stress is effectively reduced after ERT treatment. Therefore, the gradient microfluidic chip system of the present invention effectively reproduces the Fabry disease renal phenotype and efficiently demonstrates the effects of ERT treatment.

[0208]

[0209] summation

[0210] In this invention, a gradient microfluidic chip design capable of implementing a gradient drug screening platform and efficient differentiation and maturation of Fabry disease-induced kidney organoids was devised, and a photomask was fabricated. A master mold for the PDMS-based microfluidic chip was prepared by depositing photoresist on a silicon wafer using a two-step photolithography process. The organoid culture channels were patterned to a height of 6 mm, while the gradient channels and organoid culture channels were patterned to heights of 5 μm and 150 μm, respectively. Photoresist was deposited on a transparent glass wafer and patterned by irradiating with ultraviolet light. Subsequently, a microfluidic chip mold was manufactured using a PDMS mixture to achieve a total height of 1 cm, and the glass substrate and the mold were bonded via plasmonic bonding. Afterward, organoids were injected into the microfluidic platform after the coating pretreatment was completed, and the entire organoid channel was sealed using PCR tape to prevent leakage of the medium and ensure continuous flow.

[0211] The completed Fabry disease organoid gradient microfluidic chip was used to generate culture medium flow via a peristaltic pump for 3 days, and organoid differentiation, maturation, angiogenesis, and nutrient permeability were analyzed. The improvement in the overall function of the renal organoids was confirmed through quantitative analysis of the vascular marker PECAM, the glomerular podocyte marker NPHS1, and the proximal tubule marker LTL using immunofluorescence staining. Additionally, PCR analysis confirmed increased expression of NPHS1, WT1, GGT1, and ECAD. Subsequently, when the recombinant enzyme α-galactocidase A, a Fabry disease therapeutic drug, was treated for 3 days at concentrations of 0, 0.75, 2.25, and 3 μg / mL generated by the gradient, it was confirmed that Gb3, a substance accumulated due to Fabry disease, was eliminated in a concentration-dependent manner. Consequently, it was confirmed that the function and morphology of the damaged glomerular podocytes and proximal tubules were restored. In particular, despite the difficulty of recovering to normal organoid levels following the induction of Fabry disease, it was confirmed that recovery to a level comparable to normal organoids occurred at the highest concentration of 3 μg / mL. Reactive oxygen species generated by Gb3 also decreased in a concentration-dependent manner, and it was confirmed that damaged mitochondria recovered after drug treatment. However, these values ​​were also generally lower than those of normal organoids.

[0212] Based on a deep understanding of the pathological characteristics of Fabry disease, the present invention develops an innovative gradient microfluidic platform capable of concentration-based drug screening that overcomes the limitations of existing organoids. This platform effectively induces differentiation and maturation in Fabry disease kidney organoids through the flow of the extracellular matrix and a continuous medium, thereby more accurately reproducing kidney function. Furthermore, by facilitating nutrient supply through vascularization, it enables long-term culture, which in turn increases drug permeability and allows for more effective drug screening. Through this method, drug candidates used in the search for Fabry disease treatments can be screened, and their efficacy and toxicity can be analyzed. This platform is applicable not only to Fabry disease but also to organoids induced with various other diseases, and it suggests potential applications for diverse organoids beyond the kidney, such as the heart, brain, and skin. This implies that the platform provided by the present invention can play a significant role in the development of treatments for various diseases. Considering these points comprehensively, the present invention presents great potential in drug screening and disease research.

[0213]

[0214] Sintering

[0215] In this invention, the inventors developed a gradient microfluidic chip to promote the differentiation and maturation of physiologically enhanced kidney organoids. Furthermore, by ensuring the culture medium has a continuous fluidic flow, they created an extracellular microenvironment of human cells for long-term physiological function improvement. The results of this invention demonstrate the utility of the gradient microfluidic chip for efficiently culturing and differentiating enhanced kidney organoids, thereby facilitating Fabry disease kidney modeling and drug screening. Additionally, this invention represents the first attempt to culture genetically edited Fabry disease organoids using a gradient microfluidic chip and apply them to drug efficacy studies, demonstrating that dynamic flow conditions enhance sensitivity in detecting therapeutic efficacy at low concentrations compared to conventional static culture conditions. Therefore, the gradient microfluidic chip developed in this invention can be widely applied to various types of organoids, including disease models, to enhance organoid differentiation and maturation in vitro, thereby facilitating molecular pathway research in organ development, drug screening, and regenerative medicine experiments. The gradient microfluidic chip system developed in the present invention has significant potential to accelerate research in both basic and translational fields by enhancing the utility of organoids and other 3D culture-based systems.

[0216]

[0217] [Explanation of the symbol]

[0218] 1: Gradient microfluidic chip for drug screening

[0219] 100: Culture medium inlet

[0220] 200: Drug infusion port

[0221] 300: Gradient Channel

[0222] 311: 1st micro-branch channel 312: 2nd micro-branch channel

[0223] 313: 3rd micro-branch channel 314: 4th micro-branch channel

[0224] 315: 5th micro-branch channel 316: 6th micro-branch channel

[0225] 317: 7th fine branch channel 318: 8th fine branch channel

[0226] 319: 9th micro-branch channel 320: 10th micro-branch channel

[0227] 351: Micromixing Channel 1 352: Micromixing Channel 2

[0228] 353: 3rd Micromixing Channel 354: 4th Micromixing Channel

[0229] 355: 5th Micromixing Channel 356: 6th Micromixing Channel

[0230] 357: 7th Micromixing Channel

[0231] 360: Microprotrusion(s)

[0232] 400: Organoid culture channel

[0233] 401: Organoid culture channel height

[0234] 402: Microwell

[0235] 402h: Microwell height

[0236] 402d: Microwell width

[0237] 410: 1st organoid culture channel

[0238] 420: Second organoid culture channel

[0239] 430: Third organoid culture channel

[0240] 440: 4th organoid culture channel

[0241] 411: Microwell 1-1 412: Microwell 1-2

[0242] 413: Microwell No. 1-3 421: Microwell No. 2-1

[0243] 422: Microwell No. 2-2 423: Microwell No. 2-3

[0244] 431: Microwell No. 3-1 432: Microwell No. 3-2

[0245] 433: Microwell No. 3-3 441: Microwell No. 4-1

[0246] 442: Microwell No. 4-2 443: Microwell No. 4-3

[0247] 450: Microchannel

[0248] 460: Organoid

[0249] 500: Outlet

[0250] 600: Glass substrate

Claims

1. A culture medium inlet through which the culture medium is injected; Drug infusion port where drug is injected; A gradient channel comprising at least two microbranching channels respectively connected to the culture medium inlet and the drug inlet, and at least one microbranching channel joined and connected to the culture medium inlet and the drug inlet, and at least three micromixing channels respectively connected to the microbranching channels, forming a fluid with a constant drug concentration gradient; An organoid culture channel connected to the gradient channel, wherein a microchannel connected at least once to each micromixing channel is disposed at the bottom of the organoid culture channel, and each microchannel comprises at least three microwells disposed along the longitudinal direction of the microchannel; and An outlet connected to the microchannel and through which the fluid is discharged; A gradient microfluidic chip for drug screening comprising 2. A gradient microfluidic chip for drug screening according to claim 1, wherein the micromixing channel forms an angle of 30° to 60° with respect to the fluid flow direction and includes micro-protrusions arranged alternately on the left and right sides of the inner wall of the micromixing channel.

3. A gradient microfluidic chip for drug screening according to claim 1, wherein the micromixing channel has a structure bent in a 'ㄹ' pattern or a zigzag pattern.

4. A gradient microfluidic chip for drug screening according to claim 1, wherein the culture medium inlet is connected to the first and second micro-branching channels, the drug inlet is connected to the third and fourth micro-branching channels, the first and fourth micro-branching channels are each connected to the first and third micro-mixing channels, and the second micro-branching channel connected to the culture medium inlet and the third micro-branching channel connected to the drug inlet are joined and connected to the second micro-mixing channel.

5. In paragraph 4, the first micromixing channel is additionally connected to the fifth and sixth microbranching channels, the second micromixing channel is additionally connected to the seventh and eighth microbranching channels, and the third micromixing channel is additionally connected to the ninth and tenth microbranching channels, and A gradient microfluidic chip for drug screening, wherein the fifth microbranching channel is connected to the fourth micromixing channel, the sixth and seventh microbranching channels merge and are connected to the fifth micromixing channel, the eighth and ninth microbranching channels merge and are connected to the sixth micromixing channel, and the tenth microbranching channel is connected to the seventh micromixing channel.

6. A gradient microfluidic chip for drug screening according to claim 1, wherein the gradient channel has at least three constant concentration gradient points in which the fluid within the channel has 7. A gradient microfluidic chip for drug screening according to claim 1, wherein the microfluidic chip further comprises a pump connected to the culture medium inlet and the drug inlet and supplying fluid to the microchannel at a flow rate of 9 to 15 μL / min.

8. A gradient microfluidic chip for drug screening according to claim 1, wherein the micro-branching channel and the micro-mixing channel have a height of 50 to 500 μm.

9. A gradient microfluidic chip for drug screening according to claim 1, wherein the organoid culture channel has a diameter of 0.5 to 5 mm and a height of 5 to 15 mm.

10. A gradient microfluidic chip for drug screening according to claim 1, wherein the microchannel has a diameter of 1 to 11 mm and a height of 50 to 500 μm.

11. A gradient microfluidic chip for drug screening according to claim 1, wherein the discharge ports are at least three.

12. A drug screening method using a gradient microfluidic chip for drug screening according to claim 1, comprising the following steps: A step of culturing an organoid in the above organoid culture channel; and Step of injecting a test drug into the above drug injection port.

13. A drug screening method according to claim 12, wherein the organoids are each treated with at least three different drug concentrations in an organoid culture channel.

14. A drug screening method according to claim 12, wherein the organoid is one or more organoids selected from the group consisting of kidney, brain, skin, heart, optic cup, liver, pancreas, bile duct, neural tube, stomach, large intestine, small intestine, prostate, breast, salivary gland, endometrium, mammary gland, thyroid, tongue, esophagus, lung, blood vessel, muscle and adrenal cortex.

15. A drug screening method according to claim 12, wherein the organoid is a Fabry disease-mimicking kidney organoid obtained by culturing stem cells in which the GLA (galactosidase alpha) gene has been knocked out.

16. A drug screening method for the prevention or treatment of Fabry disease using a gradient microfluidic chip for drug screening according to claim 1, comprising the following steps: A step of culturing a Fabry disease-mimicking kidney organoid obtained by culturing stem cells in which the GLA (galactosidase alpha) gene has been knocked out in the organoid culture channel; A step of injecting a test drug into the above drug injection port; and A step of measuring the accumulation of Gb3 (globotriaosylceramide), mitochondrial activity, or the production of reactive oxygen species (ROS) in the above Fabry disease-mimicking kidney organoid.

17. A method for screening drugs for the prevention or treatment of Fabry disease, wherein the method further comprises the step of determining the test drug as a candidate drug for the prevention or treatment of Fabry disease if, in an organoid treated with the test drug, the amount of Gb3 accumulation decreases, mitochondrial activity decreases, or the amount of reactive oxygen species produced decreases compared to an organoid not treated with the test drug.

Citation Information

Patent Citations

  • Integrated microfluidic device and method for cell culture by using it

    KR1020120118680A

  • Disaster management system and disaster management method using the same

    KR1020220031794A

  • Semiconductor devices

    KR1020240166144A

  • Drug delivery composition for pain relief and  method for preparing thereof, and pharmaceutical composition for pain relief

    KR1020250009638A

  • Scratch-resistant high-speed USB connector

    KR1020260010183A