Primer probe combinations and kits
By combining primer and probe combinations and kits with real-time PCR and the UDG enzyme anti-contamination system, the sensitivity and cost issues of CYP2C19 gene polymorphism detection in existing technologies have been resolved, enabling rapid and accurate genotype analysis.
Patent Information
- Application Number
- CN202210442124.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-25
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2042-04-25
AI Technical Summary
Existing methods for detecting CYP2C19 gene polymorphism suffer from problems such as low sensitivity, high cost, demanding instrument requirements, strict storage conditions, and susceptibility to mutations, making it difficult to achieve rapid and accurate genotype analysis.
A primer-probe combination and kit is provided, containing primers and probes with high specificity and sensitivity. It uses real-time PCR technology combined with the UDG enzyme anti-contamination system to achieve rapid detection of three gene polymorphisms.
It achieves high-throughput, low-cost, and simple-to-operate detection of CYP2C19 gene polymorphism with a sensitivity of 0.1 ng/μL. The storage conditions are 2–8℃, avoiding low-temperature storage. The detection process is completed within 50 minutes, and the results are accurate and reliable.
Smart Images

Figure QLYQS_1 
Figure BDA0003615208560000041 
Figure BDA0003615208560000091
Abstract
Description
Technical Field
[0001] This invention relates to the field of medical testing technology, and in particular to primer-probe combinations and kits. Background Technology
[0002] Cytochrome CYP450 is a major enzyme system in hepatocytes that metabolizes drugs. The CYP2C19 gene within this system has a significant impact on the metabolism of many drugs; many endogenous substances and approximately 2% of clinically used drugs are metabolized by the CYP2C19 enzyme. Studies have shown that the CYP2C19 enzyme can affect the metabolism of various clinical drugs, including clopidogrel, phenytoin sodium, and diazepam. Its gene polymorphism is a major reason for the metabolic differences in the same drug between individuals and ethnic groups. In 2010, the US FDA required that the relationship between CYP2C19 and efficacy be stated on the clopidogrel drug label and recommended that CYP2C19 genotyping be performed before use.
[0003] The CYP2C19 gene contains multiple alleles, among which CYP2C19*1 is the wild-type allele, encoding an enzyme with normal biological activity. CYP2C19*2, CYP2C19*3, and CYP2C19*17 are alleles with high mutation frequencies in the Chinese population. CYP2C19*2 and CYP2C19*3 are loss-of-function or reduced-function alleles, which can lead to decreased catalytic activity of the CYP2C19-encoded enzyme, weakened substrate metabolism, and reduced production of active metabolites, thus causing adverse drug reactions. CYP2C19*17 is the gain-of-function allele, which can increase the catalytic activity of the CYP2C19-encoded enzyme and enhance substrate metabolism. Genetic variations in the CYP2C19 gene lead to individual differences in CYP2C19 enzyme activity, resulting in ultra-rapid metabolizers, rapid metabolizers, intermediate metabolizers, and slow metabolizers in the population.
[0004] Clopidogrel, also known as Plavix, is an antiplatelet drug widely used in patients with acute coronary syndrome, myocardial infarction, and diagnosed peripheral artery disease. It effectively reduces the occurrence of atherosclerotic events (such as myocardial infarction, stroke, and vascular death). As a prodrug, clopidogrel itself has no pharmacological activity; it is primarily activated by the CYP2C19 enzyme to produce an active metabolite that exerts its antiplatelet effect. In March 2010, the US FDA required a black-line label to be added to the clopidogrel product information, warning that poor metabolizers of clopidogrel do not respond well to treatment. The FDA recommended that physicians assess a patient's clopidogrel metabolism by testing their CYP2C19 genotype, and that alternative anticoagulants be considered for patients with poor clopidogrel metabolism.
[0005] Currently, there are many methods for detecting different gene polymorphism sites, such as Sanger sequencing, allele-specific PCR (AS-PCR), PCR-SSO (Sequence Specific Oligonucleotide, SSO), PCR-SSP, High Resolution Melting Analysis (HRM), PCR-Restriction Fragment Length Polymorphism, gene chip method, and quantitative real-time PCR.
[0006] Among existing detection methods, Sanger sequencing is the classic method for DNA sequence analysis. Because it can directly read DNA sequences, it is considered the gold standard for genotyping. Its advantages include longer sequencing lengths and the ability to discover new variant sites, but its sensitivity is low and it has specific requirements for reagents and instruments, making it difficult to popularize. Allele-specific PCR (AS-PCR) has high sensitivity and is suitable for detecting somatic mutations with a low mutation rate in tumor tissues, but its throughput is low and its false positive rate is high. PCR-SSO (polymerase chain reaction oligonucleotide probe hybridization) is time-consuming and requires strict control of experimental conditions; otherwise, mismatches will occur, affecting the accuracy of the results. PCR-SSP (Symptom PCR-Symptom SP) uses SSPs that bind complementary to the base sequence of a specific allele fragment, and PCR specifically amplifies this gene fragment to analyze gene polymorphism. High-resolution melting curve analysis is a simple, rapid, and high-throughput method for genotyping by analyzing the melting curve of the PCR reaction, but it cannot exclude newly emerging genetic variations in the tested nucleic acid, and this method has high requirements for instrument sensitivity and resolution. Restriction fragment length polymorphism (RFLP) is a method based on enzyme digestion. It is low-cost and simple, but has low throughput, is labor-intensive for large-scale genotyping, and is only applicable to a subset of SNPs. Gene chip methods use specific oligonucleotide fragments as probes, which are regularly arranged and immobilized on a support. Sample DNA is then hybridized to the chip according to base pairing principles through PCR amplification and fluorescent labeling. The fluorescence signal on the chip is then detected and analyzed by a fluorescence detection system, rapidly obtaining an individual's genotype information. Its main advantage is the simultaneous detection of multiple SNP sites, offering high throughput, but it is also costly and requires specialized equipment. It is suitable for laboratories with chip detection capabilities to detect known fixed sites and large sample sizes. Currently, the commonly used method for detecting gene polymorphism sites is TaqMan probe-based quantitative PCR. This method offers high sensitivity, accurate genotyping, simple and rapid operation, and readily available and widely applicable equipment. However, current quantitative PCR detection reagents have limited detection sites, and the cost of detecting a single site is high. Furthermore, the specificity of Taqman probes is easily reduced when other mutations occur near the target SNP site. In addition, most current quantitative PCR detection reagents have relatively harsh storage conditions, usually stored at -20℃, and their detection performance is poor after repeated freeze-thaw cycles. Therefore, it is necessary to establish a method that is convenient to store and can quickly and effectively detect CYP2C19 gene polymorphism. Summary of the Invention
[0007] In view of this, the present invention provides primer-probe combinations and kits, the primers, probes and kits of the present invention having the characteristics of high specificity, high sensitivity and simple operation.
[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0009] This invention provides a primer-probe set, comprising:
[0010] (I) The upstream primer has any of the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 5, SEQ ID No. 9, SEQ ID No. 10 and / or SEQ ID No. 13; and / or
[0011] (II) The downstream primer has any of the nucleotide sequences shown in SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 11 and / or SEQ ID No. 14; and / or
[0012] (III) The probe has any of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and / or SEQ ID No. 15;
[0013] (IV) A nucleotide sequence having one or more bases substituted, deleted, or added to any of the nucleotide sequences shown in (I) to (III), and having the same function as any of the nucleotide sequences shown in (I) to (III); and / or
[0014] (V) A nucleotide sequence having at least 80% homology with any of the nucleotide sequences shown in (I) to (IV);
[0015] The number of items is 2 to 10.
[0016] The present invention also provides the application of the above-mentioned primer and probe set in the preparation of reagents, kits and / or devices for detecting human CYP2C19 gene polymorphism.
[0017] In some specific embodiments of the present invention, the reagents, kits and / or devices described in the above applications include PCR reaction solution W, PCR reaction solution M and / or PCR reaction solution E;
[0018] The PCR reaction solution W includes primers having any of the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13 and / or SEQ ID No. 14, probes having any of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and / or SEQ ID No. 15, and / or PCR reaction buffer; and / or
[0019] The PCR reaction solution M comprises primers having any of the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13 and / or SEQ ID No. 14, probes having any of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and / or SEQ ID No. 15, and / or PCR reaction buffer; and / or
[0020] The PCR reaction solution E includes manganese acetate; and / or
[0021] The PCR reaction buffer includes dNTPs, glycerol, ultrapure water, enzymes, metal ions, permeation protectants, surfactants, stabilizers, preservatives, and / or buffer solutions.
[0022] In some specific embodiments of the present invention, the reaction system and reaction procedure of the reagents, kits and / or devices described above include:
[0023] The reaction system comprises: 20 μL of the PCR reaction solution W or the PCR reaction solution M, 10 μL of the PCR reaction solution E, and / or 50 μL of nucleic acid template; and / or the reaction procedure comprises:
[0024]
[0025] In some specific embodiments of the present invention, the above-described application is characterized in that the criteria for judging the detection results of the primer probe set, reagents, kits, and / or devices include:
[0026] When the detection result of the channel to which the probe with the nucleotide sequence shown in SEQ ID No. 12 belongs is: C tW -C tM When <-2.5, it is of type CYP2C19*17CC; C tW -CtM >2.5 indicates CYP2C19*17TT type; |C tW -C tM |≤2.5 indicates CYP2C19*17CT type; and / or
[0027] When the detection result of the channel to which the probe with the nucleotide sequence shown in SEQ ID No. 8 belongs is: C tW -C tM <-2.5 is the CYP2C19*3GG type; C tW -C tM >2.5 indicates CYP2C19*3AA type; |C tW -C tM |≤2.5 is of type CYP2C19*3GA; and / or
[0028] When the detection result of the channel to which the probe with the nucleotide sequence shown in SEQ ID No. 4 belongs is: C tW -C tM <-2.5 is the CYP2C19*2GG type; C tW -C tM >2.5 indicates CYP2C19*2AA type; |C tW -C tM When |≤2.5, it is of type CYP2C19*2GA.
[0029] The present invention also provides reagents, including the above-described primer-probe set and acceptable excipients and / or auxiliaries.
[0030] In some specific embodiments of the present invention, the reagents described above further include PCR reaction solution W, PCR reaction solution M and / or PCR reaction solution E;
[0031] The PCR reaction solution W includes primers having any of the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13 and / or SEQ ID No. 14, probes having any of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and / or SEQ ID No. 15, and / or PCR reaction buffer; and / or
[0032] The PCR reaction solution M comprises primers having any of the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13 and / or SEQ ID No. 14, probes having any of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and / or SEQ ID No. 15, and / or PCR reaction buffer; and / or
[0033] The PCR reaction solution E includes manganese acetate; and / or
[0034] The PCR reaction buffer includes dNTPs, glycerol, ultrapure water, enzymes, metal ions, permeation protectants, surfactants, stabilizers, preservatives, and / or buffer solutions.
[0035] The present invention also provides a kit comprising the above-described primer and probe set, as well as acceptable excipients and / or auxiliaries.
[0036] In some specific embodiments of the present invention, the kit described above further includes PCR reaction solution W, PCR reaction solution M and / or PCR reaction solution E;
[0037] The PCR reaction solution W includes primers having any of the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13 and / or SEQ ID No. 14, probes having any of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and / or SEQ ID No. 15, and / or PCR reaction buffer; and / or
[0038] The PCR reaction solution M comprises primers having any of the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13 and / or SEQ ID No. 14, probes having any of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and / or SEQ ID No. 15, and / or PCR reaction buffer; and / or
[0039] The PCR reaction solution E includes manganese acetate; and / or
[0040] The PCR reaction buffer includes dNTPs, glycerol, ultrapure water, enzymes, metal ions, permeation protectants, surfactants, stabilizers, preservatives, and / or buffer solutions.
[0041] In some specific embodiments of the present invention, the PCR reaction buffer includes water, dNTPs, rTth enzyme, UDG enzyme, Tween, DMSO, NaN3, ammonium sulfate, glycerol, and Tricine; the DMSO is a 10 wt% aqueous solution; the Tween is a 10 wt% aqueous solution of Tween-20; and the sodium azide solution contains 10% NaN3 solution of sodium azide.
[0042] In some specific embodiments of the present invention, the above-described device is covered with the above-described primer probe set or the above-described reagent, as well as acceptable components.
[0043] The present invention also provides a detection method, comprising performing real-time fluorescence PCR on the test sample using the above-described primer and probe set, the above-described reagents and / or the above-described kit, and identifying the CYP2C19 gene polymorphism of the test sample according to the judgment criteria described above.
[0044] The present invention has the following effects:
[0045] 1. This kit can detect 3 gene loci (CYP2C19*2, CYP2C19*3, and CYP2C19*17) in a single experiment, with high throughput, simple operation and low cost;
[0046] 2. The primers involved in this invention do not require special modification to meet the requirements for CYP2C19 gene polymorphism analysis and detection;
[0047] 3. The reagent can be stably stored at 2-8℃ for 12 months, avoiding low-temperature storage and repeated freeze-thaw cycles. The storage conditions are easy to achieve, improving the convenience of use.
[0048] 4. Detection is performed using real-time PCR technology. All detection processes are closed-tube reactions, and the UDG enzyme anti-contamination system is incorporated to significantly reduce contamination and ensure the accuracy and reliability of the results.
[0049] 5. Rapid detection: The entire detection process is completed within 50 minutes, and the interpretation method is simple. Attached Figure Description
[0050] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0051] Figure 1The fluorescence quantitative PCR curve for wild-type amplification of the CYP2C19*2 gene is shown.
[0052] Figure 2 The fluorescence quantitative PCR curve for amplification of the heterozygous CYP2C19*2 gene is shown.
[0053] Figure 3 The fluorescence quantitative PCR curve for amplification of the CYP2C19*2 gene mutant is shown.
[0054] Figure 4 The fluorescence quantitative PCR curve for wild-type amplification of the CYP2C19*3 gene is shown.
[0055] Figure 5 The fluorescence quantitative PCR curve for amplification of the heterozygous CYP2C19*3 gene is shown.
[0056] Figure 6 The fluorescence quantitative PCR curve for amplification of the CYP2C19*3 gene mutant is shown.
[0057] Figure 7 The fluorescence quantitative PCR curve for wild-type amplification of the CYP2C19*17 gene is shown.
[0058] Figure 8 The fluorescence quantitative PCR curve for amplification of the heterozygous CYP2C19*17 gene is shown.
[0059] Figure 9 The quantitative real-time PCR curve for amplification of the CYP2C19*17 gene mutant is shown.
[0060] Figure 10 The fluorescence quantitative PCR curve for amplification of the CYP2C19 internal control gene is shown.
[0061] Figure 11 The results of the CYP2C19*2 heterozygous sample test are shown:
[0062] Figure 12 This shows the detection results of the CYP2C19*2 heterozygous sample;
[0063] Figure 13 The results of the detection of CYP2C19*2 heterozygous samples at a concentration of 0.5 ng / μL are shown.
[0064] Figure 14 This shows the detection results of the CYP2C19*2 heterozygous sample;
[0065] Figure 15 This shows the detection results of the CYP2C19*3 heterozygous sample;
[0066] Figure 16 The results of the detection of CYP2C19*3 heterozygous samples at a concentration of 0.1 ng / μL are shown.
[0067] Figure 17 This shows the detection results of the CYP2C19*17 heterozygous sample;
[0068] Figure 18 This shows the detection results of the CYP2C19*17 heterozygous sample;
[0069] Figure 19 The results of the CYP2C19*17 heterozygous sample test are shown. Detailed Implementation
[0070] This invention discloses primer-probe combinations and kits. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0071] The purpose of this invention is to overcome the shortcomings of the prior art and provide a detection method that is simple to operate, fast, and highly accurate.
[0072] This invention overcomes the shortcomings of existing technologies and provides a highly sensitive and specific primer and probe, as well as a kit, for detecting human CYP2C19 gene polymorphism based on Taqman probes. The nucleotide sequences of the primers and probes are specifically as follows:
[0073] The CYP2C19*2 primers are:
[0074] F: 5'-TTTAAATTACAACCAGAGCTTGGCATAT-3'; (SEQ ID No. 1)
[0075] R1: 5'-GTTTTTAAGTAATTTGTTATGGGTTACC-3'; (SEQ ID No. 2)
[0076] R2: 5'-AGGTTTTTAAGTAATTTGTTATGGGTTACT-3'; (SEQ ID No. 3)
[0077] The CYP2C19*2 probe:
[0078] 5'-ROX-CTATCATTGATTATTTCCCGGGAACC-BHQ2-3'; (SEQ ID No. 4)
[0079] The CYP2C19*3 primers are:
[0080] F: 5'-ACTTTCATCCTGGGCTGTGCTC-3'; (SEQ ID No. 5)
[0081] R1: 5'-AAAACTTGGCCTTACCTGGCTC-3'; (SEQ ID No. 6)
[0082] R2: 5'-AAAAACTTGGCCTTACCTGGCTT-3'; (SEQ ID No. 7)
[0083] The CYP2C19*3 probe:
[0084] 5'-HEX-CAATCCTGATGTTTTCATTCAATTTTTCCATC-BHQ1-3'; (SEQ ID No. 8)
[0085] The CYP2C19*17 primers are:
[0086] F1: 5'-CAAATTTGTGTCTTCTGTTCTCAAATC-3'; (SEQ ID No. 9)
[0087] F2: 5'-CAAATTTGTGTCTTTCTGTTCTCAAATT-3'; (SEQ ID No. 10)
[0088] R: 5'-TGTTGGTGCCACACAGCTCATA-3'; (SEQ ID No. 11)
[0089] The CYP2C19*17 probe:
[0090] 5'-FAM-AATCCCAGTTCTGCCAGCTATGAGCTG-BHQ1-3'; (SEQ ID No. 12)
[0091] The internal control gene primers are:
[0092] F: 5'-CCAGGAGCTGTGGGAGGAAGAT-3'; (SEQ ID No. 13)
[0093] R: 5'-TTCTGCTTTTATTTTATGGTTGGGA-3'; (SEQ ID No. 14)
[0094] The internal control gene probe is:
[0095] 5'-CY5-CAAGCTAGGCCCTTTTGCTAATCATGTTCAT-BHQ2-3'; (SEQ ID No. 15)
[0096] The fluorescent quantitative PCR probes described in this invention are all Taqman probes, wherein the fluorescent reporter group of the CYP2C19*2 probe is ROX, the fluorescent reporter group of the CYP2C19*3 probe is HEX, the fluorescent reporter group of the CYP2C19*17 probe is FAM, and the fluorescent reporter group of the internal control gene probe is CY5.
[0097] This invention also provides a human CYP2C19 gene polymorphism detection kit, wherein the kit contains the specific primers and probes provided by this invention, and further includes a PCR reaction solution. The PCR reaction solution includes dNTPs, PCR buffer, glycerol, ultrapure water, enzymes, metal ions, sodium azide, etc.
[0098] The human CYP2C19 gene polymorphism detection kit also includes negative and positive controls.
[0099] The kit of this invention can be stably stored for 12 months at 2–8°C, and includes PCR reaction solution W, PCR reaction solution M, and PCR reaction solution E. PCR reaction solution W and PCR reaction solution M contain wild-type and mutant primers and probes, respectively, and PCR reaction solution E is a 25 mmol / L manganese acetate aqueous solution. The PCR reaction buffer is prepared by adding water, 20 mM dNTPs, rTth enzyme, UDG enzyme, Tween, DMSO, NaN3, 0.4 M ammonium sulfate, 80% glycerol, and 1 M Tricine. In the PCR reaction buffer of this invention, the DMSO used is a 10 wt% DMSO aqueous solution; the Tween used is a 10 wt% Tween-20 aqueous solution; and the sodium azide solution contains 10% NaN3 solution.
[0100] The concentrations of primers and probes in the PCR reaction are:
[0101] Table 1
[0102]
[0103] This invention provides a detection method for the above-mentioned human CYP2C19 gene polymorphism detection kit, the detection method comprising the following steps:
[0104] 1) Separate and purify the genomic DNA of the sample to be tested;
[0105] 2) Reaction solution preparation: PCR reaction system was constructed using PCR reaction solution W, PCR reaction solution M, and PCR reaction solution E prepared with the above-mentioned human CYP2C19 gene polymorphism detection primers, probes, and PCR reagents. Two systems, PCR reaction solution W and PCR reaction solution M, were constructed respectively. Each reaction system used DNA as a template for real-time PCR, and negative and positive quality controls were set up at the same time.
[0106] 3) Collect fluorescence signals: Select the fluorescence detection mode corresponding to the fluorescent group, and take fluorescence signals for 3 to 15 cycles for baseline adjustment. Set the threshold line so that it just exceeds the highest point of the amplification curve (irregular noise line) of the normal negative control.
[0107] Analysis of test results: The positive control fluorescence amplification curves all exceeded the threshold line, with obvious S-shaped amplification curves and Ct≤35 for FAM, HEX, ROX, and Cy5 signals. The negative control Cy5 channel required the detection of fluorescence signal and obvious amplification, with Ct≤35 for Cy5 channel. The FAM, HEX, and ROX signals had no obvious amplification and Ct≥35 or no signal value.
[0108] After the PCR reaction was completed, the results were interpreted according to Table 2:
[0109] Table 2
[0110]
[0111] Interpretation of test results for the sample:
[0112] FAM channel detection results: C tW -C tM <-2.5 indicates CYP2C19*17CC type, C tW -C tM >2.5 is of type CYP2C19*17TT, |C tW -C tM |≤2.5 indicates CYP2C19*17CT type.
[0113] HEX channel detection results: C tW -C tM <-2.5 indicates CYP2C19*3GG type, C tW -C tM >2.5 indicates CYP2C19*3AA type, |C tW -C tM |≤2.5 indicates CYP2C19*3GA type.
[0114] ROX channel detection results: C tW -C tM<-2.5 indicates CYP2C19*2GG type, C tW -C tM >2.5 indicates CYP2C19*2AA type, |C tW -C tM |≤2.5 indicates CYP2C19*2GA type.
[0115] The advantages of this invention lie in the fact that the human CYP2C19 gene detection kit uses the Taqman probe method, establishing a multiplex real-time PCR method for detecting genotypes at three polymorphic loci in two reaction tubes. This invention's human CYP2C19 gene detection kit uses ARMS primers to specifically amplify the target fragment, while employing common Taqman probes to reduce costs. Furthermore, it incorporates an internal control system and a UDG enzyme anti-contamination system, resulting in more accurate and stable genotyping detection of samples.
[0116] This invention, through specific research, designs a set of specific PCR primers and probes, providing a highly specific, highly sensitive, high-throughput, and easy-to-use CYP2C19 gene detection kit. Based on ARMS-PCR technology, this invention specifically targets the CYP2C19*2 locus, designing special ARMS-PCR primers and probes. Specifically, this study found that the second base preceding the CYP2C19*2 gene locus can also mutate. If the primer and probe design includes this base region, a mutation in the second base preceding the CYP2C19*2 gene locus will result in reduced amplification efficiency or no amplification. This study optimizes the ARMS-PCR primers, designing one forward primer and two specific reverse primers to specifically recognize the CYP2C19*2 gene locus while avoiding interference from mutations in the second base preceding the CYP2C19*2 gene locus. This invention's kit can accurately detect genomic DNA as low as 0.1 ng / μL, exhibiting high sensitivity.
[0117] This invention discloses a method, primers, probes, and a kit including the primers and probes for detecting CYP2C19 gene polymorphism. Primers and probes for detecting three gene loci: CYP2C19*2, CYP2C19*3, and CYP2C19*17 are provided. Based on ARMS-PCR technology, this invention allows for rapid detection of gene polymorphism at three loci using a two-tube amplification system. Furthermore, this kit can be stored at 4°C, avoiding the need for freezing at -20°C required for conventional reagents. The kit offers the advantage of being readily available without repeated freeze-thaw cycles. This invention provides a rapid, simple method for on-machine detection, utilizes high-throughput quantitative PCR technology, and offers fast detection speed, facilitating widespread application.
[0118] All raw materials and reagents used in this invention are commercially available.
[0119] The present invention will be further illustrated below with reference to the embodiments:
[0120] Example 1: Composition of the reagent kit
[0121] The composition of the detection kit described in this invention is as follows:
[0122] Table 3
[0123]
[0124] Table 4
[0125]
[0126] Example 2: Extraction of Genomic DNA from Samples
[0127] In this embodiment, whole blood samples were collected from humans, and genomic DNA was extracted from them.
[0128] Genomic DNA was extracted from EDTA- or sodium citrate-anticoagulated whole blood as a template for PCR detection. Whole blood sample processing reagents and nucleic acid extraction or purification reagents from Zhengzhou Antu Biotechnology Co., Ltd. were used, and the procedures were performed according to the instructions, detailed below:
[0129] 1. Whole blood sample processing:
[0130] a) Take 0.2-0.4 mL of whole blood sample, add 1.2 mL of erythrocyte lysis buffer, vortex for 1 min, centrifuge at 12000 rpm for 5 min, aspirate and discard the supernatant (carefully aspirate the supernatant, do not aspirate the precipitate, otherwise it will affect the test results. If there is obvious red lumpy precipitate, it is recommended to repeat this step), retain the precipitate;
[0131] b) Add 800 μL of whole blood precipitation suspension and vortex to resuspend the precipitation.
[0132] c) Incubate at 90℃ for 5 minutes, then vortex for 5 seconds, and set aside.
[0133] 2. Sample extraction:
[0134] a) Add 30 μL proteinase K, 600 μL of the processed sample solution, 100 μL of magnetic bead suspension, and 1.2 mL of lysis buffer to the reaction vessel, mix well, and incubate at 37°C for 2 min.
[0135] b) After incubation, magnetically aspirate the above mixture for 1 minute and 30 seconds, then discard the waste liquid;
[0136] c) Demagnetize, add 2 mL of washing solution A, mix well, magnetically adsorb for 1 min 30 s, and discard the waste liquid;
[0137] d) Demagnetize, add 2 mL of washing solution B, mix well, magnetically aspirate for 1 min 30 s, and discard the waste liquid (minimize residue);
[0138] e) Add 100-300 μL (add according to the requirements of subsequent tests), mix well, and dissociate in an 80℃ dry thermostat for 5 min;
[0139] f) After magnetic attraction for 2 minutes, extract or purify the product for subsequent experiments.
[0140] Example 3: Detection of Genomic DNA in Samples
[0141] This embodiment uses the primer and probe combinations listed in Example 1 to amplify the genomic DNA sample extracted in Example 2. The detection steps are as follows:
[0142] 1. Constructing the reaction system
[0143] Prepare the reaction solution according to the proportions in the table below. For each PCR experiment, both positive and negative controls must be tested simultaneously.
[0144] Table 5
[0145]
[0146] Take two PCR reaction tubes. Add 20 μL of CYP2C19 PCR reaction solution W and 10 μL of CYP2C19 PCR reaction solution E to reaction tube 1, and add 20 μL of CYP2C19 PCR reaction solution M and 10 μL of CYP2C19 PCR reaction solution E to reaction tube 2. Then add 50 μL of nucleic acid extract of the same sample to PCR reaction tubes 1 and 2 respectively, and transfer them to the amplification area.
[0147] a) PCR amplification detection
[0148] Place the PCR reaction tubes into the sample chamber of the amplification instrument, and set the amplification program as follows:
[0149] Table 6
[0150]
[0151] Select the FAM channel to detect DNA at the CYP2C19*17 site, select the HEX / JOE channel to detect DNA at the CYP2C19*3 site, select the ROX channel to detect DNA at the CYP2C19*2 site, and select the CY5 channel to detect internal control DNA.
[0152] b) Analysis of test results
[0153] 2. Result Calculation:
[0154] a) After the reaction is complete, save the results. The threshold should be set so that the threshold line just exceeds the highest point of the amplification curve (irregular noise line) of the normal negative control. The type of the control and unknown sample should be determined according to Table 7 [Positive Judgment Value].
[0155] b) Check the results to confirm that the experiment meets the requirements of the "Validity Judgment" below, and record the genotyping results of the samples.
[0156] c) Validity judgment
[0157] The internal control Ct value (CY5 channel) should be ≤40. The positive control value should be within the specified range. The negative control channels should have no amplification curve, or the amplification curve should be a straight line or a slightly sloping line with no obvious exponential growth phase, and no Ct or Ct ≥36. If out of control occurs, corrective measures should be taken.
[0158] Table 7 Positive Judgment Values
[0159]
[0160] Note: If there is no Ct in the target amplification, the Ct value is calculated based on the maximum cycle number of 45.
[0161] Interpretation of Test Results
[0162] If the internal control Ct (CY5 channel) > 40, or the FAM channel CtW ≥ 36 and CtM ≥ 36, or the HEX / JOE channel CtW ≥ 36 and CtM ≥ 36, or the ROX channel CtW ≥ 36 and CtM ≥ 36, then a retest is required.
[0163] Figure 1 This is the fluorescence quantitative PCR curve for wild-type amplification of the CYP2C19*2 gene; Figure 2 This is a fluorescence quantitative PCR curve for the amplification of the heterozygous CYP2C19*2 gene; Figure 3 This is the quantitative real-time PCR curve for amplification of the CYP2C19*2 gene mutant. Figure 4 This is the fluorescence quantitative PCR curve for wild-type amplification of the CYP2C19*3 gene; Figure 5 This is a fluorescence quantitative PCR curve for the amplification of the heterozygous CYP2C19*3 gene; Figure 6 This is the quantitative real-time PCR curve for amplification of the CYP2C19*3 gene mutant. Figure 7 This is the fluorescence quantitative PCR curve for wild-type amplification of the CYP2C19*17 gene; Figure 8 This is the fluorescence quantitative PCR curve for the amplification of the heterozygous CYP2C19*17 gene; Figure 9 This is the quantitative real-time PCR curve for amplification of the CYP2C19*17 gene mutant. Figure 10 This is the fluorescence quantitative PCR curve for the amplification of the CYP2C19 internal control gene.
[0164] Example 4: Sensitivity of the kit for detecting the present invention using human genomic DNA as a template
[0165] The PCR reaction system and conditions described in this invention were used, and the specific operation method was the same as in Example 3. Nine human genomic DNA samples were selected, and the genotypes of these nine samples were CYP2C19*2GG, CYP2C19*2GA, CYP2C19*2AA, CYP2C19*3GG, CYP2C19*3GA, CYP2C19*3AA, CYP2C19*17CC, CYP2C19*17CT, and CYP2C19*17TT. The nucleic acid concentrations of the nine genomic DNA samples were set to 0.05 ng / μL, 0.1 ng / μL, 0.5 ng / μL, and 1 ng / μL, respectively. The results showed that accurate genotyping was still achieved even at a nucleic acid concentration of 0.1 ng / μL. Specific data are shown in the table below. This embodiment demonstrates that the kit of the present invention has high sensitivity for detecting CYP2C19*2, CYP2C19*3, and CYP2C19*17 gene polymorphisms, reaching a sensitivity of 0.1 ng / μL.
[0166] Table 8
[0167]
[0168] Example 5: Primer and probe screening and detection to verify the accuracy and sensitivity of the kit
[0169] In the research process of this invention, dozens of primers and probes were selected for the target sequences of the mutation sites. From these numerous primers and probes, the primer-probe combinations with the best specificity for the three sites CYP2C19*2, CYP2C19*3, and CYP2C19*17 were screened. During the screening process, it was found that most primer-probe combinations had low specificity, poor amplification efficiency, and poor sensitivity. The detection results of some of the screened primers and probes are as follows:
[0170] Table 9
[0171]
[0172]
[0173]
[0174] Figure 11 The result is from a CYP2C19*2 heterozygous sample. The primer amplification efficiency is low, and the analysis of the detection results is inaccurate. Figure 12 The results are from a CYP2C19*2 heterozygous sample, and the primer amplification fluorescence signal is very low. Figure 13This is the detection result of a 0.5 ng / μL CYP2C19*2 heterozygous sample; the *2 mutant tube showed no amplification curve. Figure 14 The results are from a CYP2C19*2 heterozygous sample, showing high amplification efficiency and accurate genotyping. Figure 15 The results are from a CYP2C19*3 heterozygous sample, showing a low level of fluorescence signal amplification by primers. Figure 16 The result is from the detection of a 0.1 ng / μL CYP2C19*3 heterozygous sample. The amplified CT value of the mutant system is too large, which leads to inaccurate typing. Figure 17 The results are from a CYP2C19*17 heterozygous sample. The poor amplification efficiency of the mutant system caused inaccurate typing. Figure 18 The results are from a CYP2C19*17 heterozygous sample; the primers have poor specificity and no amplification curve was observed. Figure 19 The results were from a CYP2C19*17 heterozygous sample. Although the typing was accurate, the fluorescence signal amplification was low, and there were missed detections after the reagents were placed in the container immediately after preparation.
[0175] Example 6: Stability detection of the kit of the present invention using human CYP2C19 genomic heterozygous DNA as a template
[0176] The kit of this invention can be stably stored at 2–8°C for 12 months. The detection results of the kit for 0.1 ng / μL heterozygous samples are as follows.
[0177] Table 10
[0178]
[0179]
[0180] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. sequence list <110> Zhengzhou Antu Bioengineering Co., Ltd. <120> Primer-probe combinations and kits <130> MP21039387 <160> 47 <170> SIPOSequenceListing 1.0 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <400> 1 tttaaattac aaccagagct tggcatat 28 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <400> 2 gtttttaagt aatttgttat gggttacc 28 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> 3 aggtttttaa gtaatttgtt atgggttatact 30 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <400> 4 ctatcattga ttatttcccg ggaacc 26 <210> 5 <211> twenty two <212> DNA <213> Artificial Sequence <400> 5 actttcatcc tgggctgtgc tc 22 <210> 6 <211> twenty two <212> DNA <213> Artificial Sequence <400> 6 aaaacttggc cttacctggc tc 22 <210> 7 <211> twenty three <212> DNA <213> Artificial Sequence <400> 7 aaaaacttgg ccttacctgg ctt 23 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <400> 8 caatcctgat gttttcattc aatttttcca tc 32 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <400> 9 caaatttgtg tcttctgttc tcaaatc 27 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <400> 10 caaatttgtg tcttctgttc tcaaatt 27 <210> 11 <211> twenty two <212> DNA <213> Artificial Sequence <400> 11 tgttggtgcc acacagctca ta 22 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <400> 12 aatcccagtt ctgccagcta tgagctg 27 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence <400> 13 ccaggagctg tgggaggaag at 22 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <400> 14 ttctgctttt attttatggt tggga 25 <210> 15 <211> 31 <212> DNA <213> Artificial Sequence <400> 15 caagctaggc ccttttgcta atcatgttca t 31 <210> 16 <211> twenty two <212> DNA <213> Artificial Sequence <400> 16 actatcattg attatttcac gc 22 <210> 17 <211> twenty four <212> DNA <213> Artificial Sequence <400> 17 atcactatca ttgattattt caca 24 <210> 18 <211> twenty four <212> DNA <213> Artificial Sequence <400> 18 caataaagtc ccgagggttg ttac 24 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <400> 19 ttgcttttat ggaaagtgat attttg 26 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <400> 20 gttttaaatt acaaccagag cttggcatat 30 <210> twenty one <211> 26 <212> DNA <213> Artificial Sequence <400> twenty one ttttaagtaa tttgttatgg gttacc 26 <210> twenty two <211> 32 <212> DNA <213> Artificial Sequence <400> twenty two caaggttttt aagtaatttg ttatgggtta ct 32 <210> twenty three <211> 35 <212> DNA <213> Artificial Sequence <400> twenty three tagtggggaa attattgcat atctaagaga aaaca 35 <210> twenty four <211> 26 <212> DNA <213> Artificial Sequence <400> twenty four taaattacaa ccagagcttg gcatat 26 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 aggtttttaa gtaatttgtt atgggttacc 30 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <400> 26 gtttttaagt aatttgttat gggttat 28 <210> 27 <211> 29 <212> DNA <213> Artificial Sequence <400> 27 tagtgggaaa attattgcat atctaagag 29 <210> 28 <211> twenty four <212> DNA <213> Artificial Sequence <400> 28 aactttcatc ctgggctgtg ctcc 24 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <400> 29 caaaaaactt ggccttacct ggctc 25 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <400> 30 caaaaaactt ggccttacct ggctt 25 <210> 31 <211> 32 <212> DNA <213> Artificial Sequence <400> 31 caatcctgat gttttcattc aatttttcca tc 32 <210> 32 <211> twenty four <212> DNA <213> Artificial Sequence <400> 32 ctcaggattg taagcacccc cttg 24 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <400> 33 actcaggatt gtaagcaccc cctta 25 <210> 34 <211> twenty three <212> DNA <213> Artificial Sequence <400> 34 tggtcaatat agaattttgg att 23 <210> 35 <211> 27 <212> DNA <213> Artificial Sequence <400> 35 ggccaagttttttgcttcctgaaaac 27 <210> 36 <211> twenty four <212> DNA <213> Artificial Sequence <400> 36 atttgtgtct tctgttctca aatc 24 <210> 37 <211> twenty four <212> DNA <213> Artificial Sequence <400> 37 atttgtgtct tctgttctca aatt 24 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <400> 38 gaccctggga gaacaggac 19 <210> 39 <211> twenty four <212> DNA <213> Artificial Sequence <400> 39 atcccagttc tgccagctat gagc 24 <210> 40 <211> 27 <212> DNA <213> Artificial Sequence <400> 40 gttttatgaa caggatgaat gtggtat 27 <210> 41 <211> 27 <212> DNA <213> Artificial Sequence <400> 41 ggcgcattat ctcttacatc agagatg 27 <210> 42 <211> 27 <212> DNA <213> Artificial Sequence <400> 42 ggcgcattat ctcttacatc agagata 27 <210> 43 <211> 35 <212> DNA <213> Artificial Sequence <400> 43 aacagaagac acaaatttga aaaaaaaaat cgttt 35 <210> 44 <211> 27 <212> DNA <213> Artificial Sequence <400> 44 cctgttttat gaacaggatg aatgtgg 27 <210> 45 <211> 27 <212> DNA <213> Artificial Sequence <400> 45 ggcgcattat ctcttacatc agagctg 27 <210> 46 <211> 27 <212> DNA <213> Artificial Sequence <400> 46 ggcgcattat ctcttacatc agagcta 27 <210> 47 <211> 32 <212> DNA <213> Artificial Sequence <400> 47 ttgttttagc aaaacaaaac aacttccaaa ca 32
Claims
1. A primer probe set characterized in that, The primer and probe set includes: CYP2C19*2 primer, CYP2C19*2 probe, CYP2C19*3 primer, CYP2C19*3 probe, CYP2C19*17 primer, CYP2C19*17 probe, internal control gene primer, and internal control gene probe. The CYP2C19*2 primers are: F: As shown in SEQ ID No. 1; R1: As shown in SEQ ID No. 2; R2: As shown in SEQ ID No. 3; The CYP2C19*2 probe is shown in SEQ ID No.
4. The CYP2C19*3 primers are: F: As shown in SEQ ID No. 5; R1: As shown in SEQ ID No. 6; R2: As shown in SEQ ID No. 7; The CYP2C19*3 probe is shown in SEQ ID No.
8. The CYP2C19*17 primers are: F1: As shown in SEQ ID No. 9; F2: As shown in SEQ ID No. 10; R: As shown in SEQ ID No. 11; The CYP2C19*17 probe is shown in SEQ ID No.
12. The internal control gene primers are: F: As shown in SEQ ID No. 13; R: As shown in SEQ ID No. 14; The internal control gene probe is as shown in SEQ ID No.
15.
2. The use of the primer-probe set as described in claim 1 in the preparation of reagents, kits and / or devices for detecting human CYP2C19 gene polymorphism.
3. Use according to claim 2, wherein the compound is ###0002### The reagents, kits and / or devices include PCR reaction solution W, PCR reaction solution M and PCR reaction solution E; The PCR reaction solution W includes primers with nucleotide sequences as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13 and SEQ ID No. 14, probes with nucleotide sequences as shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and SEQ ID No. 15, and PCR reaction buffer; The PCR reaction solution M comprises primers with nucleotide sequences as shown in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13 and SEQ ID No. 14, probes with nucleotide sequences as shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and SEQ ID No. 15, and PCR reaction buffer; The PCR reaction solution E includes manganese acetate.
4. Use according to claim 2 or 3, wherein the compound is ###0002### The reaction system and reaction procedure of the reagents, kits and / or devices include: The reaction system comprises: 20 μL of the PCR reaction solution W, the PCR reaction solution M, 10 μL of the PCR reaction solution E, and 50 μL of nucleic acid template; The reaction procedure includes:
5. The use according to claim 4, wherein the compound is ###0002### The criteria for judging the detection results of the primer-probe set, reagents, kits and / or devices include: When the detection result of the probe channel to which the nucleotide sequence shown in SEQ ID No. 12 belongs is: C tW -C tM When <-2.5, it is of type CYP2C19*17 CC; C tW -C tM >2.5 indicates CYP2C19*17 TT type; |C tW -C tM |≤2.5 indicates CYP2C19*17CT type; When the detection result of the probe belonging to the nucleotide sequence shown in SEQ ID No. 8 is: C tW -C tM <-2.5 is CYP2C19*3 GG type; C tW -C tM >2.5 indicates CYP2C19*3 AA type; |C tW -C tM |≤2.5 indicates CYP2C19*3 GA type; When the detection result of the probe channel corresponding to the nucleotide sequence shown in SEQ ID No. 4 is: C tW -C tM <-2.5 is CYP2C19*2 GG type; C tW -C tM >2.5 indicates CYP2C19*2 AA type; |C tW -C tM When |≤2.5, it is of type CYP2C19*2 GA.
6. A reagent characterized in that, Includes the primer and probe set as described in claim 1, and acceptable excipients.
7. The agent of claim 6, wherein The reagents also include PCR reaction solution W, PCR reaction solution M and PCR reaction solution E; The PCR reaction solution W includes primers with nucleotide sequences as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13 and SEQ ID No. 14, probes with nucleotide sequences as shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and SEQ ID No. 15, and PCR reaction buffer; The PCR reaction solution M comprises primers with nucleotide sequences as shown in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13 and SEQ ID No. 14, probes with nucleotide sequences as shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and SEQ ID No. 15, and PCR reaction buffer; The PCR reaction solution E includes manganese acetate.
8. A kit, characterized in that, It includes the primer and probe set as described in claim 1, and acceptable excipients.
9. The kit of claim 8, wherein The kit also includes PCR reaction solution W, PCR reaction solution M and PCR reaction solution E; The PCR reaction solution W includes primers with nucleotide sequences as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13 and SEQ ID No. 14, probes with nucleotide sequences as shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and SEQ ID No. 15, and PCR reaction buffer; The PCR reaction solution M comprises primers with nucleotide sequences as shown in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 13 and SEQ ID No. 14, probes with nucleotide sequences as shown in SEQ ID No. 4, SEQ ID No. 8, SEQ ID No. 12 and SEQ ID No. 15, and PCR reaction buffer; The PCR reaction solution E includes manganese acetate.
10. A detection method for non-diagnostic purposes, characterized in that, This includes performing real-time fluorescence PCR on the test sample using the primer and probe set as described in claim 1, the reagent as described in claim 6 or 7, and / or the kit as described in claim 8 or 9, and identifying the CYP2C19 gene polymorphism of the test sample according to the judgment criteria described in claim 5.
Citation Information
Patent Citations
Prime, probe and kit for detecting polymorphism of CYP2C19 gene
CN106399561A
Method and kit for detection of human CYP2C19 gene polymorphism
CN107119107A
Composite amplification system and kit for parting detection of clopidogrel, statin and aspirin related drug metabolic genes
CN110423803A
Kit for detecting polymorphism of human CYP2C9 and VKORC1 genes
CN110760578A