Synthetic microbiota for treating a microbial infection

Abstract

A method for treating a microbial infection in a subject is provided that includes administering to the subject a composition including a therapeutically effective amount of at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a pathway or mechanism of proline utilization or depletion. Also provided is a composition for use in treating a microbial infection, a synthetic microbiota or synthetic microbiota transplant including such composition, the use of such composition in the manufacture of a medicament for treating a microbial infection, and a medical kit for treating a microbial infection including the synthetic microbiota transplant and an instruction for use thereof.

Description

Attorney Docket No. 0073605-001128 SYNTHETIC MICROBIOTA FOR TREATING A MICROBIAL INFECTION CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Application Serial No. 63 / 760,164, filed on February 19, 2025, and entitled “SYNTHETIC MICROBIOTA AND RELATED PROCESSES AND APPARATUSES,” the entirety of which is incorporated herein by reference.STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under and under GM151045 and All 47165, awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD OF THE INVENTION

[0003] The present invention generally relates to the field of therapeutics. In particular, the present invention is directed to a synthetic microbiota for treating a microbial infection.REFERENCE TO SEQUENCE LISTING

[0004] This specification includes a sequence listing submitted herewith, which includes the file entitled 0073605-001128USU1. xml having the following size: 13,495 bytes which was created December 22, 2025, the contents of which are incorporated by reference herein.BACKGROUND

[0005] C lostridioides difficile (C. difficile) is in many ways an enigmatic member of the human gut microbiome; it is present across many mammals and commonly found in human infants. C. difficile is normally suppressed by antagonistic relationships with members of the healthy gut microbiota, although the precise mechanisms of this suppression have not been fully described.

[0006] When the healthy gut microbiota becomes disrupted or depleted, e.g., during an antibiotic treatment, C. difficile infection (CDI) may occur. Traditional antimicrobial therapy for C. difficile infection can further disrupt the gut microbiome, creating a feedback loop that results in high rates of recurrent infection (rCDI). Despite the long association of C. difficile with humans, the widespread use of broad-spectrum antibiotics, especially third-generation cephalosporins, has resulted in C. difficile being a leading cause of antibiotic-associated diarrhea. In addition, the ability of C. difficile to form disinfection-resistant spores further complicates treatment, as the environment may be a significant source of exposure.

[0007] CDI is among the most common nosocomial infections, resulting in -500,000 annual infections and associated healthcare costs in excess of 1.5 billion dollars in the USA alone. RecentAttorney Docket No. 0073605-001128 breakthroughs in narrow-spectrum antibiotics have led to improved efficacy for treating CDI, and the use of fecal microbiota transplant (FMT), the administration of fecal material from a healthy human donor, has been demonstrated to be highly effective in preventing rCDI. Despite being highly efficacious, FMT comes with safety concerns including the accidental transmission of multidrugresistant pathogens, transmission of unexpected metabolic phenotypes, and a lack of a stable composition / formulation. The reliance on human donors whose microbiomes are constantly shifting, and for whom microbiome likely represents an optimal state for their own genetics and lifestyle, results in variable engraftment that is difficult to predict a priori. Despite the ongoing efforts to expand FMT therapy to treatment of obesity and neurological conditions, reproducible approaches to microbiome supplementation with well-defined mechanisms of action remain elusive.

[0008] Live biotherapeutic products, i.e., multi-strain consortia and fecal-derivatives, represent a promising category for alternatives to FMT; however, conventional probiotic strains and formulations have demonstrated limited efficacy, and recent breakthroughs often rely on human fecal material. The creation of more complex consortia leveraging antagonistic ecological interactions to suppress C. difficile is a promising alternative; however, a major knowledge gap exists in the field as to how to design and construct synthetic consortia. Despite limited evidence of certain functions being correlated with C. difficile resistance, such as the formation of secondary bile acid metabolites by bai operon-encoding Clostridia including Clostridium scindens much remains to be learned about the mechanisms through which a complex community antagonizes C. difficile and how these mechanisms could be leveraged clinically.SUMMARY OF THE DISCLOSURE

[0009] An aspect of the present disclosure is a method for treating a microbial infection in a subject. The method includes administering to the subject a composition including a therapeutically effective amount of at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

[0010] Another aspect of the present disclosure is another method for treating a microbial infection in a subject. The method includes administering to the subject a composition including a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

[0011] In some embodiments of the method described herein, the subject is a human subject.Attorney Docket No. 0073605-001128

[0012] In some embodiments of the method described herein, the at least one microbial strain is a genetically engineered microbial strain.

[0013] In some embodiments of the method described herein, the at least one microbial strain includes one or more of strains or strain variants of Escherichia coli, Bacteroides thetaiotaomicron, Bacteroides ovatus, Bacteroides uniformis, Phocaeicola [Bacteroides] vulgatus, Parabacteroides merdae, Enterocloster asparagiformis, Dorea longicatena, Agathobacter rectalis, Lachnospira eligens, Bacteroides stercoris, Bacteroides xylanisolvens, Anaerobutyricum hallii. Lactonifactor longoviformis, Faecalibacterium prausnilzii. Blautia producta, Dorea formicigenerans, Blautia obeum, Clostridium spiroforme, Eggerthella lenta, Eubacterium hadrus, Clostridium or bi sc indens, Clostridium sy mb iosum, Bacteroides sp., Bifidobacterium longum subsp. longum, Bacteroides caccae, Bacteroides cellulosilyticus, Bacteroidesdorei, Bacteroides finegoldii, Parabacteroides sp. , Peptostreptococcus anaerobius[russellii], Sutterella wadsworthensis, and Clostridium scindens.

[0014] In some embodiments of the method described herein, the at least one microbial strain includes a Peptostreptococcus anaerobius [russellii strain or strain variant. In some embodiments, the Peptostreptococcus anaerobius [russellii] strain or strain variant includes at least a DNA sequence in its genome that is complementary to one or more primers according to SEQ ID NOs: 9 and 10.

[0015] In some embodiments of the method described herein, the at least one microbial strain includes Dorea longicatena strain or strain variant. In some embodiments, the Dorea longicatena strain or strain variant includes at least a DNA sequence in its genome that is complementary to one or more primers according to SEQ ID NOs: 7 and 8.

[0016] In some embodiments of the method described herein, the at least one microbial strain includes a single-strain administration of a Peptostreptococcus anaerobius [russellii] strain or strain variant.

[0017] In some embodiments of the method described herein, the at least one microbial strain includes a single-strain administration of a Dorea longicatena strain or strain variant.

[0018] In some embodiments of the method described herein, the at least one microbial strain includes a genetically engineered Escherichia coli strain, lactobacilli strain, or Phocaeicola vulgatus strain adapted to overexpress a putA gene or produce one or more proline-utilizing gene products.

[0019] In some embodiments of the method described herein, the method further includes reducing a level of one or more of IL- 10, IL-6, and TNF-a in the subject.Attorney Docket No. 0073605-001128

[0020] In some embodiments of the method described herein, the competitive Stickland fermentation includes a reductive Stickland fermentation of proline and, optionally, glycine.

[0021] In some embodiments of the method described herein, the microbial infection includes an antibiotic-resistant microbial infection. In some embodiments of the method described herein, the microbial infection includes a Clostridioides difficile infection. In some embodiments of the method described herein, the microbial infection is an antibiotic-associated diarrhea. In some embodiments of the method described herein, the microbial infection is a nosocomial infection.

[0022] Another aspect of the present disclosure is a composition for use in treating a microbial infection. The composition includes at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

[0023] Another aspect of the present disclosure is another composition for use in treating a microbial infection. The composition includes a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

[0024] Another aspect of the present disclosure is a composition for use in a method of treating a microbial infection. The method includes administering to a subject the composition, wherein the composition includes a therapeutically effective amount of at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

[0025] Another aspect of the present disclosure is another composition for use in a method of treating a microbial infection. The method includes administering to a subject the composition, wherein the composition includes a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

[0026] In some embodiments of the composition described herein, the subject to which the composition is administered is a human subject.

[0027] In some embodiments of the composition described herein, the at least one microbial strain is a genetically engineered microbial strain.

[0028] In some embodiments of the composition described herein, the at least one microbial strain includes one or more of strains or strain variants of Escherichia coli, Bacteroides thetaiotaomicron, Bacteroides ovatus, Bacteroides uniformis, Bacteroides vulgatus, Parabacteroides merdae, Enterocloster asparagiformis Dorea loiigicateiia. Agathobacter rectalis, Lachnospira eligens, Bacteroides stercoris, Bacteroides xylanisolvens, Anaerobutyricum hallii LactonifactorAttorney Docket No. 0073605-001128 longoviformis, Faecali bacterium prausnitzii , Blautia producta, Dorea formicigenerans. Blautia obeum, Clostridium spiroforme, Eggerthella lenta, Eubacterium hadrus, Clostridium orbiscindens, Clostridium symbiosum, Bacteroides sp. , Bifidobacteriumlongum subsp. longum, Bacteroides caccae, Bacteroides celhilosilyticus, Bacteroidesdorei, Bacteroides fnegoldii, P ar abacter aides sp. , Peptostreptococcus anaerobius[russellii], Sutterella wadsworthensis, and Clostridium scindens.

[0029] In some embodiments of the composition described herein, the at least one microbial strain includes a Peptostreptococcus anaerobius [russellii] strain or strain variant. In some embodiments, the Peptostreptococcus anaerobius [russellii] strain or strain variant includes at least a DNA sequence in its genome that is complementary to one or more primers according to SEQ ID NOs: 9 and 10.

[0030] In some embodiments of the composition described herein, the at least one microbial strain includes a Dorea longicatena strain or strain variant. In some embodiments, the Dorea longicatena strain or strain variant includes at least a DNA sequence in its genome that is complementary to one or more primers according to SEQ ID NOs: 7 and 8.

[0031] In some embodiments of the composition described herein, the at least one microbial strain includes a single-strain administration of a Peptostreptococcus anaerobius [russellii strain or strain variant.

[0032] In some embodiments of the composition described herein, the at least one microbial strain includes a single-strain administration of a. Dorea longicatena strain or strain variant.

[0033] In some embodiments of the composition described herein, the at least one microbial strain includes a genetically engineered Escherichia coli strain, lactobacilli strain, or Phocaeicola vulgatus strain adapted to overexpress a putA gene or produce a proline-utilizing gene product or enzyme.

[0034] In some embodiments of the composition described herein, the competitive Stickland fermentation performed by the at least one microbial strain includes a reductive Stickland fermentation of proline and, optionally, glycine.

[0035] In some embodiments of the composition described herein, the composition is used to treat an antibiotic-resistant microbial infection. In some embodiments of the composition described herein, the composition is used to treat a Clostridioides difficile infection. In some embodiments of the composition described herein, the composition is used to treat an antibiotic-associated diarrhea.Attorney Docket No. 0073605-001128 In some embodiments of the composition described herein, the composition is used to treat a nosocomial infection.

[0036] In some embodiments of the composition described herein, the composition further includes a vehicle.

[0037] Another aspect of the present disclosure is a synthetic microbiota including the composition described herein.

[0038] Another aspect of the present disclosure is a synthetic microbiota transplant including the composition or the synthetic microbiota described herein.

[0039] In some embodiments of the synthetic microbiota transplant, the synthetic microbiota transplant is, or is used as, a synthetic fecal microbiota transplant.

[0040] Another aspect of the present disclosure is the use of the composition, synthetic microbiota, or synthetic microbiota transplant described herein in the manufacture of a medicament for treating a microbial infection.

[0041] Another aspect of the present disclosure is the use of the composition, synthetic microbiota, or synthetic microbiota transplant described herein in combination with a human fecal transplant in the manufacture of a medicament for treating a microbial infection.

[0042] Another aspect of the present disclosure is a medical kit for treating a microbial infection. The kit includes the composition, synthetic microbiota, or synthetic microbiota transplant described herein and at least an instruction for the use thereof.

[0043] Aspects of the present disclosure provide a safer, more predictable, better-defined, and more scalable approach for combating the recurrence of C. difficile infections.

[0044] These and other aspects and features of nonlimiting embodiments of the present invention will become apparent to those skilled in the art upon review of the following description of specific nonlimiting embodiments of the invention in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] For the purpose of illustrating the invention, the drawings show aspects of one or more embodiments of the invention. However, it should be understood that the present invention is not limited to the precise arrangements and instrumentalities shown in the drawings.

[0046] FIGS. 1A-J depict exemplary data showing that meta-analysis of studies enables rational design of communities that correlate with C. difficile. (A) A total of 12 studies encompassing 899 samples were identified from literature review for inclusion into meta-analysis. (B) Colonization state and sample distribution between studies. Forest plots demonstrate that (C) C. difficile isAttorney Docket No. 0073605-001128 detected in higher abundances in diagnosed individuals which is accompanied by decreased alpha diversity as measured by (D) Shannon’s diversity index (E) Faith’s phylogenetic diversity, and (F) ASV richness. Individual studies were compared using Welch’s t-test of log2-normalized data with the combined estimate derived through linear mixed effect model. (G) Percent variation explained (R2) by C. difficile colonization status with various distance metrics (statistical testing by AD0N1S / PERMAN0VA). (H) C. c / z / Z / cv / t’-colonized samples are clearly distinguished from noncolonized individuals as determined by multivariate analysis (PCoA of Unweighted UniFrac distances with statistical analysis by ADONIS / PERMANOVA, the dashed ellipse denotes the 95% confidence interval) (I) A receiver operator curve of classifier performance on studies whose data was withheld from model training demonstrates that microbiome composition accurately predicts C. difficile colonization irrespective of the masking of C. difficile in the prediction dataset. Mean and standard error from 10 iterations (each with a different external study) are shown. (J) Proportionality analysis of predictive features demonstrates discrete networks of co-abundant microbes negatively predicting C. difficile status. N = 825 samples for all panels.

[0047] FIGS. 2A-K depict exemplary data showing synthetic communities form diverse but distinct communities in vitro and in vivo. (A) Synthetic consortia were constructed from pure culture strains (Table 3) and passaged daily through rich media (N = 4 independent culture lineages). (B) While a significant proportion of hFMT diversity is lost through serial passage, the diversity of sFMTl + Cs is stable. Diversity measured by 16S rRNA gene sequencing, Significance determined by effect of passage number using GLM NB. (C) sFMTl + Cs strain abundances in vitro demonstrate compositional variation as a function of time with the maintenance of 23 / 34 resolvable strain groups after 4 passages (CLR = centered log2 ratio). (D) Rank order relative abundances of sFMTl members are not altered in vitro by the inclusion of C. scindens (sFMTl + Cs, Spearman correlation). (E) Synthetic communities were used to colonize gnotobiotic animals which were followed for a period of 14 days with multi-omics analyses performed. (F) Bacterial load quantified by 16S rRNA qPCR demonstrates that robust colonization is obtained within 1 day of colonization with similar kinetics observed between synthetic communities (sFMTl, sFMTl + Cs) and human fecal transplant (hFMT); however, (G) observed diversity continues to rise over the following 3-7 days (P < 0.034, GLM NB). (H) During colonization of animals, diversity is lost from input pools in both hFMT and sFTMs (P < 6.9e-3 Mann Whitney U test). (I) Strain abundances continue to fluctuate over the experimental period with initial influx of E. coli replaced by more strict anaerobes. (J) Composition of in vivo and in vitro communities differ considerably with some strains onlyAttorney Docket No. 0073605-001128 detected in one condition. Dashed lines represent x = y (red) ± a 2-fold difference in abundance (gray). (K) Within Bacteroides species, intraspecies (infraspecific) variation in colonization efficiency is apparent as determined by strain-resolved metagenomic sequencing (mFUKM: mean fragments per unique kmer per million reads mapped; each point represents one animal).

[0048] FIGS. 3A-F depict exemplary data showing in vivo metabolism of synthetic communities mimics human fecal transplant. (A) sFMTl generates significant concentrations of short chain fatty acids (SCFA) in vivo as compared to germ-free (GF) samples with higher production of acetate and propionate, but lower levels of butyrate compared to human fecal transplant (hFMT). (B) Quantification of metabolites by NMR reveals shared and unique patterns of metabolism by sFMTl compared to GF and hFMT. * Denotes aP < 0.05 in the statistical contrast. (C) Colonization results in elevated total levels of bile acids in all communities with elevated levels of (D) deconjugated and (E) secondary (2°) bile acids. (F) Each community results in a discrete bile acid pool as determined by PCA analysis of 48 bile acid concentrations. Statistical analysis in panels A-E by ANOVA with Tukey HSD.

[0049] FIGS. 4A-J depict exemplary data showing that synthetic communities that are anticorrelated with C. difficile decrease disease activity independent of bile acid 7a-dehydroxylation. (A) Human fecal communities (hFMT) and communities predicted to be inhibitory to C. difficile (sFMTl, sFMTl + Cs) suppress C. difficile during in vitro growth assays while the community of strains positively correlated with C. difficile (proCD) does not (N = 6 biological replicates / group). (B) Experimental design of gnotobiotic infection model: after 7 days of colonization for communities to stabilize (FIGS. 2F-I), mice were challenged with C. difficile spores to follow infection and disease activity (N = 8-9mice / group). (C) All colonization states provided protection against infection-associated mortality. (D) Weight loss, normalized by pre-infection weight, demonstrates variable protection as a function of colonization state (*P < 0.05, **P < 0.01, ***P < 0.001 vs germ-free control). (E) Early weight loss two days post infection (DPI) reveals superior efficacy of hFMT and significant differences between proCD and sFMTl, and sFMTl + Cs. (F) Colonization with hFMT, sFMTl, and sFMTl + Cs result in reduced carriage of C. difficile during early infection as determined by qPCR. (G) Fecal toxin B levels are reduced in early infection by hFMT, sFMTl, and sFMTl + Cs but not proCD. (H) Experimental design for recurrent C. difficile infection model. Mice receive cefoperazone followed by challenge with C. difficile spores. Mice then receive vancomycin in drinking water before two administrations of either synthetic communities, or an autologous fecal transplant (collected before cefoperazone). Both vehicle controlAttorney Docket No. 0073605-001128 and mFMT result in (I) an earlier onset of relapse and (J) increased disease severity compared to sFMTl. Statistics in panels A, D, E, F, and G by Kruskal -Wallis with Dunn’s post-hoc test with Bonferroni correction. Statistics in panels C and J by Kaplan-Meier log-rank test.

[0050] FIGS. 5A-H depict exemplary data showing that strains capable of Stickland fermentation can be both necessary and sufficient for sFMT suppression of C. difficile. (A) Experimental design (N = 8 mice / group). (B)1H- MR of fecal samples before infection (day 0) shows sFMTlAStickland2 has reduced ability to ferment proline into 5-AVA and increases free proline compared to sStickland2. (C) Removal of 2 Stickland fermenting strains removes protection against infection-associated mortality. (D) sStickland2 mice exhibit no infection-associated weight loss while sFMTlAStickland2 mice exhibit weight loss equivalent to germ-free mice. (*P < 0.05, **p < 0.01, ***p < 0.001 vs germ-free control). (E) C. difficile colonization 1 day post infection, and (F) quantification of toxin B demonstrate that sFMTlAStickland2 loses protective effects against C. difficile infection while sStickland2 is sufficient. (G) qPCR quantification of the two strains in sStickland2 colonization is dominated by P. cmaerobius (dashed line denotes limit of detection). (H) Abundance of OTUs represented by sStickland2 members in the human meta-analysis demonstrates decreased carriage is associated with C. difficile colonization status (P < le-4 for both strains, Fisher’s Exact Test). Numbers above plot represent the number of colonized individuals over the total number in each group. Statistical analysis in panel C by log-rank test. Statistical analysis in panel B, D-G by Kruskal -Wallis with Dunn’s post-hoc test with Bonferroni correction.

[0051] FIGS. 6A-H depicts exemplary data showing that a single-strain administration of P. anaerobius can be necessary and sufficient for sFMT suppression of C. difficile through competition for proline. (A) Experimental design (N = 8 mice / group). (B)1H-NMR of fecal samples before infection (day 0) demonstrates that P. cmaerobius ferments proline into 5-AVA in vivo with high efficiency. (C) P. anaerobius mono-colonized mice exhibit no infection-associated weight loss comparable to hFMT while sFMTl APa mice exhibit weight loss equivalent to germ-free mice. (*P < 0.05, **P < 0.01, ***P < 0.001 vs germ-free control, Kruskal-Wallis with Dunn’s post-hoc test and Bonferroni correction). (D) Fecal C. difficile and (E) toxin B quantification demonstrate that P. anaerobius protects against infection, and that protection is lost in sFMTl APa colonized mice. (F) P. anaerobius results in reduced expression of pro-inflammatory cytokines 7-days post infection compared to sFMTl APa. (G) C. difficile growth in P. anaerobius supernatants was partially rescued by supplementation with proline, but was not further enhanced through additional amino acids or peptone. Abbreviations: Cd-C. difficile, Min-ATCC trace mineral supplement, Vit-ATCC vitaminAttorney Docket No. 0073605-001128 mix, Glu-glucose, AA mix contains phenylalanine, glycine, threonine, tryptophan, tyrosine, and proline. (H) Competition with PutA expressing E. coli significantly reduced C. difficile outgrowth in vitro compared to vehicle and vector controls in both growth media tested (N = 6 / group). Statistical analysis in panel B-F&H by Kruskal-Wallis with Dunn’s post-hoc test with Bonferroni correction; G by Kruskal-Wallis with Dunn’s post-hoc test with Benjamini-Hochberg correction.

[0052] FIGS. 7A-E depict exemplary results showing that meta-analysis of studies enables rational design of communities that correlate with C. difficile relating to FIGS. 1A-J. (A) Percent cumulative variation explained by each axis (scree plot) calculated for beta diversity metrics shows phylogenetic-weighted metrics (PhTLR Euclidean and unweighted UniFrac) capture the highest proportion of variation in the dataset. Area under the receiver operator curve (AUROC) for random forest classification of both withheld samples (B) and studies (C) shows variable performance for classification accuracy. Normalization strategies and censoring of C. difficile (Cd.) demonstrate that data normalized to proportions have better performance than normalized to log ratios, and that the performance of the model is more dependent on data normalization strategy than on C. difficile inclusion. (N = 10 permutations / model, ANOVA with TukeyHSD). (D) Feature importance (mean decrease in GINI) plotted over prediction rank demonstrates a limited set of features predict C. difficile colonization. The dashed line represents 200 features. (E) The top 200 most important features are distributed across multiple phyla and are significantly different between Cd colonized individuals and controls (Welch’s t-test mean log2(fold change) and 95% CI shown).

[0053] FIGS. 8A-D depict exemplary results train quantification related to FIGS. 2A-K. (A) The heatmap displays the mean abundance (determined via amplicon sequencing) of resolvable strain groups for both in vitro and in vivo experiments demonstrating the absence of C. scindens in sFMTl and variable engraftment over time. N = 4 replicates (in vitro) and N = 8 mice (in vivo). (B) Metagenomic strain-resolved input abundances in sFMTl and sFMTl + Cs demonstrates even pooling and the absence of C. scindens in sFMTl. Points and error bars represent median and 1QR across subcontigs, FUKM: fragments per thousand unique k-mers per million reads mapped (see Methods). (C) Quantification of strain abundances after 7 days in vivo reveals variation over 5 orders of magnitude with the additional strain richness noted with the inclusion of C. scindens (N = 8-9 mice / group). (D) Analyses of communities using YACHT (Yes / No Answers to Community membership via Hypothesis Testing) which provides a statistical approach for detecting strain presence which confirms variable engraftment between sFMTl and sFMTl + Cs. Unique k-mers represent the number of k-mers unique to each genome detected which must be above 0.01XAttorney Docket No. 0073605-001128 coverage of unique k-mer content providing a false positive rate of approximately 0.044 and a false negative rate of approximately 0.024. Xs denote strains which do not have significant enough coverage to conclude their presence within samples.

[0054] FIGS. 9A-C depict exemplary results showing that microbial communities elicit differential bile acid pools related to FIGS. 3A-F. (A) Prediction of bile acid metabolism genes in sFMTl+Cs members using HMMs. Only C. scindens shows evidence of a pathway for 7 a-dehydroxylation. (B) Bile acid concentrations (converted to Z scores) are displayed on a per-animal basis with statistical contrasts between groups displayed in the lower panel (ANOVA of log2 transformed abundances with Tukey HSD, * denotes adjusted P < 0.05, N = 9 mice in GF and sFMTl + Cs, N = 8 mice in sFMTl, and N = 7 mice in hFMT). (C) Determination of differential bile acid metabolites between sFMTl and sFMTl + Cs reveals expected 7a-dehydroxylation to form LCA and DCA with decreased deconjugation of host-derived GCA (P < 0.05 Welch’s T-test).

[0055] FIGS. 10A-G depict exemplary supplemental data related to FIGS. 4A-J. (A) Quantification of C. difficile carriage in gnotobiotic mice by qPCR demonstrates all mice are eventually colonized (*P < 0.05, **P < 0.01, ***P < 0.001 vs germ-free control). (B) Experimental design for replication gnotobiotic infection model: after 14 days of colonization for communities to stabilize, mice were challenged with C. difficile spores to follow infection and disease activity for 2 days (N = 5 mice / group). (C) Weight loss (normalized by pre-colonization weight) demonstrates successful colonization of sFMT communities indicated by ~5% weight loss due to reduction in cecal content, and (D) weight loss (normalized to pre-infection) shows sFMT communities provide protection against infection-associated weight loss. (E) 2 days post-infection sFMTl + Cs significantly reduced C. difficile abundance by qPCR with a trend of (F) reduced toxin expression. (G) Fecal transplant from mice in our conventional animal facility offer poor protection against C. difficile. Mice were either directly colonized from C57BL / 6J mice housed in our facility for 8 weeks, or from gnotobiotic mice that had been previously colonized using fecal material from a healthy human donor (Kaplan Meier log rank test). Statistics in panels A,D-F by Kruskal-Wallis with Dunn’s post-hoc test with Bonferroni correction.

[0056] FIGS. 11 A-S depict exemplary supplemental data relating to FIGS. 5A-H. (A) Proline is consumed by sFMTl but not hFMT in vivo while 5-AVA is only significantly produced by sFMTl as determined by NMR (experimental description in Figure 4B). (B) Prediction of Stickland fermentation gene homologs in sFMT strains on the basis of KEGG HMMs for relevant enzymes. (C) In vitro validation of loss of Stickland fermentation in sFMTIASticklandl. (D) Description ofAttorney Docket No. 0073605-001128 experiment to test necessity of Stickland-fermenting strains in C. difficile suppression (N = 8 mice / group). Removal of Stickland fermenting strains results in loss of protection against C. difficile infection as measured by (E) survival, (F) weight loss, (G) C. difficile quantification by qPCR, and (H) toxin B expression. (I) Experimental design to determine necessity and sufficiency of 8 predicted Stickland fermenting strains in C. difficile suppression (N = 8 mice / group). (J) NMR confirmation that 5-AVA is not produced in sFMTl ASticklandl in vivo while only marginal decreases in free proline are observed. Statistical testing by linear mixed effect model where colonization represents the contrast between pre-colonization and pre-infection, and community represents contrasts between synthetic communities. (K) Survival data, (L) infection-associated weight loss, (M) C. difficile colonization 1 day post-infection, and (N) quantification of toxin B demonstrate that sFMTl ASticklandl is necessary for protection against C. difficile infection while sSticklandl is sufficient for protection. (O) Quantification of metabolites by NMR demonstrates that sFMTl ASticklandl also has reduced production of Acetate and Butyrate. * Denotes a P < 0.05 in the denoted contrast. (P) In vitro growth in biologically relevant concentrations of 5-AVA (10 mM) demonstrates 5-AVA has no effect on vegetative cell growth or production of toxin B (inset; N = 4 / group). (Q) Sporulation assays in the presence of 5-AVA demonstrate 5-AVA neither induces germination, nor inhibits TCA-induced germination(N = 4 / group). (R) Analysis of Stickland fermentation in sSticklandl strains demonstrates that JEB00029 and JEB000254 ferment proline to 5-AVA in vitro (N = 4 / group). (S) Quantification of metabolites by NMR demonstrates a minimal number of differential metabolites between germ-free and sStickland2 colonized animals. * Denotes a P < 0.05 in the denoted contrast. Statistics in panels A, C, F-H, M, N, P, Q by Kruskal-Wallis with Dunn’s post-hoc test with Bonferroni correction. *P < 0.05, **P < 0.01, ***p < 0.001 vs germ-free control. Statistics in panels E and K by Kaplan-Meier log-rank test. Statistical analysis in panels O and S by ANOVA and TukeyHSD.

[0057] FIGS. 12A-J depict supplemental data relating to FIGS. 6A-H. (A) 'H-NMR of fecal samples before infection (day 0) shows the removal of P. anaerobius abolished the ability to ferment proline to 5-AVA in sFMTl APa group. (B) qPCR quantification shows P. anaerobius can colonize germ-free mice gut to high abundance (dashed line denotes limit of detection). (C) Bile acid profiling demonstrates that mice colonized with sStickland2 have no differentially abundant bile acids compared to germ-free mice indicating protective action is bile acid independent. Cytokine analysis of colon tissue (D) pre- and (E) 7 days post-infection (N = 4 mice / group pre-infection and N = 8 mice / group post-infection). Gray values indicate samples with insufficient protein yield forAttorney Docket No. 0073605-001128 analysis. (F) Deferred antagonism assays and (G) disk diffusion (N = 3 / group) assays demonstrate no evidence of formation of C. difficile inhibitory metabolites by P. anaerobius. Litnosilactobacillus reuteri was included as positive control given known formation of reuterin and organic acids. (H) Profding P. anaerobius supernatants reveals depletion of several amino acids including proline (N = 4 / group). (I) The proline utilization A gene (putA) was cloned into E. coli W3110 to test the effect of proline competition in C. difficile inhibition. (J) PutA-expressing cells consume significantly more proline than cells only containing the vector (N = 4 / group). Statistical analysis in panel A, C, D, E, and H by ANOVA of log2 transformed concentrations with Tukey HSD, * denotes adjusted P < 0.05; D by log-rank test. Statistical analysis in panel B by Kruskal-Wallis with Dunn’s post-hoc test with Bonferroni correction and J by Wilcox test.

[0058] The drawings are not necessarily to scale and may be illustrated by phantom lines, diagrammatic representations, and fragmentary views. In certain instances, details that are not necessary for an understanding of the embodiments or that render other details difficult to perceive may have been omitted.DETAILED DESCRIPTION

[0059] To facilitate the understanding of this invention, a number of terms are defined below and throughout the disclosure. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control. The terminology herein is used to describe specific embodiments of the invention, but their usage does not limit the invention, except as outlined in the claims. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0060] It is to be understood that any aspect and / or element of any embodiment of the method(s) described herein or otherwise may be combined in any way to form additional embodiments of the method(s), all of which are within the scope of the method(s).

[0061] Where a process is described herein, those of ordinary skill in the art will appreciate that the process may operate without any user intervention. In another embodiment, the process includes some human intervention (e.g., a step is performed by or with the assistance of a human).Attorney Docket No. 0073605-001128

[0062] As used herein, including the claims, the phrase “at least some” means “one or more” and includes the case of only one. Thus, e.g., the phrase “at least some ABCs” means “one or more ABCs” and includes the case of only one ABC.

[0063] As used herein, including the claims, the term “at least one” should be understood as meaning “one or more” and therefore includes both embodiments that include one or multiple components. Furthermore, dependent claims that refer to independent claims that describe features with “at least one” have the same meaning, both when the feature is referred to as “the” and “the at least one”.

[0064] As used herein, the term “portion” means some or all. Therefore, for example, “a portion of X” may include some of “X” or all of “X”. In the context of a conversation, the term “portion” means some or all of the conversation.

[0065] As used herein, including the claims, the phrase “using” means “using at least” and is not exclusive. Thus, e.g., the phrase “using X” means “using at least X”. Unless specifically stated by use of the word “only”, the phrase “using X” does not mean “using only X”.

[0066] As used herein, including the claims, the phrase “based on” means “based in part on” or “based, at least in part, on” and is not exclusive. Thus, e.g., the phrase “based on factor X” means “based in part on factor X” or “based, at least in part, on factor X”. Unless specifically stated by use of the word “only”, the phrase “based on X” does not mean “based only on X”.

[0067] In general, as used herein, including the claims, unless the word “only” is specifically used in a phrase, it should not be read into that phrase.

[0068] As used herein, including the claims, the phrase “distinct” means “at least partially distinct”. Unless specifically stated, distinct does not mean fully distinct. Thus, e.g., the phrase “X is distinct from Y” means that “X is at least partially distinct from Y” and does not mean that “X is fully distinct from Y”. Thus, as used herein, including the claims, the phrase “X is distinct from Y” means that X differs from Y in at least some way.

[0069] It should be appreciated that the words “first”, “second”, and so on, in the description and claims, are used to distinguish or identify, and not to show a serial or numerical limitation.

[0070] Similarly, letter labels (e.g., “(A)”, “(B)”, “(C)”, and so on, or “(a)”, “(b)”, and so on) and / or numbers (e.g., “(i)”, “(ii)”, and so on) are used to assist in readability and to help distinguish or identify, and are not intended to be otherwise limiting or to impose or imply any serial or numerical limitations or orderings. Similarly, words such as “particular”, “specific”, “certain”, andAttorney Docket No. 0073605-001128 “given”, in the description and claims, if used, are to distinguish or identify, and are not intended to be otherwise limiting.

[0071] As used herein, including the claims, the terms “multiple” and “plurality” mean “two or more,” and include the case of “two”. Thus, e.g., the phrase “multiple ABCs” means “two or more ABCs” and includes “two ABCs”. Similarly, e.g., the phrase “multiple PQRs” means “two or more PQRs” and includes “two PQRs”.

[0072] The present invention also covers the exact terms, features, values, and ranges, etc., in case these terms, features, values, and ranges, etc., are used in conjunction with terms such as “about”, “around”, “generally”, “substantially”, “essentially”, “at least”, etc. Thus, e.g., “about 3” or “approximately 3” shall also cover exactly 3, and “substantially constant” shall also cover exactly constant.

[0073] It should be understood that every maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

[0074] As used herein, unless stated otherwise, the terms “about” or “approximately” refer to a value that is within 10% above or below the value being described.

[0075] As used herein, including the claims, singular forms of terms are to be construed as also including the plural form and vice versa, unless the context indicates otherwise. Thus, it should be noted that as used herein, the singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. In other words, terms such as “a”, “an”, and “the” are not intended to refer to only a singular entity but include the general class of which a specific example may be used for illustration.

[0076] Throughout the description and claims, the terms “comprise”, “including”, “having”, “contain”, and their variations should be understood as meaning “including but not limited to” and are not intended to exclude other components unless specifically so stated.

[0077] As used herein, a “subject” includes, but is not limited to, humans and non-human vertebrates such as wild, domestic, and farm animals. The terms “subject” and “patient” may be used interchangeably throughout this disclosure. As a nonlimiting example, a subject or patient canAttorney Docket No. 0073605-001128 include a human of any age, sex, gender, race, ethnicity, health record, etc., as deemed relevant and / or suitable by a person of ordinary skill in the art, upon reviewing the entirety of this disclosure. Additional nonlimiting examples of subjects or patients can include mammals or birds, such as without limitation, non-human primates, cats, dogs, cows, horses, rodents, pigs, sheep, goats, and poultry. The term subject can refer to any individual in need of treatment. While the present invention primarily describes treatment of human subjects, it should be noted that the scope of the present invention is not limited to human subjects.

[0078] As used herein, the terms “administration” or “administering” refer to a method of giving a dosage of a compound or pharmaceutical composition to a subject. A composition described herein may be administered to a subject by any one of a variety of manners or a combination of varieties of manners. In general, a composition may be administered orally (e.g., as tablets or capsules), nasally, intraperitoneally, or parenterally, by intravenous, intramuscular, topical, or subcutaneous routes, or by injection into tissue. Nonlimiting examples of administration include an administration via colonoscopy / endoscopy, which delivers a compound or pharmaceutical composition directly to the colon or upper small intestine of the subject; an administration via enema, which delivers a compound or pharmaceutical composition directly to the rectum of subject; an administration via a nasogastric (NG) tube, which delivers a compound or pharmaceutical composition from the nose to the stomach of the subject; among others.

[0079] As used herein, an “effective amount” or “therapeutically effective amount” is the amount of a composition of this disclosure which, when administered to a subject, is sufficient to effect treatment of a disease or condition in the subject. The amount of a composition of this disclosure which constitutes a “therapeutically effective amount” may vary depending on the composition, the condition and its severity, the manner of administration, and the age of the subject to be treated.

[0080] As used herein, the terms “treat”, “treating”, or “treatment” refer to administration of a compound or pharmaceutical composition for a therapeutic purpose. To “treat a disorder” or use for “therapeutic treatment” refers to administering treatment to a patient already suffering from a disease to ameliorate the disease or one or more symptoms thereof to improve the patient’s condition (e.g., by reducing one or more symptoms of a neurological disorder). The term “therapeutic” includes the effect of mitigating deleterious clinical effects of certain processes (i.e., consequences of the process, rather than the symptoms of processes). As nonlimiting examples, a treatment may include (i) preventing a disease or condition from occurring in a subject, in particular, when such subject isAttorney Docket No. 0073605-001128 predisposed to the condition but has not yet been diagnosed as having it; (ii) inhibiting a disease or condition, i.e., arresting its development; (iii) relieving a disease or condition, i.e., causing regression of the disease or condition; or (iv) relieving the symptoms resulting from a disease or condition, i.e., relieving pain without addressing the underlying disease or condition.

[0081] It will be appreciated that variations to the embodiments of the invention can be made while still falling within the scope of the invention. Alternative features serving the same, equivalent, or similar purpose can replace features disclosed in the specification, unless stated otherwise. Thus, unless stated otherwise, each feature disclosed represents one example of a generic series of equivalent or similar features.

[0082] Use of exemplary language, such as “for instance”, “such as”, “for example” (“e.g.,”), and the like, is merely intended to better illustrate the invention and does not indicate a limitation on the scope of the invention unless specifically so claimed.

[0083] While the invention has been described in connection with what is presently considered to be the most practical and embodiments thereof are further described in the examples below, it is to be understood that the invention is not to be limited to the disclosed embodiment, but on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

[0084] The following description sets forth various examples along with specific details to provide a thorough understanding of claimed subject matter. It will be understood by those skilled in the art, however, that claimed subject matter may be practiced without one or more of the specific details disclosed herein. Further, in some circumstances, well-known methods, procedures, systems, and / or components have not been described in detail in order to avoid unnecessarily obscuring claimed subject matter. The illustrative embodiments described in the detailed description and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented here. It will be readily understood that the aspects of the present disclosure, as generally described herein, can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are explicitly contemplated and make part of this disclosure.Method for Treating a Microbial Infection

[0085] An objective of the present disclosure is to provide a method for treating a microbial infection in a subject. In some embodiments, the method includes administering to the subject a composition including a therapeutically effective amount of at least one microbial strain adapted toAttorney Docket No. 0073605-001128 perform a competitive Stickland fermentation, provide a mechanism of proline depletion, or otherwise reduce available proline concentration. In some embodiments, the method includes administering to the subject a composition including a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

[0086] As used herein, a “microbe” is a microscopic organism. Nonlimiting examples of a microbe include bacteria, archaea, fungi, protozoa, viruses, and / or the like. A microbe has the ability to perform certain biological processes, such as without limitation, fermentation, gene expression, and metabolite production, among others. The terms “microbe” and “microorganism” maybe used interchangeably throughout the present disclosure.

[0087] As used herein, a “microbial strain” is a genetic variant or subtype within a species of microbe, often with one or more unique and well-defined characteristics that distinguish it from other member(s) of the same species. Such characteristics include without limitation metabolism, growth patterns, resistance to antibiotics, disease-causing ability, among other phenotypes. The terms “microbial strain” and “strain” may be used interchangeably throughout the present disclosure.

[0088] In some embodiments of the method described herein, the at least one microbial strain is a genetically engineered microbial strain. As used herein, a “genetically engineered microbial strain” is a microbial strain whose genetic material has been manipulated to alter one or more of its hereditary traits. Such manipulation may include without limitation inserting, deleting, or otherwise modifying one or more specific DNA sequences; as a result of such manipulation, a genetically modified microbial strain may exhibit one or more different traits in its structure, function, or the like, compared to its naturally occurring counterparts.

[0089] The microbial strain or genetically engineered microbial strain described herein can include a nucleic acid sequence based on, or synthetically derived from, a DNA, an RNA, or a peptide nucleic acid (PNA), among others. Accordingly, genetic information can be stored within the nucleic acid sequence through unique sequences of nucleobases (e.g., ATGC for DNA and AUGC for RNA). A nucleic acid sequence includes a coding sequence that encodes a peptide and one or more regulatory elements that regulate the expression of the coding sequence. Exemplary embodiments of a regulatory element may include a promoter, an enhancer, a silencer, an insulator, an operator, and a response element, among others.

[0090] As used herein, a “promoter” is a DNA sequence where an RNA polymerase binds to initiate transcription. As used herein, an “enhancer” is a distant element of DNA sequence thatAttorney Docket No. 0073605-001128 increases transcription rates by interacting with a promoter via DNA looping. As used herein, a “silencer” is a DNA sequence that represses transcription when bound by specific proteins. As used herein, an “insulator” is a DNA sequence that prevents the interaction between one or more enhancers and one or more promoters of neighboring genes. As used herein, an “operator” is a DNA segment that regulates the transcription of adjacent genes. As used herein, a “response element” is a DNA sequence that responds to external signals, allowing genes to be turned on or off in response to environmental changes. These regulatory elements may work together to ensure a precise gene expression necessary for proper cellular function.

[0091] Tn some embodiments, a nucleic acid sequence can include one or more operons. As used herein, an “operon” is a functioning unit of DNA containing a cluster of genes under the control of a single promoter. It is commonly found in prokaryotes such as bacteria. These genes are transcribed together into a single messenger RNA strand and typically encode proteins that work together in a specific biological pathway. An operon can include a regulatory element, such as an operator as described above, where an activator or repressor protein may bind to increase or inhibit transcription. An operon can include one or more regulatory genes that encode one or more such activator or repressor proteins.

[0092] In some cases, promoter engineering can be used to improve the transcriptional level of a nucleic acid sequence or gene. Promoter engineering modifies the promoter region to increase gene expression levels, thereby improving enzyme production and activity. In one or more embodiments, codon optimization can be used to improve the translational efficiency of a gene. For the purposes of this disclosure, “codon optimization” is a technique used in genetic engineering to improve the expression of a gene in a particular host organism. Codon optimization involves altering the DNA sequence of a gene to use codons that are more frequently preferred by the host organism’s translational machinery. A codon optimization process may take into account a codon bias of the host, ensuring that a synthetic gene sequence is translated more efficiently into the desired protein. Codon optimization may enhance the yield and function of a protein, which may be useful for various applications in biotechnology and synthetic biology. It is worth noting that promoter engineering and codon optimization are distinct yet complementary techniques in genetic engineering. Promoter engineering involves modifying the promoter region of a gene to enhance its expression by improving the binding efficiency of transcriptional machinery. Codon optimization, on the other hand, focuses on altering the coding sequence of a gene to use preferred codons of the host organism, thereby improving translation efficiency. While both aim to increase proteinAttorney Docket No. 0073605-001128 production, promoter engineering targets transcriptional levels, and codon optimization targets translational efficiency. Combining both techniques may in some cases synergistically enhance an overall gene expression.

[0093] A genetically engineered microbial strain can be constructed using recombinant DNA technology. As used herein, “recombinant DNA technology”, often referred to as genetic engineering, is a type of technology that involves using enzymes and various laboratory techniques to manipulate and isolate DNA segments of interest. Recombinant DNA technology can be used to combine (or splice) DNA from different species or to create genes with new functions. The resulting DNA copies are often referred to as recombinant DNA. Such recombinant DNA can subsequently be propagated in a host cell, such as without limitation a bacterial or yeast cell, whose cellular machinery copies and expresses the recombinant DNA along with its own.

[0094] A genetically engineered microbial strain can include a plasmid. As used herein, a “plasmid” is a circular, double-stranded DNA molecule. Plasmids are distinct from a cell’s chromosomal DNA and are capable of autonomous replication. Plasmids may be used as vectors for insertion, expression, and propagation of foreign genes within a host organism. Such vectors may include specific sequences for an origin of replication, selectable markers, and cloning sites, enabling manipulation and study of genetic material for applications in research, biotechnology, and therapeutic development.

[0095] As used herein, a “strain variant” or “variant” of a microbial strain is a subtype of a microbe or microorganism that is genetically distinct from a main or dominant microbial strain, but not sufficiently different to be termed a distinct strain microorganism. As nonlimiting examples, a strain variant can have at least 94%, at least 95, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, etc., of sequence identity over the shared portion of the genome with respect to a main or dominant microbial strain.

[0096] Sequence identity between two nucleic acid sequences can be determined by comparing an alignment of the sequences. When an equivalent position in the compared sequences is occupied by the same nucleobase, then the molecules are identical at that position. Scoring an alignment as a percentage of identity is a function of the number of identical nucleobases at positions shared by the compared sequences. When comparing sequences, optimal alignments may require gaps to be introduced into one or more of the sequences to take into consideration possible insertions and deletions in the sequences. Sequence comparison methods may employ gap penalties so that, for the same number of identical molecules in sequences being compared, a sequence alignment with as fewAttorney Docket No. 0073605-001128 gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. Calculation of maximum percent identity involves the production of an optimal alignment, taking into consideration gap penalties.

[0097] In some embodiments of the method described herein, the at least one microbial strain includes one or more of strains or strain variants of Escherichia coli, Bacteroides thelaioiaomicron, Bacteroides ovatus, Bacteroides uniformis, Bacteroides vulgatus, Parabacteroides merdae, Enterocloster asparagiformis, Dorea longicatena, Agathobacter rectalis, Lachnospira eligens, Bacteroides stercoris, Bacteroides xylani solvens, Anaerobutyricum hallii, Lactonifactor longoviformis, Faecalibacterinm prausnitzii, Blautia producta, Dorea formicigenerans, Blantia obeum, Clostridium spiroforme, Eggerthella lenta, Eubacterium hadrus, Clostridium orbiscindens, Clostridium symbiosum, Bacteroides sp. , Bifidobacteriumlongum subsp. longum, Bacteroides caccae, Bacteroides cellulosilyticus, Bacteroidesdorei, Bacteroides finegoldii, Parabacteroides sp. , Peptostreptococcus anaerobius[russellii], Sutterella wadsworthensis, and Clostridium scindens.

[0098] In some embodiments of the method described herein, the at least one microbial strain includes a Peptostreptococcus anaerobius [russellii] strain or strain variant. As a nonlimiting example, the at least one microbial strain can be at least 90%, preferably at least 91%, more preferably at least 93%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, etc., with respect to strain CC14N, in accordance with details described throughout the present disclosure. In some embodiments, the Peptostreptococcus anaerobius [russellii] strain or strain variant includes at least a DNA sequence that is complementary to and / or defined by primers according to SEQ ID NOs: 9 and 10.

[0099] In some embodiments of the method described herein, the at least one microbial strain includes a Dorea longicatena strain or strain variant. As a nonlimiting example, the at least one microbial strain can be at least 90%, preferably at least 91%, more preferably at least 93%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, etc., with respect to strain DSM 13814, in accordance with details described throughout the present disclosure. In some embodiments, the Dorea longicatena strain or strain variant includes at least a DNA sequence that is complementary to and / or defined by primers according to SEQ ID NOs: 7 and 8.

[0100] In some embodiments, the at least one microbial strain includes a single-strain administration of microbes. As used herein, a “single-strain administration” is a population of microbes that includes substantially a single type or strain of microbes.Attorney Docket No. 0073605-001128

[0101] In some embodiments of the method described herein, the at least one microbial strain includes a single-strain administration of a Peptostreptococcus anaerobius [russellii] strain or strain variant. In some embodiments of the method described herein, the at least one microbial strain includes a single-strain administration of aDorea longicatena strain or strain variant. The present disclosure demonstrated that administration of a single microbial strain (e.g., Peptostreptococcus anaerobius [russellii} or Dorea longicatena} is, unexpectedly, at least as efficacious in preventing CDI as a human fecal transplant. Such feature of the present disclosure provides precise formulations with well-defined mechanisms of action, which offers a pathway to improved safety, reproducibility, and efficacy for microbiome-targeted therapies. The present disclosure accordingly marks a paradigm shift in C. difficile therapeutics: a very limited number of strains with defined metabolic functions may be used instead of, or in addition to complex human-derived products or communities. This paradigm shift helps limit potential off-target side effects of microbiome therapies as well as improving the production efficiency and regulatory compliance of consortia-based therapeutics.

[0102] In some embodiments of the method described herein, the at least one microbial strain includes a genetically engineered Escherichia coli strain, lactobacilli strain, or Phocaeicola vulgatus strain adapted to overexpress a putA gene or produce a proline-utilizing enzyme. Specifically, the putA gene encodes a PutA protein, which is a large, multifunctional, and membrane-associated flavoprotein that is central to proline metabolism and its regulation in E. coli. First, PutA acts as a bifunctional enzyme, catalyzing the two-step oxidation of L-proline to L-glutamate. Second, when proline levels are low, the soluble form of the PutA protein binds to a specific DNA region and represses the expression of both the putA gene itself and the putP gene (which encodes a proline transporter). The switch between the repressor function and the membrane-bound enzymatic function of the PutA protein is regulated by the presence / absence of proline and the redox state of its FAD cofactor. In some embodiments, the genetically engineered Escherichia coli strain can include a wild-type (WT) Escherichia coli W3110 strain. In some embodiments, the genetically engineered Escherichia coli strain can be developed in an Escherichia coli background. In some embodiments, the at least one microbial strain includes a genetically engineered lactobacilli strain adapted to overexpress a putA gene or produce a proline-utilizing enzyme. In some embodiments, the at least one microbial strain includes a Phocaeicola vulgatus (P. vulgatus strain adapted to overexpress a putA gene or produce a proline-utilizing enzyme.Attorney Docket No. 0073605-001128

[0103] In some embodiments, the genetically engineered microbial strain, such as a genetically engineered Escherichia coli strain described herein, can survive and / or proliferate in the gut without requiring antibiotic marker(s).

[0104] In some embodiments, a proline Stickland fermentation pathway of Peptostreptococcus anaerobius [russellii], as described herein, can be engineered into the E. coli chromosome (prdCABF, which is an operon containing prdC, prdA, prdB, and prdF genes). The resulting genetically engineered Escherichia coli strain can facilitate the use of an amber-less E. coli background due to the requirement for a synthetic tRNA encoding selenocysteine.

[0105] In some embodiments, the genetically engineered microbial strain described herein can be created in the background of one or more Lactobacillus casei group members or strains to generate hyper-proline-utilizing probiotic strains. Such an approach could potentially obtain a Generally Recognized As Safe (GRAS) status for the compositions described herein. Specifically, these probiotic strains are believed to be positively associated with the presence of C. difficile, likely due to their intrinsic resistance to vancomycin, an antibiotic commonly used for treating C. difficile infections and the like.

[0106] In some embodiments, as part of a treatment protocol, the method further includes selecting a genetically engineered microbial strain during the same antibiotic treatment(s) that predisposes a subject or patient to C. difficile infection.

[0107] In some embodiments of the method described herein, the method further includes reducing a level of one or more inflammatory markers, such as without limitation, a level of IL- 10, IL-6, and / or TNF-a, in the subject. As nonlimiting examples, the method described herein can include reducing a level of one or more inflammatory markers in the subject, such as without limitation, a level of fL-10, IL-6, and / or TNF-a, by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 80%, etc., with respect to a level of the one or more respective inflammatory markers prior to administration of the composition.

[0108] As used herein, a “competitive Stickland fermentation” is a Stickland fermentation process that competitively consumes or exhausts one or more nutrients or reactants required or replied upon by a pathogenic microbe responsible for a microbial infection, thereby hindering or preventing the growth / proliferation or survival of the pathogenic microbe. As used herein, a “Stickland fermentation” or “Stickland reaction” is a coupled redox reaction between two amino acids. Specifically, a Stickland fermentation or Stickland reaction oxidizes an electron-donor amino acid (i.e., Stickland donor) to form a carboxylic acid that is one carbon atom shorter than the originalAttorney Docket No. 0073605-001128 amino acid while reducing an electron-acceptor amino acid (i.e., Stickland acceptor) to form its corresponding deaminated carboxylic acid having the same length as the original amino acid.Specific amino acids can act as Stickland acceptors, as Stickland donors, or as both. Some amino acids, e.g., proline and glycine, can follow modified pathways of a Stickland fermentation. A person of ordinary skill in the art would be able to recognize the role of competitive Stickland fermentation in the invention described herein upon reviewing the entirety of the present disclosure.

[0109] In some embodiments of the method described herein, the competitive Stickland fermentation includes a reductive Stickland fermentation of proline that produces (5-aminovalerate, 5-AVA). Embodiments of the microbial strain(s) described herein can be configured to exhibit a high capacity for proline metabolism for the treatment and prevention of C. difficile infection. In some embodiments of the method described herein, the competitive Stickland fermentation includes a reductive Stickland fermentation of glycine that produces acetyl phosphate.

[0110] In some embodiments of the method described herein, wherein the microbial infection includes an antibiotic-resistant microbial infection. In some embodiments of the method described herein, the microbial infection includes a Clostridioides difficile infection, such as without limitation colitis, pseudomembranous colitis, and toxic megacolon, among others. In some embodiments of the method described herein, the microbial infection is an antibiotic-associated diarrhea. In some embodiments of the method described herein, the microbial infection is a nosocomial infection. Composition for Use in Treating a Microbial Infection[OHl] Another objective of the present disclosure is to provide a composition for use in treating a microbial infection. In some embodiments, the composition includes at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion, in accordance with details described throughout the present disclosure. In some embodiments, the composition includes a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion, in accordance with details described throughout the present disclosure.

[0112] Another objective of the present disclosure is to provide a composition for use in a method of treating a microbial infection. In some embodiments, the method includes administering to a subject the composition, wherein the composition includes a therapeutically effective amount of at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion, in accordance with details described throughout the presentAttorney Docket No. 0073605-001128 disclosure. In some embodiments, the method includes administering to a subject the composition, wherein the composition includes a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion, in accordance with details described throughout the present disclosure.

[0113] In some embodiments of the composition described herein, the at least one microbial strain is a genetically engineered microbial strain, in accordance with details described throughout the present disclosure.

[0114] Tn some embodiments of the composition described herein, the at least one microbial strain includes one or more of strains or strain variants of Escherichia coli, Bacteroides thetaiotaomicron, Bacteroides ovatus, Bacteroides uniformis, Bacteroides vulgatus, Parabacteroides merdae, Enterocloster asparagiformis Dorea longicatena. Agathobacter rectalis, Lachnospira eligens, Bacteroides stercoris, Bacteroides xylanisolvens, Anaerobutyricum hallii Lactonifactor longoviformis, Faecalibacterium prausnilzii, Blautia producta. Dorea formicigenerans, Blautia obeum. Clostridium spiroforme, Eggerthella lenta Eubacterium hadrus, Clostridium orbiscindens, Clostridium symbiosum, Bacteroides sp. , Bifidobacteriumlongum subsp. longum, Bacteroides caccae, Bacteroides cellulosilyticus, Bacteroidesdorei, Bacteroides finegoldii, Parabacteroides sp. , Peptostreptococcus anaerobius[russellii], Sutterellawadsworthensis, and Clostridium scindens, in accordance with details described throughout the present disclosure.

[0115] In some embodiments of the composition described herein, the at least one microbial strain includes a Peptostreptococcus anaerobius [russellii strain or strain variant, in accordance with details described throughout the present disclosure.

[0116] In some embodiments of the composition described herein, the at least one microbial strain includes a Dorea longicatena strain or strain variant, in accordance with details described throughout the present disclosure.

[0117] In some embodiments of the composition described herein, the at least one microbial strain includes a single-strain administration of a Peptostreptococcus anaerobius russellii strain or strain variant, in accordance with details described throughout the present disclosure.

[0118] In some embodiments of the composition described herein, the at least one microbial strain includes a single-strain administration of a Dorea longicatena strain or strain variant, in accordance with details described throughout the present disclosure.Attorney Docket No. 0073605-001128

[0119] In some embodiments of the composition described herein, the at least one microbial strain includes a genetically engineered Escherichia coli strain, lactobacilli strain, or Phocaeicola vulgatus strain adapted to overexpress a putA gene or a proline-utilizing enzyme, in accordance with details described throughout the present disclosure.

[0120] In some embodiments of the composition described herein, the competitive Stickland fermentation performed by the at least one microbial strain includes a reductive Stickland fermentation of proline and, optionally, glycine, in accordance with details described throughout the present disclosure.

[0121] In some embodiments of the composition described herein, the composition is used to treat an antibiotic-resistant microbial infection. In some embodiments of the composition described herein, the composition is used to treat a Clostridioides difficile infection. In some embodiments of the composition described herein, the composition is used to treat an antibiotic-associated diarrhea. In some embodiments of the composition described herein, the composition is used to treat a nosocomial infection, in accordance with details described throughout the present disclosure. These aspects can be implemented in accordance with details described throughout the present disclosure.

[0122] In some embodiments of the composition described herein, the composition further includes a vehicle. As used herein, a “vehicle”, “delivery vehicle”, “carrier”, or “pharmaceutically acceptable carrier” is a chemical, composition, or formulation that facilitates the transport of a pharmaceutically active substance to its target location in a patient’s body, primarily through increasing the stability and / or controlling the release of the pharmaceutically active substance. In some embodiments, a vehicle includes one or more substantially chemically inert and substantially non-toxic chemical species or group of chemical species that are used in conjunction with one or more pharmaceutically active substances to create a formulation. It should be noted that the delivery vehicle described herein can include any type of delivery vehicle or delivery system deemed suitable or applicable by a person of ordinary skill in the art, upon reviewing the entirety of this disclosure. Nonlimiting examples of such delivery vehicles can include without limitation solutions, micelles, liposomes, nanoparticles, hydrogels, or a combination thereof, among others.

[0123] In some embodiments, the vehicle described herein maintains a suitable condition for the microbial strain(s) described herein. As used herein, a “suitable condition” is an environmental condition or factor suitable for the growth and / or replication of a cell. In some cases, a suitable condition can vary from one type of cell to another. A suitable condition can include without limitation a suitable temperature / temperature range, a suitable pressure / pressure range, a suitable pHAttorney Docket No. 0073605-001128 or pH range, a suitable ionic strength / range of ionic strength, a suitable osmotic pressure or osmolarity / range of osmotic pressure or osmolarity, a suitable concentration / concentration range of one or more nutrients, a suitable level of metabolic waste / metabolites, among others. Nonlimiting examples of such vehicles include Brain Heart Infusion (BHI) or Brain Heart Infusion Supplemented (BHIS). A person of ordinary skill in the art, upon reviewing the entirety of the present disclosure, will be able to identify suitable conditions specific to one or more microbial strains described herein.

[0124] Nonlimiting examples of pharmaceutically acceptable carriers and formulations of pharmaceutical compositions include without limitation those described in Remington: The Science and Practice of Pharmacy, 21st ed., Lippincott, Williams & Wilkins, Philadelphia, PA., 2006; and Allen, L. V. et al., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, 8th ed., Lippincott, Williams & Wilkins, Philadelphia, PA., 2005.

[0125] In some embodiments, the composition described herein can include or be implemented as a pharmaceutical composition. Such pharmaceutical composition can be prepared in various forms, including without limitation physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Nonlimiting examples of suitable aqueous and nonaqueous carriers include water, ethanol, polyols such as propylene glycol, polyethylene glycol, glycerol, and the like, suitable mixtures thereof; vegetable oils such as olive oil; and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example and without limitation, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and / or by the use of surfactants, such as sodium lauryl sulfate, among others. Additional components can include without limitation a buffer, a solvent, or a diluent, among others.

[0126] In some embodiments, the composition described herein can include one or more adjuvants such as one or more preserving, wetting, emulsifying, suspending, sweetening, flavoring, perfuming, and / or dispensing agents.

[0127] In some embodiments, the composition described herein can include one or more isotonic agents, such as without limitation, one or more sugars, sodium chloride, and / or the like.

[0128] In some embodiments, prolonged delivery of an injectable pharmaceutical form can be achieved by the use of one or more agents that delay absorption, such as without limitation aluminum monostearate or gelatin.

[0129] In some embodiments, the composition described herein can be formulated using a solid dosage form. Nonlimiting examples of suitable solid dosage forms for oral administration canAttorney Docket No. 0073605-001128 include capsules, tablets, pills, powders, and granules. In such solid dosage forms, a therapeutic composition can be admixed with at least one inert customary excipient, such as sodium citrate or dicalcium phosphate. Additionally, and / or alternatively, a therapeutic composition can be admixed with (a) one or more fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) one or more binders, such as without limitation carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, or acacia; (c) one or more humectants, such as without limitation glycerol; (d) one or more disintegrating agents, such as without limitation agar-agar, calcium carbonate, plant starches such as potato or tapioca starch, alginic acid, certain complex silicates, or sodium carbonate; (e) one or more solution retarders, such as without limitation paraffin; (f) one or more absorption accelerators, such as without limitation quaternary ammonium compounds, (g) one or more wetting agents, such as without limitation cetyl alcohol, glycerol monostearate, or glycols; (h) one or more adsorbents, such as without limitation kaolin or bentonite; or (i) one or more lubricants, such as without limitation talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and / or pills, the dosage forms can also include a buffering agent. Solid compositions can also be employed as fillers in soft- or hard-filled gelatin capsules using one or more excipients such as lactose, milk sugar, high-molecular weight polyethylene glycols, and / or the like.

[0130] In some embodiments, solid dosage forms such as tablets, dragees, capsules, pills, and / or granules can be prepared with coatings and shells, such as enteric coatings and others as recognized by a person of ordinary skill in the art, upon reviewing the entirety of this disclosure. Such solid dosage forms can contain one or more opacifying agents and / or can also be of such composition that they release the active compound or compounds in a certain part of the gastrointestinal tract in a delayed manner. Nonlimiting examples of embedding compositions include polymeric substances and waxes. The active compounds can also be in a micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0131] In some embodiments, the composition described herein can be formulated using a liquid dosage form. Nonlimiting examples of liquid dosage forms for oral administration can include a pharmaceutically acceptable carrier formulated as an emulsion, solution, suspension, syrup, or elixir, among others. In addition to the active compounds, the liquid dosage forms can contain one or more inert diluents as recognized by a person of ordinary skill in the art, upon reviewing the entirety of this disclosure, such as without limitation water or other solvents, solubilizing agents, andAttorney Docket No. 0073605-001128 emulsifiers. Nonlimiting examples of such inert diluents include ethanol / ethyl alcohol, isopropanol / isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, dimethylformamide, oils including cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, and sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethyleneglycols, fatty acid esters of sorbitan, one or more mixtures of these substances, and / or the like.

[0132] In some embodiments, the composition described herein can be formulated using a suspension. A suspension can contain suspending agents, such as without limitation, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitol esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar or tragacanth, one or more mixtures of these substances, and / or the like.

[0133] In some embodiments, the composition described herein can be formulated using a liposomal formulation. Nonlimiting examples of liposomal formulations can include one or more types of neutral, cationic lipid , and / or anionic lipid, such that the liposomal formulations have a net neutral surface charge at physiological pH. In some embodiments, a PEG-modified lipid can be included. Liposomes can be generated using methods such as without limitation solvent / hydration methods, ethanol or ether injection methods, freeze / thaw methods, sonication methods, reversephase evaporation methods, and / or surfactant methods, among others. Liposomes and methods relating to their preparation and use can be found in Liposomes: A Practical Approach (The Practical Approach Series, 264), V. P. Torchilin and V. Weissig (Eds.), Oxford University Press; 2nd ed., 2003; N. Duzgunes, Liposomes, Part A, Volume 367 (Methods in Enzymology), Academic Press; 1st ed., 2003; L. V. Allen, Jr. et al., Ansel’s Pharmaceutical Dosage Forms and Drug Delivery Systems, 8th ed., Philadelphia, PA.: Lippincott, Williams & Wilkins, 2005, pp. 663-666; and A. R. Gernnaro, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, 21st ed., 2005, pp. 766-767.Synthetic Microbiota and Synthetic Microbiota Transplant

[0134] Another objective of the present disclosure is to provide a synthetic microbiota including the composition described herein. As used herein, a “synthetic microbiota” is a lab-created community of microbes or microorganisms, often bacteria, that has been intentionally designed, manipulated, and assembled to mimic or improve upon natural microbial communities.

[0135] Another objective of the present disclosure is to provide a synthetic microbiota transplant including the composition or the synthetic microbiota described herein. As used herein, aAttorney Docket No. 0073605-001128 “synthetic microbiota transplant” is a synthetic microbiota that is administered inside a subject or patient to perform certain designated therapeutic function(s). This aspect can be implemented in accordance with details described throughout the present disclosure.

[0136] In some embodiments of the synthetic microbiota transplant, the synthetic microbiota transplant is, or is used as, a synthetic fecal microbiota transplant, that treats a microbial infection in the gastrointestinal tract and / or restores gut health by mimicking or improving the function of a healthy microbiome. This aspect can be implemented in accordance with details described throughout the present disclosure.

[0137] Another objective of the present disclosure is to demonstrate the use of the composition, synthetic microbiota, or synthetic microbiota transplant described herein in the manufacture of a medicament for treating a microbial infection. This aspect can be implemented in accordance with details described throughout the present disclosure.

[0138] Another objective of the present disclosure is to demonstrate the use of the composition, synthetic microbiota, or synthetic microbiota transplant described herein in combination with a human fecal transplant (e.g., obtained from a healthy donor) in the manufacture of a medicament for treating a microbial infection. This aspect can be implemented in accordance with details described throughout the present disclosure.Medical Kit

[0139] Another aspect of the present disclosure is a medical kit for treating a microbial infection. The kit includes the composition, synthetic microbiota, or synthetic microbiota transplant described herein and at least an instruction for the use thereof. As used herein, a “medical kit” is a set of usually prepackaged reagents, devices, etc., that allows a subject or medical professional to easily test for, screen, diagnose, monitor, alleviate the symptoms of, and / or treat a certain health condition. The medical kit described herein can be implemented using any means deemed suitable or applicable by a person of ordinary skill in the art, in view of the entirety of the present disclosure.EXAMPLE: A Designed Synthetic Microbiota Provides Insight to Community Function in Clostridioides Difficile ResistanceSummary

[0140] C lostridioides difficile (C. difficile'), a major cause of antibiotic-associated diarrhea, is suppressed by the gut microbiome, but the precise mechanisms are not fully described. Through meta-analysis of 12 human studies, we designed a synthetic fecal microbiota transplant (sFMTl) byAttorney Docket No. 0073605-001128 reconstructing microbial networks negatively associated with C. difficile colonization. This lab-built 37-strain consortium formed a functional community suppressing C. difficile in vitro and in animal models. Using sFMTl as a tractable model system, we find that bile acid 7a-dehydroxylation is not a determinant of sFMTl efficacy, while one strain performing Stickland fermentation, a pathway of competitive nutrient utilization, can be both necessary and sufficient for the suppression of C. difficile replicating the efficacy of a human fecal transplant in a gnotobiotic mouse model. Our data illustrate the significance of nutrient competition in suppression of C. difficile and a generalizable approach to interrogating complex community function through robust methods to leverage publicly available sequencing data.Introduction

[0141] C 'lostridioides difficile infection (CDI) is among the most common nosocomial infections resulting in -500,000 annual infections and associated healthcare costs in excess of 1.5 billion dollars in the USA alone1,2. C. difficile s capacity to form disinfection-resistant spores further complicates treatment as the environment may be a significant source of exposure3,4. C. difficile is in many ways an enigmatic member of the human gut microbiome which can be found across many mammals and is commonly found in human infants5. Despite its long association with humans, the widespread use of broad-spectrum antibiotics, especially third-generation cephalosporins6,7, has resulted in C. difficile being a leading cause of antibiotic-associated diarrhea. C. difficile is normally suppressed by antagonistic relationships with members of the healthy gut microbiota which are depleted during antibiotic treatment8,9. Traditional antimicrobial therapy for C. difficile further disrupts the gut microbiome creating a feedback loop resulting in high rates of recurrent infection (rCDI, 2O-3O%)10. Recent breakthroughs in narrow-spectrum antibiotics have led to improved efficacy11,12; however, the use of fecal microbiota transplant (FMT), the administration of fecal material from a healthy human donor, has been demonstrated to be highly effective in preventing rCDI13,14. Despite being highly efficacious, FMT comes with safety concerns including the accidental transmission of multidrug-resistant pathogens15, transmission of unexpected metabolic phenotypes16, and a lack of a stable composition / formulation. The reliance on human donors whose microbiomes are constantly shifting17, and for whom microbiome likely represents an optimal state for their own genetics and lifestyle, results in variable engraftment that is difficult to predict a priori18. Given the expansion of FMT therapy to indications such as obesity and neurological conditions19,20, more reproducible approaches to microbiome supplementation are required with defined mechanisms of action.Attorney Docket No. 0073605-001128

[0142] Live biotherapeutic products, i.e., multi-strain consortia and fecal-derivatives, represent a promising category for alternatives to FMT21; however, conventional probiotic strains and formulations have demonstrated limited efficacy22, and recent breakthroughs often rely on human fecal material23,24. The creation of more complex consortia leveraging antagonistic ecological interactions to suppress C. difficile is a promising alternative25 26; however, a major knowledge gap exists in the field as to how to design and construct synthetic consortia. While we have evidence of certain functions correlated with C. difficile resistance, such as the formation of secondary bile acid metabolites by bai operon-encoding Clostridia including Clostridium sei ride ns2 2' much remains to be learned about the mechanisms through which a complex community antagonizes C. difficile and how these mechanisms could be leveraged clinically.

[0143] In this example, we report a computationally guided approach to rationally design synthetic consortia without relying on prior mechanistic knowledge. By leveraging the principles of meta-analysis to uncover robust microbial predictors of C. difficile resistance, we find that microbiome composition is a determinant of C. difficile colonization. Through machine learning analysis, we designed a synthetic FMT (sFMTl) which we show is able to suppress C. difficile virulence in vitro and in animal models. Using sFMTl as a platform for mechanistic investigation, we uncover that secondary bile acid metabolism is dispensable for sFMTl function, while strains that compete for proline (Stickland fermentation) can be both necessary and sufficient for function with a single-strain capable of offering protection equivalent to a human fecal transplant.Importantly, this approach is generalizable and may be employed to study the function of complex microbial communities across a range of host-microbiome interactions.Results

[0144] Meta-analysis allows the design of synthetic communities. An inclusive search term was used to retrieve human studies of individuals with confirmed C. difficile carriage by clinical diagnostic methods combined with microbiome sequencing data. A total of 268 publications and 90 Sequence Read Archive (SRA) datasets were obtained (FIG. 1 A). After manual review, 90 relevant studies were selected; however, it was determined that 52 were missing traceable deposited sequencing data while 26 lacked appropriate metadata to link deposited sequencing data to participant / C. difficile carriage. Data collection resulted in 12 studies including a total of 899 samples (FIG. IB, Table 1).

[0145] Raw data were obtained and processed through a unified pipeline with 74 samples subsequently excluded lacking adequate depth for further analysis. As a validation of our approach,Attorney Docket No. 0073605-001128 we examined the relative abundance of C. difficile, as quantified from sequencing data, finding significantly higher levels in all but 4 of the studies which is likely a function of the rigorous DNA extraction methods and sequencing depth required for C. difficile detection (FIG. 1C)30. Microbial (alpha) diversity was found to be reduced across individual data sets and in aggregate (FIGS. 1D-F). To understand if this loss was associated with conserved sets of microbes, we performed a beta diversity analysis on both individual studies and the combined dataset (FIGS. 1G-H). C. difficile colonization was associated with a reproducibility-altered microbiome composition in all but one study employing a robust strategy involving 5 different distance metrics. Across datasets, we found that C. difficile colonization explained 4.4% of variation (P < 0.001) in the pooled dataset (PERMANOVA of Unweighted UniFrac Distances) which was replicated with all tested metrics (FIG. 1G, FIG. 7A), an effect size equivalent to diet interventions31, while the variation associated with inter-study differences, a combination of biological and technical variation, was 10.8% (P < 0.001, FIG. 1H).

[0146] To determine which microbial features could most robustly predict C. difficile colonization status as a binary outcome, we turned to random forest classifiers32. We used an iterative validation strategy wherein each iteration excluded one study to act as an external validation set, and the remaining dataset was split into % training and % test sets. While we found model performance varied by data normalization strategy (including those based on phylogenetic signals)33, the exclusion of C. difficile in the training dataset did not reduce performance in external study validation sets, which is likely owing to the ensemble nature of random forests (FIGS. 7B-C). Our final models excluding C. difficile as a predictor were capable of achieving an area under the receiver operator curve of 0.81 ± 0.2 (mean ± sd) on external studies, which indicates a strong ability to differentiate C. difficile-colonized individuals on the basis of microbiome composition alone (FIG. II).

[0147] To better understand the microbial features that drove the predictions, we examined their importance as measured through the mean decrease in the GINI coefficient (FIG. 7D)34. We found that -200 features marked an inflection point in variable importance wherein little more predictive power could be obtained. Analysis of the abundance and taxonomic distribution of these features revealed that the majority were negative predictors of C. difficile colonization (Negative = 131, Npositive = 69, Table 2, FIG. 7E). These features covered a broad taxonomic range and included organisms with previously described interactions with C. difficile including negative correlations with Faecalibacterium prausnitzii, Bacteroid.es viilgatus, Bacteroides ovatiis, and Blautia obeun35~Attorney Docket No. 0073605-001128 '7, and positive correlations with Enterococcus spp.38, and lactobacilli commonly described as probiotics22(Table 2). The positive association with lactobacilli may underlie the reported lack of efficacy for conventional probiotics39, but may also be driven by intended therapeutic use or their intrinsic resistance to vancomycin rather than a synergistic relationship with C. difficile40. This later point further demonstrates the necessity of experimental validation to establish cause and effect between these altered microbiome compositions and resistance to C. difficile infection. Noticeably, C. scindens, a model organism for C. difficile antagonism, was not an effective predictor, and organisms known to carry the complete bai operon were found in only 20 samples at low abundances (C. scindens, C. hylemonae, Peptacetobacter [Clostridium] hiranonis). Finally, we conducted a proportionality analysis41finding that not only were microbes anti -correlated with C. difficile, but they themselves formed co-correlated networks suggesting that disruption of these networks may allow incursion of C. difficile (FIG. 1J).

[0148] Synthetic communities form stable functional communities in vitro and in vivo. To construct our synthetic communities, we started by comparing predictive features (Table 2) against the full-length 16S rRNA sequences of our genome-sequenced strain collection. Where possible, strains were selected where there was a >97% identity alignment, prioritizing the best alignment for species with multiple strains present in our collection. Where a 97% match failed, the threshold was relaxed to 95% and / or a taxonomy-guided approach was used to find a functional representative. Where more than one predictive 16S rRNA gene variant mapped to the same species, multiple representative strains were included, resulting in 4 species with multi -strain coverage (determined based on 94% whole genome average nucleotide identity): B. ovatus, B. uniformis, B. vulgatus, and B. xylanisolvens . Strains were then separated into two communities: sFMTl (strains negatively correlated with C. difficile)' and proCD (those positively correlated) which consist of 37 and 25 strains respectively covering a broad taxonomic range (Table 3). Many of the features mapped to the same sets of strains, which indicates functional redundancy among closely related operational taxonomic units (OTUs) and results in a final representation of 49.6% and 59.4% of sequence features having a genus-level match for sFMTl and proCD, respectively. Leveraging the additive nature of synthetic communities, we created a variant of sFMTl with the inclusion of C. scindens (sFMTl + Cs) to study both the biological significance of secondary bile acid metabolism in C. difficile exclusion, and the impact it would have on community composition and function (FIG. 2A).

[0149] To understand how these strains may form a stable functional community, we began with batch culture experiments with daily passages over the course of 4 days (~20 generations / day,Attorney Docket No. 0073605-001128 FIG. 2A). While a significant proportion of diversity was lost in the serial culture of a human fecal sample (hFMT), the synthetic communities exhibited greater stability, potentially owing to the culturability of its individual members (FIG. 2B). After an initial loss in observed diversity, individual strain abundances stabilized with E. coli becoming the most abundant strain and C. scindens being found at levels approaching the detection limit (FIGS. 2C-D, FIG. 8A). While C. scindens could be detected after 4 days, it had little effect on the relative composition of the remainder of the community in vitro with most strains having virtually identical abundances between sFMTl and sFMTl + Cs (FIG. 2D).

[0150] Given that in iv / r -rich media does not mimic the natural environment of these microbes, we opted to study the composition and function of the synthetic communities in a gnotobiotic animal model (FIG. 2E). Using qPCR to track fecal bacterial levels, we found that robust colonization occurred within 1 day for all communities with a slight lag observed contrasting sFMTl to sFMT 1 + Cs and human fecal transplant (hFMT) (FIG. 2F). While the total colonization level was established within 1 day, we found that the observable diversity continued to rise in all communities to 7 days post-colonization (FIG. 2G). This observation illustrates an important limitation of sequencing-based approaches in which the microbial community is not exhaustively sampled.Similarly, a significant proportion of input diversity is lost irrespective of whether the community was human-derived (hFMT) or synthetic (sFMTl and sFMTl + Cs; FIG. 2H). Tracking the abundance of amplicon sequence variants illustrated significant temporal variation in strain abundances over time (FIG. 21). Notably, an early influx of the facultative anaerobe E. coli was succeeded by more oxygen-tolerant organisms including the Bacteroides spp., followed by more oxygen-sensitive and fastidious organisms including the Clostridia and E. lenta (FIG. 21, FIG. 8A). These observations support a model wherein early colonizers deplete residual luminal oxygen, creating a permissive environment for other microbes, as is believed to occur during colonization of infants42,43. Further validating the need for host-associated models, a comparison of strain abundances between in vitro and in vivo revealed significant variation in the relative abundances of most members of the synthetic communities including lower levels of E. coli in vivo and higher levels of Clostridia including L. longoviformis, E. asparagiformis, and C. spiroforme (FIG. 2J).

[0151] Given the inclusion of multiple strains for 4 species, our amplicon-based analyses were unable to resolve all community members. To more specifically quantify strain level abundances, we utilized metagenomic sequencing and an updated version of our previously published methodology for strain-level tracking in synthetic communities called StrainR244. All strains could be accuratelyAttorney Docket No. 0073605-001128 quantified and resolved in input communities (FIG. 8B) and strain-level quantification gave a high degree of correspondence to amplicon-based data (FIG. 8C). Presence / absence detection of microbes via sequencing is fraught with false positives due to a variety of features including barcode switching, and sequencing errors resulting in erroneous mapping of strain-specific reads45 44. To help address these problems, we leveraged a statistical framework for strain detection (YACHT49). These analyses had high concordance with our quantitative approach (FIG. 8D), but failed to provide support for colonization of all strains as has been previously reported in large complex communities that do not account for these features of sequencing data50. Unlike in vitro data (FIG. 2D), the inclusion of C. scindens was found to have a more pronounced effect on the abundance of other strains within the community. Notably, its inclusion resulted in the additional colonization of A. halii, E. rectale and F. prausnitzii (FIG. 8D), with quantitative evidence additionally suggesting variable engraftment of B. producta and D. longicatena (FIG. 8C). The only strain which benefited from its absence was B. longum (log2(fold change) > 1, FDR corrected Welch’s t test < 0.1, FIG. 8C). Taken together, these observations suggest that the inclusion of one microbe can have a significant effect on community assembly. Evaluating intraspecies (infraspecific) competition, dominant strains were observed within B. vulgatus, B. xylanisolvens, and B. unifarmis, with the dominant strain present at an order of magnitude level over the subdominant strain(s) (FIG. 2K). Notably, the subdominant strain was not completely excluded (FIGS. 8C-D). These models provide a tool to evaluate intraspecies competition and discover mechanisms of colonization and competition

[0152] Synthetic communities mimic the metabolism of complex communities in vivo. We next sought to understand how sFMT mimics the metabolism of a human-derived fecal transplant (hFMT). Analysis of short-chain fatty acids (SCFAs) revealed extensive production by sFMTl compared to germ-free (GF) controls (FIG. 3A). Interestingly, while the hFMT produced higher levels of butyrate, sFMT produced higher levels of acetate and propionate. Indeed, the total level of SCFAs produced was significantly higher for sFMTl compared to hFMT. The comparison of a range of potential microbial metabolites demonstrated broad effects of microbial colonization with most metabolites impacted by hFMT also impacted by sFMTl (FIG. 3B).

[0153] Similarly, we examined the effects of microbial colonization on the bile acid pool including analysis of samples from sFMTl + Cs given C. scindens ’ known capacity for 7 a-dehydroxylation to form deoxycholic acid (DCA) and lithocholic acid (LCA)27,29. C. scindens ’ ability to perform 7a-dehydroxylation was supported by its sole possession of the complete baiAttorney Docket No. 0073605-001128 operon (FIG. 9A). Using a targeted method for quantification of 53 bile acids, we observed that all colonization groups lead to increased total levels of bile acids, a phenomenon occurring through a feedback mechanism involving the host signaling factor FGF15 (FIG. 3C)51,52. Demonstrating the biological activity of bile salt hydrolase positive strains, we observed increased deconjugation of bile acids in colonization groups, albeit with lower deconjugation levels observed in synthetic communities compared to hFMT (FIG. 3D). Similarly, we observed increased formation of microbial bile acid metabolites (2° bile acids), in all colonization states, with significantly lower levels in sFMTl and sFMTl + Cs, which did not differ in their total level of 2° metabolites (FIG. 3E). Using dimensional reduction and univariate analyses, we visualized the differences across the bile acid pool finding that the hFMT composition was distant from sFMTl and sFMTl + Cs (FIG.3F, FIG. 9B). Notably, only 5 bile acids were significantly different between sFMTl and sFMTl + Cs: the increased production of the expected LCA and DC A, but also 3,7,12-trioxocholic acid and its tauro-conjugated form, while there were lower levels of glycine-conjugated cholic acid (GCA) (FIG.9C). Collectively, these data demonstrate that synthetic communities can replicate key metabolic features of complex microbial ecosystems, such as those observed with a human fecal transplant, underscoring the potential of synthetic communities to emulate the metabolic complexity of native gut microbiota, while also revealing areas of divergence that could inform their optimization for therapeutic applications.

[0154] sFMTl protects against C. difficile infection without bai. In order to test the functions of these communities against C. difficile, each community was co-cultured with C. difficile and passed daily. After 4 days of culturing, C. difficile growth inhibition was quantified by qPCR. Both sFMTl and sFMTl + Cs were able to reduce C. difficile growth significantly while proCD had no significant reduction compared to the media-only control (FIG. 4A). We next sought to examine function in vivo using a gnotobiotic mouse model given their sensitivity to enteric infection, and to allow for precise implantation of microbes without confounding effects due to interactions with endogenous microbes (FIG. 4B). Mice were colonized 7 days before infection to allow for stabilization of the input community (FIGS. 2F-I) before challenging with C. difficile spores. While each microbial community limited the severity of infection (FIG. 4C), we found considerable variation between communities in the extent of disease activity (FIGS. 4D-G). Notably, mice colonized with hFMT did not display infection-associated weight loss, had lower carriage of C. difficile, and lower fecal toxin B during early infection (FIGS. 4D-G). Alternatively, proCD exhibited the worst outcomes in terms of weight loss, total C. difficile carriage, and toxin levels. proCD communities had higher carriage ofAttorney Docket No. 0073605-001128 C. difficile at 1 and 4 days post -infection compared to germ-free controls (FIG. 10A). Both sFMTl and sFMTl + Cs elicited significantly less weight loss, C. difficile carriage, and toxin abundance compared to proCD. Transient differences were noted between the protective effects of sFMTl and sFMTl + Cs within the first 2 days of infection; however, these effects were not maintained, nor were they replicated in additional experiments contrasting these two communities (FIGS. 4D-G, FIGS. 10B-F). Of note, all communities including hFMT did not completely suppress colonization by C. difficile, and it was stably implanted in all animals by 5 days post-infection, suggesting the protective effects are mediated by delayed colonization and suppression of virulence rather than complete exclusion in this model (FIG. 10A).

[0155] We separately confirmed the efficacy of sFMTl in an antibiotic-induced recurrent model of C. difficile infection53. Modeling the clinical context of C. difficile infection relapse, conventional mice were sensitized to infection via cefoperazone treatment followed by infection and initial treatment with vancomycin (FIG. 4H). Mice then received two treatments with either sFMTl or an autologous fecal transplant (mFMT) and were followed up for recurrence of infection. We found that sFMT delayed relapse (FIG. 41) and decreased severity compared to vehicle (FIG. 4J). Interestingly, the mouse-derived fecal microbiota transplant (mFMT) resulted in more severe disease than sFMTl and vehicle control (FIG. 4IJ). We replicated this finding in a gnotobiotic model demonstrating that human-derived microbiotas are more protective than those from our mouse colony, even when the fecal transplant was derived from a humanized gnotobiotic mouse (FIG. 10G). This result further demonstrates that not all fecal transplants may be expected to be equivalent in function54.Interestingly, we find high levels of Enterococcus spp. in mice house in our conventional facility, whose association with C. difficile (Table 2) is mechanistically linked to worse infection outcomes38.

[0156] Strains that perform Stickland fermentation can be both necessary and sufficient for sFMTl function. We used a data-driven approach to identify pathways through which sFMTl may function to suppress C. difficile. Following the rationale that sFMTl, by the nature of its metaanalysis driven design, would be enriched in functions detrimental to C. difficile, we began by examining metabolites enriched in sFMTl compared to hFMT and germ -free colonized mice.Examination of our metabolomics data revealed only a limited number of metabolites that were enriched in sFMTl -colonized mice compared to hFMT, of which the most striking was 5-aminovalerate (5-AVA, FIG. 3B, FIG. 11 A). This metabolite is the product of reductive Stickland fermentation of proline, a catabolic amino acid utilization typical of Cluster XI Clostridia, and is suggested to be of importance for C. difficile growth and virulence55-56. Indeed we measured aAttorney Docket No. 0073605-001128 concomitant reduction in proline (FIG. 3B, FIG. 11 A). We identified strains with homologs of enzymes involved in the Stickland fermentation of proline and glycine leading to the creation of a functional knockout of Stickland fermentation comprising 29 strains (sFMTl ASticklandl; FIG. 1 IB, Table 3). Using an in vitro assay, we confirmed that proline and glycine were not significantly reduced by sFMTl ASticklandl and that 5-AVA was no longer produced (FIG. 11C). To establish if the removal of Stickland+strains (including C. scindens) resulted in loss of sFMTl function, we contrasted sFMTl + Cs against sFMTl ASticklandl (FIG. 11D). We found that sFMTl ASticklandl had a limited effect against C. difficile in terms of survival and weight loss, with only minimal impact noted on suppression of toxin expression (FIGS. 11E-H). We replicated the experiment with the inclusion of an additional community of only presumptive Stickland fermenters to determine if they were sufficient to suppress C. difficile infection (N = 8 strains, sSticklandl; FIG. Ill, Table 3). Validating our predictions in vivo, fecal 5-AVA was only detected in significant quantities from sFMTl and sSticklandl colonized mice, but not those with sFMTl ASticklandl (FIG. 11 J). A concomitant reduction in free proline, but not glycine was observed, suggesting that proline may be the important substrate for competition with C. difficile. The removal of Stickland fermenting strains (sFMTl ASticklandl) resulted in a loss of protective function in terms of survival, weight loss, total C. difficile burden, and toxin production (FIG. 11K-N). The community of only predicted Stickland fermenters (sSticklandl) provided protection equivalent to or exceeding sFMTl suggesting they are likely both necessary and sufficient acting as the functional core of sFMTl (FIGS. 11K-N).

[0157] We next sought to understand whether the protective effects of Stickland fermenters were mediated by competition for proline or the biological activity of the resulting 5-AVA. To this end, we approximated the biologically relevant fecal concentrations of 5-AVA in vitro to determine 5-AVA’ s impact on C. difficile growth, toxin production, and promotion or inhibition of spore germination, finding no significant effects (FIGS. 11P-Q). Taken together these results suggest that the mechanism of C. difficile suppression is not dependent on the biological function of 5-AVA but rather is dependent on the competition for free proline and / or other amino acids.

[0158] Closer analysis of in vivo metabolites resulting from the removal and complementation of predicted Stickland fermenters demonstrated differences in other potentially meaningful metabolites including the short-chain fatty acids acetate and butyrate (FIG. 1 10)57 61. This observation, combined with a trend of enhanced protection offered by sSticklandl over sFMTl (FIGS. 11L-N), led us to further refine our synthetic communities. To accomplish this step, we measured each sSticklandl member’s capacity for proline consumption and concomitant 5-AVAAttorney Docket No. 0073605-001128 production. We observed that in vitro, two strains were prolific in their Stickland fermentation of proline (FIG. 11R). As such, we reformulated the communities to generate a 2-strain proline fermenting community (sStickland2), and a corresponding 35-strain variant of sFMTl lacking these strains (sFMTl AStickland2, Table 3, FIG. 5A). sStickland2 was still capable of consuming proline and producing 5-AVA in vivo; however, no production of short-chain fatty acids was observed (FIG.5B, FIG. 1 IS). After C. difficile infection, we found that the removal of the two sStickland2 strains completely abolished the protective capacity of sFMTl, resulting in infection severities equivalent to germ-free animals. These results suggest that sFMTAStickland2 is even less effective than proCD (FIGS. 5D-F, FIG. 4D). On the other hand, sStickland2 colonized mice do not show any infection-associated weight loss and have suppressed colonization and toxin levels that mimick the effects of human fecal transplant (hFMT, FIG. 4D). We developed qPCR assays to selectively quantify the sStickland2 members, discovering that the P. anaerobius strain completely dominates sStickland2-colonized mice. These results suggest that sStickland2 is a de facto monocolonization of a single high-activity Stickland fermenting strain (FIG. 5G). Examining the abundances of the sequencing features representing the two sStickland2 strains in the human meta-analysis data revealed that their potential protective activity does not come from differential abundance, but rather differential presence, with both species found at an order of magnitude higher prevalence in C. difficile -negative compared to C. / z / zcz / c-positive individuals.

[0159] sFMT function is driven by competition for proline. Having reduced the complexity of sFMTl to a single P. anaerobius strain, we first demonstrated that it alone could be both necessary and sufficient for sFMTl function (FIG. 6A). Proline and glycine were largely liberated as a result of colonization with hFMT or sFMTl without P. anaerobius (sFMTl APa), whereas proline was only depleted by the single-strain administration of P. anaerobius and fermented to 5-AVA (FIG. 6B, FIG. 12A). While both proline and glycine are substrates for reductive Stickland fermentation, glycine’s abundance was not altered by sStickland 1 (FIG. 11 J), sStickland2 (FIG. 5B), or a singlestrain administration with P. anaerobius (FIG. 6B), demonstrating proline as the more plausible target for nutrient competition. We found that anaerobius, colonized at 8.8e7 ± 3.8e7 genome copies / g feces (mean ± sd, FIG. 12B), could be both necessary and sufficient for protection against C. difficile, as measured through diarrheal-associated weight loss (FIG. 6C), fecal C. difficile burden (FIG. 6D), and fecal toxin B (FIG. 6E). Notably, the protection afforded by a single-strain administration of P. anaerobius met or exceeded that of the healthy human donor transplant (hFMT) in all measured parameters (FIGS. 6C-E).Attorney Docket No. 0073605-001128

[0160] We also sought to examine other potential mechanisms of protection by P. anaerobius. non 7a-dehydroxylation bile acid metabolism62, immunomodulation of the host63, and production of antimicrobial peptides64. We found no evidence of microbial bile acid metabolism in mice colonized with sStickland2, which excludes microbial bile acid metabolism as a possible mechanism (FIG. 12C). To examine if P. anaerobius elicited an immune response altering the inflammatory tone of the animal, we leveraged a Luminex panel to analyze cytokines in the colon. Compared to germ-free mice, P. anaerobius resulted in a mild decrease in the abundance of IL- 10 and IL-6 suggesting an anti-inflammatory phenotype; however, no other markers were altered in concentration including markers of type 2 and 3 immunity such as IL-33 and IL-17A as have been indicated as important in responses to C. difficile63(FIG. 12D). Examination of inflammatory markers 7-days post infection revealed significant decreases in major inflammatory markers IL-10, IL-6 and TNF-a consistent with decreased infection activity (FIG. 6F, FIG. 12E). Taken together, these results suggest that, while P. anaerobius is not immunologically inert, it alone does not stimulate pathways which may potentiate responses against C. difficile. We further investigated if the inhibition is dependent on any metabolites or bacteriocins generated by P. anaerobius. Through deferred and simultaneous inhibition assays (FIGS. 12F-G), we found no evidence for direct inhibition of C. difficile by P. anaerobius, further reinforcing nutritional competition as the major mechanism of inhibition.

[0161] We profiled the culture supernatants of P. anaerobius finding the significant utilization of proline, threonine, tryptophan, tyrosine, phenylalanine, leucine, and methionine (FIG. 12H). C. difficile displays significantly impaired growth in P. anaerobius supernatants, but this impaired growth could be recovered by adding fresh media. This observation provides further evidence that inhibition does not result from formation of inhibitory metabolites (FIG. 6G). Growth could not be recovered through addition of glucose, trace minerals, or vitamins; however, addition of proline could partially restore growth. Addition of one or more previously mentioned depleted amino acids including proline and / or a peptide-rich peptone could also partially restore growth with no significant difference compared to addition of proline alone. We sought to demonstrate more generally that competition for proline led to inhibition of C. difficile. To this end, we over-expressed the E. coli proline utilization gene putA in E. coli, which led to significantly increased proline utilization (FIGS. 12I-J). Compared to vector control, expression of putA resulted in a 1- to 2-order-of-magnitude reduction in the abundance of C. difficile in vitro (FIG. 6H). Taken together, these results highlight proline competition as a critical mechanism underlying microbial inhibition of C. difficile.Attorney Docket No. 0073605-001128 Discussion

[0162] Our data-driven development of sFMTl and subsequent identification of Sticklandfermenting strains as key contributors to C. difficile infection resistance establishes a generalizable framework for unraveling the mechanisms of action within complex microbial communities.Through meta-analysis and machine learning, a prior understanding of potential mechanisms of action is not required, and as illustrated by our studies involving C. scindens, may help prevent observation bias from masking the discovery of novel interactions. C. scindens, and the bai operon responsible for the formation of C. <7z^zcz7c-inhibitory DCA and LCA have been suggested to be one of the major determinants of microbiota resistance to C. difficile infection for over a decade27,29,65’66. However, many of these findings are derived from in vitro and reductionist experimental approaches rather than studying bad clostridia in complex communities. C. scindens and other bai operon encoding microbes are low-abundance and low-prevalence organism s67 70. Indeed, recent estimates suggest C. scindens to be present in only 0.02-2.514%71,72of healthy individuals in westernized populations, which is in line with estimates from the healthy cohorts in our meta-analysis. While a high prevalence of the bai operon is often reported in metagenomic studies using mapping-based approaches73’74, it remains to be seen if these are truly / -speci lie mappings, or if they are identifying homologs found in highly prevalent organisms such as E. lenta5. These observations, combined with our computational and experimental results, warrant a critical re-evaluation of microbial pathways of bile acid metabolism and the significance of the bai operon in resistance to C. difficile infection.

[0163] Among the most striking metabolic features of sFMTl was the Stickland fermentation of proline into 5-AVA. Proline, obtained from dietary, host and microbial sources, is the main substrate for Stickland fermentation in C. difficile6. The significance of amino acid fermentation as an important metabolic pathway for C. difficile in vivo has been established, but the impact of Stickland fermentation as a pathway of competitive nutrient utilization is only beginning to be realized76,77. Our observation of the necessity of proline fermentation, and the dispensable function of bile acid metabolism has recently been corroborated using in vitro bioreactors seeded from human fecal samples78. The discovery of highly prevalent Stickland fermenting strains (D. longicatena and P. anaerobius) as robust predictors of C. difficile colonization and experimental demonstration that they can be both necessary and sufficient for sFMTl function provides compelling evidence that this metabolic pathway is a key mechanism through which healthy gut microbes suppress C. difficile. Our observation that a single-strain administration of P. anaerobius is as efficacious in preventingAttorney Docket No. 0073605-001128 CDI as a human fecal transplant provides a paradigm shift in how we may think about C. difficile-therapeutics: rather than requiring complex human-derived products or communities, we may select a very limited number of strains with defined metabolic functions. This paradigm shift would be highly beneficial both in terms of limiting potential off-target side effects of FMT and in terms of improving the production efficiency and regulatory compliance of consortia-based therapeutics79,80. Further, as illustrated by the complete loss of protection by removal of proline fermenters and the intermediate protective phenotype observed in the full sFMT community, the proteolytic activity of additional strains in the community may in fact work against the functional unit of the community. This observation further underscores the need to define the functional core of complex synthetic communities for translational applications. While the potential clinical utility of P. anaerobius may be limited by its previous description as an opportunistic pathogen, D. longicatena and other taxa may be explored as potential therapeutics. Building on this finding, our use of a genetically engineered strain overexpressing an alternative proline consumption pathway confirmed that proline limitation is a key mechanism underlying the inhibition of C. difficile outgrowth. This insight paves the way for developing biotherapeutics based on engineered microbes designed to outcompete C. difficile for proline.

[0164] Commensal microbes play an essential role in many aspects of human health and physiology including protection against infectious diseases leading to the microbiome’s description as a hidden organ81 8. However, unlike other organ systems, the gut microbiome exhibits a high degree of plasticity, which provides opportunities for restructuring its composition and function. FMT represents perhaps one of the most extreme and effective microbiota-targeted therapies; however, FMT’s greatest strength is also its greatest weakness: complexity. Hidden within fecal communities may be functional cores of beneficial organisms; however, as we show here, not every microbe common in the healthy human gut may be beneficial, and some may be detrimental. Fecal microbiota transplants address urgent unmet clinical needs as is the case with recurrent C. difficile infection; however, moving from poorly characterized mixtures to precise formulations with defined mechanisms of action offers a pathway to improved safety, reproducibility, and efficacy for microbiome-targeted therapies.

[0165] One potential limitation of the present approach includes that reliance on marker genes masks strain variation, which can be an important driver of microbial function84. Future efforts must take full advantage of the increasing availability of metagenomic data to design synthetic consortia not just based on taxonomy, but on gene content and metabolic similarity. Furthermore, theAttorney Docket No. 0073605-001128 possibility remains that the inhibitory function of P. anaerobius is not driven entirely by competition for proline, but may involve competition for other nutrients or inhibitory byproducts which were not observed. Attempts to generate proline fermentation deficient mutants of P. anaerobius were unsuccessful due to a lack of genetic tools for this clade, and heterologous expression of P. anaerobius Stickland fermentation pathway in E. coli could not be completed due to construct toxicity. Conclusive evidence may require isogenic mutants of P. anaerobius, however, genetic tools are not available for this species, and knockout of its Stickland fermentation pathways may result in severe growth defects given that this organism relies on amino acid fermentation for growth85. This limitation highlights the need for expanded genetic tools for the diversity of microbes found in the human gut. Finally, our use of gnotobiotic mice provides an optimal platform on which to study precise community compositions; however, the clinical context of C. difficile infection also involves recovering endogenous microbial communities which may interact with any implanted microbes leading to altered outcomes, particularly as it relates to polymicrobial metabolic pathways like bile acid metabolism.Star Methods

[0166] Experimental Model and Subject Details

[0167] Study inclusion and data processing. 286 clinical studies were yielded with the search term ("difficile") AND (microbiome OR microbiota OR microflora) AND (human OR trials OR clinical OR study) AND (16S OR metagenom* OR amplicon OR metatranscript*) NOT (Review[Publication Type]) AND ("2010 / 01 / 01 "[Date - Publication] : "2021 / 01 / 01 "[Date -Publication]). The results were first downselected by requiring longitudinal or cross-sectional study design related to C. difficile or CDI involving microbiome sequencing with clinical diagnostic testing, and were included in the final dataset if both the study metadata and sequencing data is publicly available. For studies that included multiple time points, baseline and end points data were included. C. difficile colonization status was considered to be positive if the result was positive in toxin detection for toxin A, B or binary toxin, by real-time PCR, or by culture result (Table 1).

[0168] Sequencing data were downloaded using the SRA (Sequence Read Archive) accession numbers using fasterq-dump. Where only multiplexed data were available, they were demultiplexed using split library fastq (QIIME 1.9.1). Reads of all samples were denoised with the following parameters using deblur denoise 16S package on QIIME2: left-trim-len 20, min-reads 1, min-size 1, and trim-length of 80% of total read length. Pyrosequencing samples were denoised using dada2 denoise-pyro with truncation length to be 80% of the total read length. OTU were quantified basedAttorney Docket No. 0073605-001128 on the SILVA 128 database clustered at 97% identity of both strands using vsearch with closed reference strategy. Both ASV features and OTU features were then fdtered to only include reads greater than 1000 and seen twice for each feature.

[0169] For both per study analysis and combined analysis on alpha diversity, samples were rarefied at the lowest sample depth using subsample table (qiime2R package version 0.99.6) and used as the input to calculate alpha diversity. Shannon diversity was calculated using Vegan (version 2.5-7), Faith’s phylogenetic diversity was calculated using the Picante package (version 1.8.2). Bray Curtis distance, unweighted unifrac distance, weighted unifrac distance, and Jensen Shannon Divergence distance were calculated using the Phyloseq package with the subsampled OTU abundance and the reference SILVA tree. CLR Euclidean distance was calculated by performing a centered log ratio transformation using make clr (qiime2R), then the Euclidean distance was calculated using dist function (R version 4.1.0). The PhILR Euclidean distance was calculated by transforming to phylogenetic isometric log ratio33followed by Euclidean distance calculation as before. Beta diversity was then analyzed with principal coordinates with Ape (version 5.6-2).ADONIS / Permanova tests of each beta diversity metrics was calculated using the vegan: :adonis2 with 999 permutations.

[0170] Classifier training and feature selection. Cross-study validation of Random Forests was performed (randomForest version 4.7-1). To determine which data type would yield the highest prediction accuracy, CLR, PhILR, and OTU data summarized were used as input data types for the prediction. One study was randomly chosen to be the external validation study and the remaining samples were combined into one dataset and % of the data were used as the training set and the remaining % was used as the test set. A version without features corresponding to the last common ancestor of named C. difficile features (ape::mrca) was also performed in the same way. To determine the maximum number of predictors to be included, MeanDecreaseGINI was used to balance in minimizing the error rate and maximizing prediction strength. The 200 most important predictors were for networking based on a proportionality analysis using propr41.

[0171] Microbial culture and sFMT preparation. Predictors selected by their Mean Decrease in Gini coefficient were aligned with the 16S rRNA database for our lab collection using BLAST (version 2.12.0) to identify the matching features (Table 3). Strains were then streaked onto BHI CHV (37 g / L Brain Heart Infusion, 15 g / L Agar, 0.05% w / v Cysteine, 5 pg / mL Hemin, 1 pg / mL menadione) with or without the addition of a 10 g / L arginine (BHI CHAV). Strains were routinely verified by sequencing of the full length 16S rRNA gene using 8F / 1543R primers (SEQ ID NOs: 13-Attorney Docket No. 0073605-001128 14) and Sanger Sequencing (Azenta Life Sciences). Verified strains were cultured in liquid variants of the same media without agar at 37 °C anaerobically (H25%, N275%, CO220%, Coy Anaerobic Systems). For each strain, cells were pelleted by centrifugation and washed with fresh BHI CHV containing 15% glycerol prior to pooling at the equivalent optical density. The pooled communities were stored at -80C freezer prior to the administration to mice.

[0172] Gnotobiotic studies. Mixed sex C57BL / 6J mice aged 8-17 weeks originally derived from the National Gnotobiotics Resource center were housed individually with ad libitum water and food (Lab Diet 5021) under a 12-hour light / dark cycle. All animals were maintained inside germ-free isolators (Class Biologically Clean) in the animal facility at Pennsylvania State University.Human / mice FMTs were prepared by suspending 200 mg of fecal sample in 2 ml of transplant media (BHI CHV with 15% glycerol), removing solids by allowing to settle for 5 minutes, and stored frozen prior to usage. Human fecal material was collected under an approved study protocol (PSU IRB STUDY00018171). Communities (~le9 CFU) or vehicle control were administered to mice by oral gavage. Mice were challenged with C. difficile 630 spores (103) by oral gavage. Weights were recorded, and fecal samples were collected daily for another additional week followed by euthanasia.20% weight loss or a body conditioning score less than or equal to 2 were used as humane endpoints. All gnotobiotic and conventional animal studies were performed under an approved study protocol (PSUIACUC PROTO202101826).

[0173] Conventional mouse studies. Mixed sex C57BL / 6J mice at 8 weeks old were purchased from JAX. After acclimation in the facility for a week, mice were housed individually and were given cefoperazone (0.5 mg / mL) for 5 days ad libitum in water to render susceptibility to C. difficile infection. Animals were switched back to regular drinking water for two days and challenged with 103CFU C. difficile 630 spores suspended in PBS. All animals were treated with vancomycin (0.4 mg / mL) in the drinking water starting from 4 days after infection for 5 days. Two days after washout, one dose of treatment per day (sFMTs, pro-CD, mFMT) or vehicle control were gavaged into each mouse for two days. Animals were monitored daily for disease activity with weights recorded and feces collected daily for an additional 10 days before euthanasia.

[0174] C. difficile Spore Preparation. C. difficile 630 was cultured on BHIS (BHI + 5 g / L yeast extract + 0.05% w / v cysteine) agar and incubated at 37 °C for one week. After one week, 1.5 mL phosphate buffered saline (PBS) was used to collect C. difficile growth with a cell scraper and transferred to 8.5 mL of PBS. After centrifugation at 6,000 x g for 5 minutes, the supernatant was removed and the pellet was resuspended in ImL of IX PBS. The suspension was then centrifuged atAttorney Docket No. 0073605-001128 16,100g for 2 minutes and the pellet was resuspended in ImL PBS with a total of 4 washes. After the last wash, the suspension was heated at 60 °C for 20 minutes to kill remaining vegetative cells and was washed 5 more times with IX PBS. The final spore suspension was quantified by plating on TCCFA (taurocholate, cycloserine, cefoxitin, fructose agar) and stored aerobically at -20 °C. Spore stocks were routinely quantified to monitor titer.

[0175] Methods Details

[0176] Amplicon sequencing. Microbial DNA was isolated using the ZymoBIOMICS 96 MagBead DNA kit (D4308). ~50 mg of frozen fecal samples were weighed and transferred into empty lysing tubes containing mixed size zirconia beads (0.01-0.1mm). 750 pL of ZymoBIOMICS lysis solution was added and the slurry was disrupted for a total of 5 minutes on FastPrep96 then centrifuged at 10,000 x g for 5 minutes. The DNA was then extracted following the manufacturer’s instructions.

[0177] Amplicon sequencing was performed by amplifying the V4 region of the 16S rRNA gene as previously described86. Briefly, the V4 region was amplified using the 515F (GTGYCAGCMGCCGCGGTAA, see SEQ ID NO: 11) and 806R (GGACTACNVGGGTWTCTAAT, see SEQ ID NO: 12) primers with partial overhangs for i7 and i5 adapters. Amplification was performed using KAPA HiFi hot start enzymes and SYBR green to monitor amplification progress and multiple lOx dilutions were amplified to select a late-exponential phase amplicon for indexing. Samples were diluted and indexed using dual 12 nt indexes before quantification with PicoGreen (Life Technologies) and pooling at equal molar concentrations. The final library underwent gel purification before sequencing on an Illumina MiSeq using V3 600 cycle reagents run as 270x12x12x270. For plotting purposes, ASVs were matched to sFMTs members by performing pairwise alignment to their respective 16S rDNA sequence derived from the genome allowing for up to 1 mismatch in a pairwise global-local alignment (Biostrings).

[0178] Metagenomic sequencing. Samples selected for metagenomic sequencing were extracted using the International Human Microbiome Consortium Protocol Q87. Briefly, samples underwent multiple rounds of bead disruption before isopropanol precipitation and cleanup using the Qiagen Stool DNA kit. Libraries were prepared using the Illumina Library Preparation kit and sequenced on a NovaSeq 6000 (Novogene USA).

[0179] StrainR2. To allow for multiple estimates of genome abundance, and to minimize the skew due to high-copy number strain-specific elements (i.e., plasmids), reference genomes (STAR Resource table) were split into subcontigs less than theN50 of all reference genomes. SubcontigsAttorney Docket No. 0073605-001128 have a 500bp overlap with the previous and next subcontigs to ensure all reads that belong to a genome will also map to a subcontig. Reads were filtered and trimmed using fastp with the parameters: trim_poly_g, length_required = 50, n_base_limit = 0. Filtered reads are then uniquely mapped to subcontigs using BBMap with the following parameters: perfectmode = t, local = f, ambiguous = toss, pairedonly = t. To normalize abundance data, the frequency of unique mappings for each subcontig is normalized by the number of unique k-mers. Due to large k-mers slowing computation, canonical kmers are hashed using sourmash and compared across subcontigs to derive a number of unique k-mer hashes per subcontig. The subcontig abundance is determined as fragments per thousand unique kmers per million reads mapped (FUKM). The abundance of a strain was determined as the median FUKM (mFUKM) of all subcontigs belonging to a genome (excluding subcontigs smaller than lOkbp).

[0180] YACHT. We employed a bioinformatic statistical approach called YACHT49to quantify the presence or absence of each reference strain in the samples. In short, YACHT is a method that utilizes long k-mers (fixed length strings of sequenced DNA of length k) to answer the question: does a sample contain enough k-mers found exclusively in a given reference genome to support the claim than an organism, with ANI (Average Nucleotide Identity) at least A to this reference genome, is contained in the sample with sequencing coverage at least c? We ran YACHT with the parameters A = 0.992 since no two reference strains had an ANI above this value (i.e., strains can be resolved via k-mers at this threshold), c = 0.01 (to ensure that any low abundance organisms would still be captured), and k-mer size k = 31. Results did not significantly change when we varied the ANI parameter from 0.992 to 0.999 and the coverage from 0.1 to 0.001, which indicates that sequencing error and variability did not appear to affect the YACHT results.

[0181] C. difficile quantification. C. difficile was quantified by qPCR using the tcdB gene as a target. Bacterial DNA was extracted with ZymoBIOMICS 96 MagBead DNA kit (D4308) as described above. The assay was TcdB forward primer:TACAAACAGGTGTATTTAGTACAGAAGATGGA (SEQ ID NO: 1), TcdB reverse primer: CACCTATTTGATTTAGMCCTTTAAAAGC (SEQ ID NO: 2), and TcdB probe:[6FAM]TTTKCCAGTAAAATCAATTGCTTC[BHQ1] (SEQ ID NO: 3), each present at 200 nM. They were amplified using iTaq™ Universal Probes Supermix (Biorad 1725132) with the following cycling parameters: 95 °C for 5 minutes, and 40 cycles of 5 seconds at 95 °C and 15 seconds at 56.6 °C. Absolutely quantification was performed using a standard curve of pure C. difficile 630 gDNA and normalization to the extracted sample mass.Attorney Docket No. 0073605-001128

[0182] Quantification of sStickland2 members. The abundance of JEB00029 and JEB00254 were quantified by qPCR targeting genes unique to each genome. Primer specificity was determined both in silico against the remaining sFMTl strains and experimentally using pure cultures. Bacterial DNA was extracted with ZymoBIOMICS 96 MagBead DNA kit (D4308) as described above. The assay was JEB00029 forward primer: TCATGGCCGTGTACTTGCTT (SEQ ID NO. 7), JEB00029 reverse primer: AGCGGATATCTGCCAGGTTG (SEQ ID NO: 8), and JEB00254 forward primer: ACAGGCTTTGGCATTGGAGA (SEQ ID NO: 9), JEB00254 reverse primer TGTGGTTAATGGCCTTGCAT (SEQ ID NO: 10), each present at 200 nM. They were amplified using iTaq™ Universal SYBR Green Supermix (Biorad 1725122) with the following cycling parameters: 95 °C for 5 minutes, and 40 cycles of 5 seconds at 95 °C and 15 seconds at 56.6 °C. Absolute quantification was performed using a standard curve of pure JEB00029 or JEB00254 gDNA and normalization to the extracted sample mass.

[0183] Toxin B Quantification. Toxin B production was quantified using Clostridium difficile Toxin A or B ELISA Kit (Antibodies Online ABIN1098189). Fecal samples were suspended in 100 pL of the dilution buffer and then diluted 10 or 20 times in dilution buffer prior to transferring to the assay wells to ensure the samples fall within the range of the standard curve. Toxin B was then quantified following the manufacturer’s instructions.

[0184] 5-AVA - C. difficile interaction assays. For vegetative cell growth inhibition assay, C. difficile 630 was inoculated at 1% v / v into 10 mM 5-AVA (approximated from in vivo NMR quantification) or vehicle fresh BHIS media in a 96-well format. Growth was measured every 15 minutes at 600 nm for 16h. Toxin B was quantified in the resulting supernatants using the ELISA method above. For the sporulation assay, le6 spores were incubated with either 5-AVA (10 mM), 5-AVA (10 mM)+TCA (0.1%), TCA (0.1%), CDCA (0.1%), TCA (0.1%) + CDCA(0.1%), or media control (BHIS) for 30 minutes and serially diluted and plated on both BHIS and BHIS+TCA plates to quantify spore germination. Germination rate was calculated as CFU (BH1S) / CFU (BHIS+TCA).

[0185] In vitro community stability assay. 100 pL of each synthetic communities were cultured in 5mL of reduced BHI CHV (37 g / L Brain Heart Infusion, 15 g / L Agar, 0.05% w / v Cysteine, 5 pg / mL Hemin, 1 pg / mL menadione) and incubated at 37 °C for 24 hours and passaged daily through BHI CHV for 4 days at the same volume ratio (100 pL of culture into 5mL of fresh media). Cultures were vortexed prior to each passage. Cells were pelleted by centrifugation and the DNA was extracted as described above.Attorney Docket No. 0073605-001128

[0186] Bile acid quantification and analysis. Bile acids were extracted and quantified using the protocol by Tian et al88. In short, approximately 50 mg of fecal samples were weighed and were homogenized with ImL of ice-cold methanol containing 0.5 pM deuterated internal standards using bead disruption. After three additional freeze-thaw cycles in liquid nitrogen, samples were centrifuged at 14,000 * g for 15 minutes at 4C. 200 pL of supernatant were transferred to a polypropylene vial and bile acids were profiled and quantified with UHPLC-MS / MS.

[0187] Extracted bile acids were analyzed using Waters Acquity UPLC coupled to Waters Xevo TQ-S. The metabolites were chromatographically separated with Waters Acquity UPLC BEH C8 1.7 pm, 2.1 x 100 mm column. 9% LC-MS grade acetonitrile in LC-MS grade water with 1 mM ammonium acetate and adjusted to pH 4.15 with acetic acid (A) and 50:50 v / v LC-MS grade isopropanol :LC-MS grade acetonitrile (B) were used as mobile phases for 15-min gradient: 0-0.1 min, 10% B, 0.3 mL / min; 0.1-9.25 min, 10-35% B, 0.3 mL / min; 9.25-11.5 min, 35-85% B, 0.3-0.325 mL / min; 11.5-11.8 min, 85-100% B, 0.325-0.4 mL / min; 11.8-12 min, 100% B, 0.4-0.475 mL / min; 12-12.1 min, 100% B, 0.475-0.5 mL / min; 12.1-12.4 min, 100% B, 0.5 mL / min; 12.4-12.45 min, 100-55% B, 0.5-0.425 mL / min; 12.45-12.5 min, 55-10% B, 0.425-4 mL / min; 12.5-12.6 min, 10% B, 0.425-0.4 mL / min; 12.6-12.7 min, 10% B, 0.4-0.35 mL / min; 12.7-12.8 min, 10% B, 0.35-0.3 mL / min; 12.8-15 min, 10% B, 0.3 mL / min. Mass spectrometry parameters were as follows: electrospray ionization, negative ion mode, capillary voltage of 1.5 kV, cone voltage of 60 V, source temperature of 150 °C, desolvation temperature of 600 °C, desolvation gas flow of 1000 L / h, and cone gas flow of 150 L / h. Collected data were analyzed using TargetLynx 4.1 software (Waters). Sample concentrations were calculated from the calibration curve for each bile acid. Bile acids which were not detected were excluded from downstream analysis.

[0188] 'H NMR-Based Metabolomics. The samples and spectra processing were performed as previously described89. Briefly, approximately 50 mg of fecal samples were weighed and extracted with 1.2 mL of 0.1 M phosphate buffer (K2HPO4 / NaH2PO4 = 4 / 1, pH = 7.4, 50% D2O) containing 0.005% (w / v) of sodium 3- (trimethyl silyl) propionate-2,2,3,3-d4 (TSP) as internal standard.Samples were vortexed, homogenized, subjected to two freeze-thaw cycles. After centrifuging at 17000 x g for 10 min at 4 °C, 550pL of clear supernatant was transferred to a 5 mm NMR tube for NMR analysis.

[0189] All1H experiments were performed at 298 K by using a Bruker Avance NEO 600 MHz NMR spectrometer (operating at 600.15 MHz forXH, Bruker Biospin, Germany) equipped with a 5 mm TCI cryoprobe and a SampleJet sample changer. The noesygpprld pulse sequence (size of fidAttorney Docket No. 0073605-001128 65534, 20 ppm spectral width, 64 scans, 4 dummy scans, relaxation delay 5 s, acquisition time 2.75 s) was used for recording IDexperiments with the 90° pulses with mixing time (100 ms). All spectra were analyzed via Chenomx NMR Suite (version 10). After automatic processing, the phase, baseline, and internal standard were checked and modified manually for quality assurance. The metabolites were identified, fitted, and quantified using built-in metabolite reference library and known internal standard concentration (TSP, 0.29 mM).

[0190] Genomic Analysis. Predicted amino acid sequences belonging to each strain were searched using KOfamscan to functionally annotate genes using hidden Markov models for genes involved in bile acid metabolism (ko000121) and Stickland fermentation of proline and glycine (EC:1.21.4.1 and EC:1.12.4.2). Results were filtered on the basis of threshold scores and E values for inclusion into figures. Separately, BLASTP was used to query annotated components of the glycine and proline reductase complex from Uniprot on the basis of the basis of the above Enzyme Commission numbers with cut offs of E-value < le-5, bitscore > 50, %identity > 30. Average nucleotide identity between genomes was determined using PyANI while phylogenetic trees were generated using PhyloPhlAn3.

[0191] Cytokine expression estimation. Colons were collected and snap-frozen in liquid nitrogen during euthanasia, then moved to -80 °C for long-term storage until use. Colon protein samples were extracted into 100 mg / mL with cell lysing buffer (ThermoFisher: FNN0021) with the addition of protease inhibitor (ThermoFisher: 1860932) and phosphatase inhibitor (ThermoFisher: 78428). The protein concentrations were quantified via BCA assay (ThermoScientific: A55864). The cytokines were estimated using MSD U-PLEX customized multiplex assay kits (MSD C0065-2; C00723-2; C0074-2; C0092-2) regarding the assay protocol. In brief, the linker and capture antibody were linked in reaction tubes for 1 hour, then incubated on the plate for another 1 hour. The samples and standards were added without additional dilution for 1 hour at room temperature with shaking, then incubated overnight at 4 °C. On the second day, detection antibodies were added and incubated with shaking for 1 hour before reading the plates. The cytokine concentrations were calculated based on the standard curve of each cytokine. The percent of recovery for each standard was calculated for quality control. Calculated concentrations were normalized with sample protein concentration and resulted in pg / mg colon protein.

[0192] Deferred antagonism assay. Overnight cultures of assay strains (C. difficile, P. anaerobius. and L. reuteri)' were made and were inoculated on BHIS and MRS plates in a straight line. After incubated in 37 °C for 24 hours in the anaerobic chamber, colonies were scraped off andAttorney Docket No. 0073605-001128 plates were exposed to chloroform vapor by inverting over a filter paper soaked with chloroform for 30 minutes in biosafety hood. Plates were further aerated and deoxygenate for another 24 hrs to remove chloroform vapor residue, followed by cross-streaking with self and other strains. After incubating in 37 °C for 24 hrs anaerobically, inhibitory activities were indicated by visible zone of inhibition at the cross-streak region.

[0193] Simultaneous inhibition / disk diffusion assay. Overnight cultures of assay strains (C. difficile and P. anaerobius) were diluted to ODeoo of 0.1 and were inoculated onto BHIS plates using sterile cotton swab to ensure complete cover of the agar surface. Once the agar surfaced is dried, sterile disks (diameter = 6 mm) were placed on top of the agar and were soaked with lOpL of P. anaerobius (ODeoo = 0.1) culture or cell-free supernatant, BHIS, or 40 pg of vancomycin, followed by incubation at 37 °C for 24 hrs anaerobically. Zone of inhibition was measured the next day.

[0194] Supernatant supplementation assay. Overnight culture of P. anaerobius was filtered through 0.2pm filters to obtain cell-free supernatant, and was supplemented with individual, or combinations of, the following nutrients: ATCC Vitamin Supplement (1.0%), ATCC Trace Mineral Supplement (1.0%), amino acids including proline (1.0 mM), threonine (1.0 mM), leucine (2.0 mM), phenyalanine (1.0 mM), tyrosine (0.5 mM), and glycine (3.0 mM), and Gibco Bacto protease peptone #2 (40 g / L). Overnight culture of C. difficile was inoculated at 0.5% rate to the supplemented media, and the growth of C. difficile was measured every 15 minutes at 600 nm for 24h.

[0195] Cloning of WT E. coli W3110. The vector control pCA24N was extracted from the original putA -expressing strain in the ASKA collection using the Zymo Zyppy Plasmid Mini-prep kit. The isolated plasmid was digested with Sfil and Stul to remove the putA insert. After screening and verification by sequencing, the empty vector was used in the subsequent transformation of wildtype E. coli W3110 strain using electroporation (treated at 2.5 kV with 25 mF and 200-ohms).Overnight cultures of E. coli and C. difficile (thiamphenicol resistance carrying guide-less pJK02 vector) culture was added to growth media (LB or BHICHV) containing 10 pg / mL thiamphenicol and 61.25 pM IPTG at 0.5% inoculation rate and incubated at 37 °C. Cultures were passed by transferring 1 pL of culture to 200 pL fresh media every 24 h for 4 days. End point cultures were plated on TCCFA media to selectively quantify C. difficile.Quantification and Statistical Analysis

[0196] Unless otherwise specified, statistical analysis was carried out in R version v4.3.1 using appropriate base functions and Tidyverse v2.0.0. Individual data points have been shown whereAttorney Docket No. 0073605-001128 possible and are otherwise represented as the mean ± standard error unless otherwise stated.Boxplots represent the median and interquartile range. Significance was determined as P < 0.05 unless otherwise stated. Survival analysis was performed using Survival v 3.5-7.Data and Code Availability

[0197] All datasets analyzed in this study are available from public sources as identified in Table 1 and the STAR Key resources table. Genomes of sFMT members are publicly available as identified in the Key Resources Table (Table 5). Complete microbiome sequencing data have been deposited to the NCBI Sequence Read Archive with accession PRJNA1038784.Supporting TablesTable 1. Samples included in study, related to FIG. 1 and STAR Methods.&Attorney Docket No. 0073605-001128Table 1 (Continued). Samples included in study, related to FIG. 1 and STAR Methods.Table 2. Predictive features of C. difficile carriage, related to FIG. 1.Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Table 2 (Continued). Predictive features of C. difficile carriage, related to FIG. 1.Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Table 2 (Continued). Predictive features of C. difficile carriage, related to FIG. 1.Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Table 3. Synthetic community membership, related to FIG. 2.Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Table 4. Bile acids analyzed and classifications, related to STAR Methods.Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Table 5: Key resource table.Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128Attorney Docket No. 0073605-001128References

[0198] 1. Guh, A.Y., Mu, Y., Winston, L.G., Johnston, H., Olson, D., Farley, M.M., Wilson, L.E., Holzbauer, S.M., Phipps, E C., Dumyati, G.K., et al. (2020). Trends in U.S. Burden of Clostridioides difficde Infection and Outcomes. N Engl. J. Med. 382, 1320-1330.

[0199] 2. CDC (2022). Educational resources. Centers for Disease Control and Prevention.

[0200] 3. Clabots, C.R., Johnson, S., Olson, M.M., Peterson, L.R., and Gerding, D.N. (1992). Acquisition of Clostridium difficile by hospitalized patients: evidence for colonized new admissions as a source of infection. J. Infect. Dis. 166, 561-567.

[0201] 4. Hensgens, M.P.M., Keessen, E C., Squire, M.M., Riley, T V., Koene, M.G.J., de Boer, E., Lipman, L.J.A., Kuijper, E.J., and European Society of Clinical Microbiology and Infectious Diseases Study Group for Clostridium difficile (ESGCD) (2012). Clostridium difficile infection in the community: a zoonotic disease? Clin. Microbiol. Infect. 18, 635-645.

[0202] 5. Rousseau, C., Levenez, F., Fouqueray, C., Dore, J., Collignon, A., and Lepage, P. (2011). Clostridium difficile colonization in early infancy is accompanied by changes in intestinal microbiota composition. J. Clin. Microbiol. 49, 858-865.

[0203] 6. Knight, D.R., and Riley, T.V. (2019). Genomic Delineation of Zoonotic Origins of Clostridium difficile. Front. Public Health 7, 164.

[0204] 7. de Lalla, F., Privitera, G., Ortisi, G , Rizzardini, G., Santoro, D., Pagano, A., Rinaldi, E., and Scarpellini, P. (1989). Third generation cephalosporins as a risk factor for Clostridium difficile-associated disease: a four-year survey in a general hospital. J. Antimicrob. Chemother. 23, 623-631.Attorney Docket No. 0073605-001128

[0205] 8. Jenior, ML., Leslie, J.L., Young, V.B., and Schloss, P.D. (2017). Clostridium difficile Colonizes Alternative Nutrient Niches during Infection across Distinct Murine Gut Microbiomes. mSystems 2,10.1128 / msystems.00063-17.

[0206] 9. Mullish, B.H., and Allegretti, J.R. (2021). The contribution of bile acid metabolism to the pathogenesis of Clostridioides difficile infection. Therap. Adv. Gastroenterol. 14, 17562848211017725.

[0207] 10. Comely, O.A., Miller, M.A., Louie, T.J., Crook, D.W., and Gorbach, S.L. (2012). Treatment of first recurrence of Clostridium difficile infection: fidaxomicin versus vancomycin. Clin. Infect. Dis. 55 Suppl 2, S 154— SI 61.

[0208] 11. Louie, T.J., Miller, M.A., Mullane, K.M., Weiss, K., Lentnek, A., Golan, Y., Gorbach, S., Sears, P., Shue, Y.-K., and OPT-80-003 Clinical Study Group (2011). Fidaxomicin versus vancomycin for Clostridium difficile infection. N. Engl. J. Med. 364, 422-431.

[0209] 12. Comely, O.A., Crook, D.W., Esposito, R., Poirier, A., Somero, M.S., Weiss, K., Sears, P., Gorbach, S., and OPT-80-004 Clinical Study Group (2012). Fidaxomicin versus vancomycin for infection with Clostridium difficile in Europe, Canada, and the USA: a double-blind, non-inferiority, randomised controlled trial. Lancet Infect. Dis. 12, 281-289.

[0210] 13. Kelly, C.R., Khoruts, A., Staley, C., Sadowsky, M.J., Abd, M., Alani, M., Bakow, B., Cuman, P., McKenney, J., Tisch, A., et al. (2016). Effect of Fecal Microbiota Transplantation on Recurrence in Multiply Recurrent Clostridium difficile Infection: A Randomized Trial. Ann. Intern. Med. 165, 609-616.

[0211] 14. Baunwall, S.M.D., Lee, M.M., Eriksen, M.K., Mullish, B.H., Marchesi, J.R., Dahlerup, J.F., and Hvas, C.L. (2020). Faecal microbiota transplantation for recurrent Clostridioides difficile infection: An updated systematic review and meta-analysis. EClinicalMedicine 29-30, 100642.

[0212] 15. Gupta, S., Mullish, B.H., and Allegretti, J.R. (2021). Fecal Microbiota Transplantation: The Evolving Risk Landscape. Am. J. Gastroenterol. 116, 647-656.

[0213] 16. Alang, N., and Kelly, C.R. (2015). Weight gain after fecal microbiota transplantation. Open Forum Infect. Dis. 2, ofv004.

[0214] 17. Caporaso, J.G., Lauber, C.L., Costello, E.K., Berg-Lyons, D., Gonzalez, A., Stombaugh, J., Knights, D., Gajer, P., Ravel, J., Fierer, N., et al. (2011). Moving pictures of the human microbiome. Genome Biol. 12, R50.Attorney Docket No. 0073605-001128

[0215] 18. laniro, G , Puncochaf, M., Karcher, N., Porcari, S., Armanini, F., Asnicar, F., Beghini, F., Blanco-Mlguez, A., Cumbo, F., Manghi, P., et al. (2022). Variability of strain engraftment and predictability of microbiome composition after fecal microbiota transplantation across different diseases. Nat. Med. 28, 1913-1923.

[0216] 19. Matheson, J. -AT., and Holsinger, R.M.D. (2023). The Role of Fecal Microbiota Transplantation in the Treatment of Neurodegenerative Diseases: A Review. Int. J. Mol. Sei. 24.

[0217] 20. Napolitano, M., and Covasa, M. (2020). Microbiota Transplant in the Treatment of Obesity and Diabetes: Current and Future Perspectives. Front. Microbiol. 11, 590370.

[0218] 21. Oliveira, R.A., and Pamer, E G. (2023). Assembling symbiotic bacterial species into live therapeutic consortia that reconstitute microbiome functions. Cell Host Microbe 31, 472-484.

[0219] 22. Mills, J.P., Rao, K., and Young, V.B. (2018). Probiotics for prevention of Clostridium difficile infection. Curr. Opin. Gastroenterol. 34, 3-10.

[0220] 23. Feuerstadt, P., Louie, T.J., Lashner, B., Wang, E.E.L., Diao, L., Bryant, J. A., Sims, M., Kraft, C.S., Cohen, S.H., Berenson, C.S., et al. (2022). SER-109, an Oral Microbiome Therapy for Recurrent Clostridioides difficile Infection. N. Engl. J. Med. 386, 220-229.

[0221] 24. Khanna, S., Assi, M., Lee, C., Yoho, D., Louie, T., Knappie, W ., Aguilar, H., Garcia-Diaz, J., Wang, G.P., Berry, S.M., et al. (2022). Efficacy and safety of RBX2660 in PUNCH CD3, a phase III, randomized, double-blind, placebo-controlled trial with a Bayesian primary analysis for the prevention of recurrent Clostridioides difficile infection. Drugs 82, 1527-1538.

[0222] 25. Louie, T., Golan, Y., Khanna, S., Bobilev, D., Erpelding, N., Fratazzi, C., Carini, M., Menon, R., Ruisi, M., Norman, J.M., et al. (2023). VE3O3, a Defined Bacterial Consortium, for Prevention of Recurrent Clostridioides difficile Infection: A Randomized Clinical Trial. JAMA 329, 1356-1366.

[0223] 26. Petrof, E.O., Gloor, G.B., Vanner, S.J., Weese, S.J., Carter, D., Daigneault, M.C., Brown, E.M., Schroeter, K., and Allen-Vercoe, E. (2013). Stool substitute transplant therapy for the eradication of Clostridium difficile infection: “RePOOPulating” the gut. Microbiome 1, 3.

[0224] 27. Buffie, C.G., Bucci, V., Stein, R.R., McKenney, P.T., Ling, L., Goboume, A., No, D., Liu, H., Kinnebrew, M., Viale, A., et al. (2015). Precision microbiome reconstitution restores bile acid mediated resistance to Clostridium difficile. Nature 517, 205-208.

[0225] 28. Greathouse, K.L., Harris, C.C., andBultman, S.J. (2015). Dysfunctional families: Clostridium scindens and secondary bile acids inhibit the growth of Clostridium difficile. Cell Metab. 21, 9-10.Attorney Docket No. 0073605-001128

[0226] 29. Reed, A.D., Nethery, M.A., Stewart, A., Barrangou, R., and Theriot, C M. (2020). Strain-Dependent Inhibition of Clostridioides difficile by Commensal Clostridia Carrying the Bile Acid-Inducible (bai) Operon. J. Bacteriol. 202.

[0227] 30. Sim, J.H.C., Anikst, V., Lohith, A., Pourmand, N., and Banaei, N. (2015). Optimized Protocol for Simple Extraction of High-Quality Genomic DNA from Clostridium difficile for Whole-Genome Sequencing. J. Clin. Microbiol. 53, 2329-2331.

[0228] 31. Carmody, R.N., and Bisanz, J.E. (2023). Roles of the gut microbiome in weight management. Nat. Rev. Microbiol. 21, 535-550.

[0229] 32. Breiman, L. (2001). Random Forests. Mach. Learn. 45, 5-32.

[0230] 33. Silverman, J.D., Washburne, A.D., Mukherjee, S., and David, L.A. (2017). A phylogenetic transform enhances analysis of compositional microbiota data. Elife 6.

[0231] 34. Nembrini, S., Kbnig, I.R., and Wright, M.N. (2018). The revival of the Gini importance? Bioinformatics 34, 3711-3718.

[0232] 35. Roychowdhury, S., Cadnum, J., Glueck, B., Obrenovich, M., Donskey, C., and Cresci, G.A.M. (2018). Faecalibacterium prausnitzii and a Prebiotic Protect Intestinal Health in a Mouse Model of Antibiotic and Clostridium difficile Exposure. JPEN J. Parenter. Enteral Nutr. 42, 1156-1167.

[0233] 36. Bjorkqvist, O., Rangel, I., Serrander, L., Magnusson, C., Halfvarson, J., Noren, T., and Bergman-Jungestrom, M. (2021). Faecalibacterium prausnitzii increases following fecal microbiota transplantation in recurrent Clostridioides difficile infection. PLoS One 16, e0249861.

[0234] 37. Mullish, B.H., McDonald, J.A.K., Pechlivanis, A., Allegretti, J.R., Kao, D., Barker, G.F., Kapila, D., Petrof, E.O., Joyce, S.A., Gahan, C.G.M., et al. (2019). Microbial bile salt hydrolases mediate the efficacy of faecal microbiota transplant in the treatment of recurrent Clostridioides difficile infection. Gut 68, 1791-1800.

[0235] 38. Smith, A.B., Jenior, M.L., Keenan, O., Hart, J.L., Specker, J., Abbas, A., Rangel, P.C., Di, C., Green, J., Bustin, K.A., et al. (2022). Enterococci enhance Clostridioides difficile pathogenesis. Nature 611, 780-786.

[0236] 39. Ma, Y., Yang, J.Y., Peng, X., Xiao, K.Y., Xu, Q., and Wang, C. (2020). Which probiotic has the best effect on preventing Clostridium difficile -associated diarrhea? A systematic review and network meta-analysis. J. Dig. Dis. 21, 69-80.

[0237] 40. Goldstein, E.J.C., Tyrrell, K.L., and Citron, D.M. (2015). Lactobacillus species: taxonomic complexity and controversial susceptibilities. Clin. Infect. Dis. 60 Suppl 2, S98-S107.Attorney Docket No. 0073605-001128

[0238] 41. Quinn, T P., Richardson, M.F., Lovell, D., and Crowley, T.M. (2017). propr: An R-package for Identifying Proportionally Abundant Features Using Compositional Data Analysis. Sci. Rep. 7, 16252.

[0239] 42. Fouhy, F., Ross, R.P., Fitzgerald, G.F., Stanton, C., and Cotter, P.D. (2012).Composition of the early intestinal microbiota: knowledge, knowledge gaps and the use of high-throughput sequencing to address these gaps. Gut Microbes 3, 203-220.

[0240] 43. Stark, P.L., and Lee, A. (1982). The microbial ecology of the large bowel of breastfed and formula-fed infants during the first year of life. J. Med. Microbiol. 15, 189-203.

[0241] 44. Bisanz, J.E., Soto-Perez, P., Noecker, C., Aksenov, A. A., Lam, K.N., Kenney, G.E., Bess, E.N., Haiser, H.J., Kyaw, T.S., Yu, F.B., et al. (2020). A Genomic Toolkit for the Mechanistic Dissection of Intractable Human Gut Bacteria. Cell Host Microbe 27, 1001-1013. e9.

[0242] 45. lia, Y., Zhao, S., Guo, W., Peng, L., Zhao, F., Wang, L„ Fan, G., Zhu, Y., Xu, D., Liu, G., et al. (2022). Sequencing introduced false positive rare taxa lead to biased microbial community diversity, assembly, and interaction interpretation in amplicon studies. Environ Microbiome 17, 3.

[0243] 46. Costello, M., Fleharty, M., Abreu, J., Farjoun, Y., Ferriera, S., Holmes, L., Granger, B., Green, L., Howd, T., Mason, T., et al. (2018). Characterization and remediation of sample index swaps by non-redundant dual indexing on massively parallel sequencing platforms. BMC Genomics 19, 332.

[0244] 47. Zhou, J., Wu, L., Deng, Y„ Zhi, X , liang, Y.-H., Tu, Q., Xie, J., Van Nostrand, J.D., He, Z., and Yang, Y. (2011). Reproducibility and quantitation of amplicon sequencing-based detection. 1SME J. 5, 1303-1313.

[0245] 48. Kunin, V., Engelbrektson, A., Ochman, H., and Hugenholtz, P. (2010). Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates.Environ. Microbiol. 12, 118-123.

[0246] 49. Koslicki, D., White, S., Ma, C , and Novikov, A. (2024). YACHT: an ANI-based statistical test to detect microbial presence / absence in a metagenomic sample. Bioinformatics 40(2), btae047.

[0247] 50. Cheng, A.G., Ho, P.-Y., Aranda-Diaz, A., Jain, S., Yu, F.B., Meng, X., Wang, M., lakiviak, M., Nagashima, K., Zhao, A., et al. (2022). Design, construction, and in vivo augmentation of a complex gut microbiome. Cell 185, 3617-3636. el9.Attorney Docket No. 0073605-001128

[0248] 51. Monaghan, T., Mullish, B.H., Patterson, J., Wong, G.K., Marchesi, J.R., Xu, H., Jilani, T., and Kao, D. (2019). Effective fecal microbiota transplantation for recurrent Clostridioides difficile infection in humans is associated with increased signalling in the bile acid-farnesoid X receptor-fibroblast growth factor pathway. Gul Microbes JO, 142-148.

[0249] 52. Parks, D.J., Blanchard, S.G., Bledsoe, R.K., Chandra, G., Consler, T.G., Kliewer, S.A., Stimmel, J.B., Willson, T.M., Zavacki, A.M., Moore, D.D., et al. (1999). Bile acids: natural ligands for an orphan nuclear receptor. Science 284, 1365-1368.

[0250] 53. Seekatz, A.M., Theriot, C.M., Molloy, C.T., Wozniak, K.L., Bergin, I.L., and Young, V.B. (2015). Fecal Microbiota transplantation eliminates Clostridium difficile in a Murine model of relapsing disease. Infect. Immun. 83, 3838-3846.

[0251] 54. Quraishi, M.N., Widlak, M., Bhala, N., Moore, D., Price, M., Sharma, N., and Iqbal, T.H. (2017). Systematic review with meta-analysis: the efficacy of faecal microbiota transplantation for the treatment of recurrent and refractory Clostridium difficile infection. Aliment. Pharmacol. Ther. 46, 479-493.

[0252] 55. Bouillaut, L., Self, W.T., and Sonenshein, A.L. (2013). Proline-dependent regulation of Clostridium difficile Stickland metabolism. J. Bacteriol. 195, 844-854.

[0253] 56. Aguirre, A.M., Yalcinkaya, N., Wu, Q., Swennes, A., Tessier, M.E., Roberts, P., Miyajima, F., Savidge, T., and Sorg, J.A. (2021). Bile acid-independent protection against Clostridioides difficile infection. PLoS Pathog. 17, el010015.

[0254] 57. Pensinger, D.A, Dobrila, H A., Stevenson, D.M., Hyrckowian, N D , Amador- Nogeuz, D., and Hyrckowian, A. J. (2024). Exogenous butyrate inhibits butyrogenic metabolism and laters virulence phenotypes in Clostridioides difficile. mBio 15, e02535-23.

[0255] 58. Seekatz, A.M., Theriot, C.M., Rao, K., Chang, Y.-M., Freeman, A.E., Kao, J.Y., and Young, V.B. (2018). Restoration of short chain fatty acid and bile acid metabolism following fecal microbiota transplantation in patients with recurrent Clostridium difficile infection. Anaerobe 53, 64-73.

[0256] 59. Karlsson, S., Burman, L.G., and Akerlund, T. (2008). Induction of toxins in Clostridium difficile is associated with dramatic changes of its metabolism. Microbiology 154, 3430-3436.

[0257] 60. Bouillaut, L., Dubois, T., Sonenshein, A.L., and Dupuy, B. (2015). Integration of metabolism and virulence in Clostridium difficile. Res. Microbiol. 166, 375-383.Attorney Docket No. 0073605-001128

[0258] 61. Pensinger, D.A., Fisher, A.T., Dobrila, H.A., Van Treuren, W., Gardner, J.O., Higginbottom, S.K., Carter, M.M., Schumann, B., Bertozzi, C.R., Anikst, V., et al. (2023). Butyrate Differentiates Permissiveness to Clostridioides difficile Infection and Influences Growth of Diverse C. difficile Isolates. Infect. Immun. 91, e0057022.

[0259] 62. Foley, M.H., Walker, M.E., Stewart, A.K., O’Flaherty, S., Gentry, E.C., Patel, S., Beaty, V.V., Allen, G., Pan, M., Simpson, J.B., et al. (2023). Bile salt hydrolases shape the bile acid landscape and restrict Clostridioides difficile growth in the murine gut. Nat. Microbiol. 8, 611-628.

[0260] 63. Frisbee, A.L., Saleh, M.M., Young, M.K., Leslie, J.L., Simpson, M.E., Abhyankar, M.M., Cowardin, C.A., Ma, J.Z., Pramoonjago, P., Turner, S.D., et al. (2019). IL-33 drives group 2 innate lymphoid cell-mediated protection during Clostridium difficile infection. Nat. Commun. 10, 2712.

[0261] 64. Gebhart, D., Lok, S., Clare, S., Tomas, M., Stares, M., Scholl, D., Donskey, C.J., Lawley, T.D., and Govoni, G.R. (2015). A modified R-type bacteriocin specifically targeting Clostridium difficile prevents colonization of mice without affecting gut microbiota diversity. mBio 6.

[0262] 65. Kang, J.D., Myers, C.J., Harris, S C., Kakiyama, G., Lee, I.-K., Yun, B.-S., Matsuzaki, K., Furukawa, M., Min, H.-K., Bajaj, J.S., et al. (2019). Bile Acid 7a-Dehydroxylating Gut Bacteria Secrete Antibiotics that Inhibit Clostridium difficile '. Role of Secondary Bile Acids. Cell. Chem. Biol. 26, 27-34.e4.

[0263] 66. Studer, N., Desharnais, L , Beutler, M., Brugiroux, S., Terrazos, M.A., Menin, L., Schtirch, C M., McCoy, K.D., Kuehne, S.A., Minton, N.P., et al. (2016). Functional intestinal bile acid 7a-dehydroxylation by Clostridium scindens associated with protection from Clostridium difficile infection in a gnotobiotic mouse model. Front. Cell. Infect. Microbiol. 6.

[0264] 67. Ridlon, J.M., Ikegawa, S., Alves, J.M.P., Zhou, B., Kobayashi, A., lida, T., Mitamura, K., Tanabe, G., Serrano, M., De Guzman, A., et al. (2013). Clostridium scindens'. a human gut microbe with a high potential to convert glucocorticoids into androgens. J. Lipid Res. 54, 2437-2449.

[0265] 68. Wells, J.E., Berr, F., Thomas, L.A., Dowling, R.H., and Hylemon, P.B. (2000). Isolation and characterization of cholic acid 7a-dehydroxylating fecal bacteria from cholesterol gallstone patients. J. Hepatol. 32, 4-10.

[0266] 69. Ridlon, J.M., Kang, D.-J., and Hylemon, P.B. (2006). Bile salt biotransformations by human intestinal bacteria. J. Lipid Res. 47, 241-259.Attorney Docket No. 0073605-001128

[0267] 70. Kim, K.H., Park, D , Jia, B., Baek, J.H., Hahn, Y , and Jeon, C O. (2022).Identification and Characterization of Major Bile Acid 7a-Dehydroxylating Bacteria in the Human Gut. mSystems 7, e0045522.

[0268] 71. Chinda, D., Takada, T., Mikami, T., Shimizu, K., Oana, K., Arai, T., Akitaya, K., Sakuraba, H., Katto, M., Nagara, Y., et al. (2022). Spatial distribution of live gut microbiota and bile acid metabolism in various parts of human large intestine. Sci. Rep. 12, 3593.

[0269] 72. Nayfach, S., Fischbach, M.A., and Pollard, K.S. (2015). MetaQuery: a web server for rapid annotation and quantitative analysis of specific genes in the human gut microbiome.Bioinformatics 31, 3368-3370.

[0270] 73. Das, P., Marcisauskas, S., Ji, B., and Nielsen, J. (2019). Metagenomic analysis of bile salt biotransformation in the human gut microbiome. BMC Genomics 20, 517.

[0271] 74. Vital, M., Rud, T., Rath, S., Pieper, D.H., and Schluter, D. (2019). Diversity of Bacteria Exhibiting Bile Acid-inducible 7a-dehydroxylation Genes in the Human Gut. Comput. Struct. Biotechnol. J. 17, 1016-1019.

[0272] 75. Heinken, A., Ravcheev, D.A., Baldini, F., Heirendt, L., Fleming, R.M.T., and Thiele, I. (2019). Systematic assessment of secondary bile acid metabolism in gut microbes reveals distinct metabolic capabilities in inflammatory bowel disease. Microbiome 7, 75.

[0273] 76. Reed, A.D., Fletcher, J.R., Huang, Y.Y., Thanissery, R., Rivera, A. J., Parsons, R.J., Stewart, A.K., Kountz, D.J., Shen, A., Balskus, E.P., et al. (2022). The Stickland Reaction Precursor trans-4-Hydroxy-l-Proline Differentially Impacts the Metabolism of Clostridioides difficile and Commensal Clostridia. mSphere 7, e0092621.

[0274] 77. Girinathan, B.P., DiBenedetto, N., Worley, J.N., Peltier, J., Arrieta-Ortiz, M.L., Immanuel, S.R.C., Lavin, R., Delaney, M.L., Cummins, C.K., Hoffman, M., et al. (2021). In vivo commensal control of Clostridioides difficile virulence. Cell Host Microbe 29, 1693-1708. e7.

[0275] 78. Huang, X., Johnson, A.E., Brehm, J.N., Do, T.V.T., Auchtung, T.A., McCullough, H.C., Lerma, A.I., Haidacher, S.J., Hoch, K.M., Horvath, T.D., et al. (2025). Clostridioides difficile colonization is not mediated by bile salts and utilizes Stickland fermentation of proline in an in vitro model. mSphere, e0104924.

[0276] 79. Hempel, S., Newberry, S., Ruelaz, A., Wang, Z., Miles, J.N.V., Suttorp, M.J., Johnsen, B., Shanman, R., Slusser, W., Fu, N., et al. (2011). Safety of probiotics used to reduce risk and prevent or treat disease. Evid. Rep. Technol. Assess., 1-645.Attorney Docket No. 0073605-001128

[0277] 80. Rouanet, A., Bolca, S., Bru, A., Claes, I., Cvejic, H., Girgis, H., Harper, A., Lavergne, S.N., Mathys, S., Pane, M., et al. (2020). Live Biotherapeutic Products, A Road Map for Safety Assessment. Front. Med. 7, 237.

[0278] 81. Baquero, F., and Nombela, C. (2012). The microbiome as a human organ. Clin. Microbiol. Infect. 18 Suppl 7, 2-4.

[0279] 82. Panwar, R.B., Sequeira, R.P., and Clarke, T.B. (2021). Microbiota-mediated protection against antibiotic-resistant pathogens. Genes Immun. 22, 255-267.

[0280] 83. Cheng, H.-Y., Ning, M.-X., Chen, D.-K., and Ma, W.-T. (2019). Interactions Between the Gut Microbiota and the Host Innate Immune Response Against Pathogens. Front. Immunol. 10, 607.

[0281] 84. Anderson, B.D., and Bisanz, J.E. (2023). Challenges and opportunities of strain diversity in gut microbiome research. Front. Microbiol. 14, 1117122.

[0282] 85. Pybus, V., and Onderdonk, A.B. (1998). A commensal symbiosis between Prevotella bivia and Peptostreptococcus anaerobius involves amino acids: potential significance to the pathogenesis of bacterial vaginosis. FEMS Immunol. Med. Microbiol. 22, 317-327.

[0283] 86. Gohl, D M., Vangay, P., Garbe, J., MacLean, A., Hauge, A., Becker, A., Gould, T.J., Clayton, J.B., Johnson, T.J., Hunter, R., et al. (2016). Systematic improvement of amplicon marker gene methods for increased accuracy in microbiome studies. Nat. Biotechnol. 34, 942-949.

[0284] 87. IHMS Standard operating procedure for fecal samples self-Collection, laboratory analysis handled within 4 to 24 hours.

[0285] 88. Tian, Y., Cai, J., Allman, E.L., Smith, P.B., and Patterson, A.D. (2021). Quantitative Analysis of Bile Acid with UHPLC-MS / MS. Methods Mol. Biol. 2194, 291-300.

[0286] 89. Tian, Y., Zhang, L., Wang, Y., and Tang, H. (2012). Age-related topographical metabolic signatures for the rat gastrointestinal contents. J. Proteome Res. 11, 1397-1411.

[0287] 90. Camacho, C., Courlouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., and Madden. T.L. (2009). BLAST+ architecture and applications. BMC Bioinformatics 10, 421.

[0288] 91. Bolyen, E., Rideout, J.R., Dillon, M.R., Bokulich, N.A., Abnet, C.C., Al-Ghalith, G.A., Alexander, H., Alm, E.J., Arumugam, M., Asnicar, F., et al. (2019). Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 37, 852-857.

[0289] 92. Core Team, R. (2021). R: A language and environment for statistical computing. Vienna: R foundation for statistical computing.Attorney Docket No. 0073605-001128

[0290] 93. Wickham, H., Averick, M., Bryan, J., Chang, W., McGowan, L., Francois, R., Grolemund, G., Hayes, A., Henry, L., Hester, J., et al. (2019). Welcome to the tidyverse. J. Open Source Softw. 7, 1686.

[0291] 94. Paradis, E., Claude, J., and Strimmer, K. (2004). APE: Analyses of Phylogenetics and Evolution in R language. Bioinformatics 20, 289-290.

[0292] 95. Jain, C., Rodriguez-R, L.M., Phillippy, A.M., Konstantinidis, K.T., and Aluru, S. (2018). High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries. Nat. Commun. 9, 5114.

[0293] 96. Bates, D., Maehler, M., Bolker, B., and Walker, S. (2015). Fitting Linear Mixed- Effects Models Using lme4. J. Stat. Softw. 67, 1-48.

[0294] It should be understood that modifications to the embodiments disclosed herein can be made to meet a particular set of design criteria. For instance, the number of or configuration of components or parameters may be used to meet a particular objective.

[0295] It will be apparent to those skilled in the art that numerous modifications and variations of the described examples and embodiments are possible in light of the above teachings of the disclosure. The disclosed examples and embodiments are presented for purposes of illustration only. Other alternative embodiments may include some or all the features of the various embodiments disclosed herein. For instance, it is contemplated that a particular feature described, either individually or as part of an embodiment, can be combined with other individually described features, or parts of other embodiments. The elements and acts of the various embodiments described herein can therefore be combined to provide further embodiments.

[0296] It is the intent to cover all such modifications and alternative embodiments as may come within the true scope of this invention, which is to be given the full breadth thereof. Additionally, the disclosure of a range of values is a disclosure of every numerical value within that range, including the end points. Thus, while certain exemplary embodiments of the device and methods of making and using the same have been discussed and illustrated herein, it is to be distinctly understood that the invention is not limited thereto but may be otherwise variously embodied and practiced within the scope of the following claims.

Claims

Attorney Docket No. 0073605-001128CLAIMS1. A method for treating a microbial infection in a subject, comprising administering to the subject a composition comprising a therapeutically effective amount of at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

2. A method for treating a microbial infection in a subject, comprising administering to the subject a composition comprising a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

3. The method according to claim 1 or 2, wherein the subject is a human.

4. The method according to claim 1 or 2, wherein the at least one microbial strain is a genetically engineered microbial strain.

5. The method according to claim 1 or 2, wherein the at least one microbial strain comprises one or more of strains or strain variants of Escherichia coli, Bacteroides thetaiotaomicron, Bacteroides ovatus, Bacteroides uniformis, Phocaeicola [Bacteroides] vulgatus, Parabacteroides merdae, Enterocloster asparagiformis, Dorealongicatena, Agathobacter rectalis, Lachnospira eligens, Bacteroides stercoris, Bacteroides xylani solvens, Anaerobutyricum hallii, Lactonifactor longoviformis, Faecalibacterium prausnitzii, Blautia producta, Dorea formicigenerans, Blautia obeum, Clostridium spiroforme, Eggerthella lenta, Eubacterium hadrus, Clostridium orbiscindens, Clostridium symbiosum, Bacteroides sp., Bifidobacterium longum subsp. longum, Bacteroides caccae, Bacteroides cellulosilyticus, Bacteroides dorei. Bacteroidesfinegoldii, Parabacteroides sp., Peptostreptococcus anaerobius [russellii], Sutterella wadsworthensis, and Clostridium scindens.

6. The method according to claim 1 or 2, wherein the at least one microbial strain comprises a Peptostreptococcus anaerobius [russellii] strain or strain variant, wherein the Peptostreptococcus anaerobius [russellii] strain or strain variant optionally comprises at least a DNA sequence in its genome that is complementary to one or more primers according to SEQ IDNOs: 9 and 10.

7. The method according to claim 1 or 2, wherein the at least one microbial strain comprises a Dorea longicatena strain or strain variant, wherein the Dorea longicatena strain or strainAttorney Docket No. 0073605-001128 variant optionally comprises at least a DNA sequence in its genome that is complementary to one or more primers according to SEQ ID NOs: 7 and 8.

8. The method according to claim 1, wherein the at least one microbial strain comprises singlestrain administration of a Peptostreptococcus anaerobius [russellii] strain or strain variant.

9. The method according to claim 1, wherein the at least one microbial strain comprises a single-strain administration of a Dorea longicatena strain or strain variant.

10. The method according to claim 1 or 2, wherein the at least one microbial strain comprises a genetically engineered Escherichia coli strain, lactobacilli strain, or Phocaeicola vulgatus strain adapted to overexpress a putA gene or a proline-utilizing enzyme.

11. The method according to claim 1 or 2, further comprising reducing a level of one or more of IL-ip, IL-6, and TNF-a in the subject.

12. The method according to claim 1 or 2, wherein the competitive Stickland fermentation includes a reductive Stickland fermentation of proline and, optionally, glycine.

13. The method according to claim 1 or 2, wherein the microbial infection includes an antibioticresistant microbial infection.

14. The method according to claim 1 or 2, wherein the microbial infection includes a Clostridioides difficile infection.

15. The method according to claim 1 or 2, wherein the microbial infection is an antibiotic- associated diarrhea.

16. The method according to claim 1 or 2, wherein the microbial infection is a nosocomial infection.

17. A composition for use in treating a microbial infection comprising at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

18. A composition for use in treating a microbial infection comprising a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

19. A composition for use in a method of treating a microbial infection, the method comprising administering to a subject the composition, wherein the composition comprises a therapeutically effective amount of at least one microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.Attorney Docket No. 0073605-001128 20. A composition for use in a method of treating a microbial infection, the method comprising administering to a subject the composition, wherein the composition comprises a plurality of microbial strains, wherein at least one microbial strain of the plurality of microbial strains is a microbial strain adapted to perform a competitive Stickland fermentation or provide a mechanism of proline depletion.

21. The composition according to any one of claims 17-20, wherein the subject is a human.

22. The composition according to any one of claims 17-20, wherein the at least one microbial strain is a genetically engineered microbial strain.

23. The composition according to any one of claims 17-20, wherein the at least one microbial strain comprises one or more of strains or strain variants of Escherichia coli, Bacteroides thetaiotaomicron, Bacteroides ovatus, Bacteroides uniformis, Bacteroides [Phocaeicola] vulgatus, Parahacteroides merdae Enterocloster asparagiformis Dorealongicatena Agathobacter rectalis, Lachnospira eligens, Bacteroides stercoris, Bacteroides xylanisolvens, Anaerobutyricum hallii, Lactonifactor longoviformis, Faecalibacterium prausnitzii, Blautia producla, Dorea formicigenerans, Blautia obeum, Clostridium spiroforme. Eggerthella lenta, Eubacterium hadrus, Clostridium orbiscindens, Clostridium symbiosum, Bacteroides sp., Bifidobacterium longum subsp. longum, Bacteroides caccae, Bacteroides cellulosilyticus, Bacteroides dorei, Bacteroidesftnegoldii, Parahacteroides sp.. Peptostreptococcus anaerobius [russellii], Sutter ella wadsworthensis, and Clostridium scindens.

24. The composition according to any one of claims 17-20, wherein the at least one microbial strain comprises a Peptostreptococcus anaerobius [russellii strain or strain variant, wherein the Peptostreptococcus anaerobius [russellii] strain or strain variant optionally comprises at least a DNA sequence in its genome that is complementary to one or more primers according to SEQ ID NOs: 9 and 10.

25. The composition according to any one of claims 17-20, wherein the at least one microbial strain comprises a Dorea longicatena strain or strain variant, wherein the Dorea longicatena strain or strain variant optionally comprises at least a DNA sequence in its genome that is complementary to one or more primers according to SEQ ID NOs: 7 and 8.

26. The composition according to any one of claims 17-20, wherein the at least one microbial strain comprises a single-strain administration of a Peptostreptococcus anaerobius [russellii] strain or strain variant.Attorney Docket No. 0073605-001128 27. The composition according to any one of claims 17-20, wherein the at least one microbial strain comprises a single-strain administration of a Dorea longicatena strain or strain variant.

28. The composition according to any one of claims 17-20, wherein the at least one microbial strain comprises a genetically engineered Escherichia coli strain, lactobacilli strain, or Phocaeicola vnlgatus strain adapted to overexpress a putA gene or a proline-utilizing enzyme.

29. The composition according to any one of claims 17-20, wherein the competitive Stickland fermentation includes a reductive Stickland fermentation of proline and, optionally, glycine.

30. The composition according to any one of claims 17-20, wherein the microbial infection includes an antibiotic-resistant microbial infection.

31. The composition according to any one of claims 17-20, wherein the microbial infection includes a Clostridioides difficile infection.

32. The composition according to any one of claims 17-20, wherein the microbial infection is an antibiotic-associated diarrhea.

33. The composition according to any one of claims 17-20, wherein the microbial infection is a nosocomial infection.

34. The composition according to any one of claims 17-20, further comprising a vehicle.

35. A synthetic microbiota comprising the composition according to any one of claims 17-20.

36. A synthetic microbiota transplant comprising the synthetic microbiota according to claim 35.

37. The synthetic microbiota transplant according to claim 36, wherein the synthetic microbiota transplant is a synthetic fecal microbiota transplant.

38. Use of the composition according to any one of claims 17-20 in the manufacture of a medicament for treating a microbial infection.

39. Use of the synthetic fecal microbiota transplant according to claim 37 in combination with a human fecal transplant in the manufacture of a medicament for treating a microbial infection.

40. A medical kit for treating a microbial infection comprising:the synthetic microbiota transplant according to claim 37; andat least an instruction for using the synthetic microbiota transplant.

Images