Application of reagents for detecting or inhibiting circ_7598

Abstract

The present invention belongs to the technical field of psoriasis diagnosis and treatment, and discloses the use of reagents for detecting or inhibiting circ_7598. More specifically, it relates to the use of reagents for detecting circ_7598 content in the preparation of psoriasis diagnostic preparations, and the use of reagents for inhibiting circ_7598 expression in the preparation of psoriasis therapeutic preparations, as well as corresponding diagnostic and therapeutic preparations. The present invention detected the cyclization site signal of circ_7598 in skin tissue using circRNA sequencing technology and confirmed that it is a real cytoplasmic localized circRNA. Further experiments found that this circRNA is abnormally highly expressed in psoriasis lesions, and inhibiting its expression in keratinocytes can slow cell proliferation and cell cycle progression. These findings suggest that circ_7598 is expected to serve as a diagnostic marker and new therapeutic target for psoriasis.

Description

Technical Field

[0001] The present invention belongs to the technical field of psoriasis diagnosis and treatment, and specifically relates to the use of reagents for detecting or inhibiting circ_7598, more specifically to the use of reagents for detecting the content of circ_7598 in preparing psoriasis diagnostic preparations, and the use of reagents for inhibiting the expression of circ_7598 in preparing psoriasis therapeutic preparations, as well as corresponding diagnostic and therapeutic preparations. Background Art

[0002] Psoriasis vulgaris is a common, chronic, relapsing inflammatory skin disease characterized by scaly, erythematous patches that predominantly occur on the scalp, trunk, and extensor surfaces of the limbs. The disease is difficult to cure and has a high relapse rate, severely impacting patients' physical and mental health and quality of life. Its etiology involves both genetic and environmental factors, and its pathogenesis remains incompletely elucidated. Current treatments are unable to achieve long-term remission or complete cure.

[0003] Keratinocytes are the main constituent cells of the epidermal tissue and are also the key effector cells that drive the phenotype of psoriasis lesions. Their functional disorders run through the entire process of psoriasis development. Some studies have shown that abnormal biological regulation of keratinocytes themselves can trigger psoriasis. Changing the expression of certain psoriasis-related genes in keratinocytes alone can induce psoriatic-like lesions in mice. Abnormal keratinocyte growth dynamics is an important feature of the pathophysiology of psoriasis. It is manifested in accelerated cell proliferation and shortened mitotic cycles, resulting in a shortened epidermal turnover cycle of 3-4 days, accompanied by delayed differentiation and apoptosis disorders. The final manifestation is the typical psoriasis pathological changes of excessive epidermal proliferation, hyperkeratosis with incomplete keratinization, disappearance of the granular layer, and thickening of the acanthus layer, which clinically presents as thickened skin and accumulation of scales.

[0004] Circular RNA (circRNA) is a newly discovered class of noncoding RNAs characterized by a covalently closed loop structure, widely expressed in prokaryotes and eukaryotes. CircRNAs are formed by the circularization, splicing, and cleavage of homologous parent messenger RNA precursors (pre-mRNAs). Specifically, the 5' and 3' ends of the pre-mRNA target sequence are linked end-to-end to form a closed loop. Consequently, circRNAs lack the 5' cap and 3' poly(A) tail structures typically found in linear RNA molecules, making them resistant to degradation by RNA exonucleases and possessing a longer half-life and greater stability than linear RNA molecules. Numerous studies have demonstrated that circRNAs are widely expressed in various human systems and exhibit aberrant and specific expression profiles in peripheral blood cells, plasma, and tissue samples from patients with various diseases. Due to their high stability and disease-related expression variability, circRNAs are considered promising for diagnostic applications. More and more evidence shows that circRNA is involved in numerous biological processes and related signaling pathways, and its abnormal expression is closely related to the occurrence and development of various diseases such as tumors, cardiovascular diseases, diabetes mellitus (type II), neurological diseases, and autoimmune diseases. Therefore, in-depth research on the mechanisms of circRNA in diseases will help develop new therapeutic targets and bring more breakthroughs in disease treatment. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to address the above technical problems and provide the use of a reagent for detecting the content of circ_7598 in the preparation of a psoriasis diagnostic preparation, as well as the use of a reagent for inhibiting the expression of circ_7598 in the preparation of a psoriasis therapeutic preparation, as well as corresponding diagnostic and therapeutic preparations.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The present invention provides the use of a reagent for detecting the expression level of circ_7598 in the preparation of a product for diagnosing psoriasis; the sequence of circ_7598 is shown in SEQ NO.1.

[0008] Furthermore, the reagent for detecting the expression level of circ_7598 includes a PCR or in situ hybridization detection reagent.

[0009] Furthermore, the PCR detection reagent includes qRT-PCR targeting the circ_7598 cyclization site,

[0010] The qRT-PCR primer sequences are

[0011] Upstream primer: 5'-ATAACCTGATTGAAGAACTGTCTGC-3' as shown in SEQ NO.2;

[0012] Downstream primer: 5'-CTGGTTCTCCTCTCTCAACACTT-3', as shown in SEQ NO.3.

[0013] The in situ hybridization probe sequence is: 5'-ATCACGCGCTGTCATATCCTGTGTAGCTGAATATA-3', as shown in SEQ NO. 4.

[0014] The present invention also provides a psoriasis diagnostic kit, comprising: the above-mentioned reagent for detecting the expression level of circ_7598.

[0015] The present invention provides use of an agent for inhibiting circ_7598 expression in preparing a psoriasis treatment preparation, wherein the sequence of circ_7598 is shown in SEQ NO.1.

[0016] Furthermore, the reagent for inhibiting the expression of circular RNAcirc_7598 includes siRNA.

[0017] Furthermore, the siRNA is as follows:

[0018] The positive chain (5'-3') is CUUUAAAAGGUAAAGUGUUTT, as shown in SEQ NO.5.

[0019] The antisense strand (5'-3') is AACACUUUACCUUUUAAAGTT, as shown in SEQ NO.6.

[0020] The reagents for inhibiting circ_7598 include negative controls:

[0021] Sense strand (5'-3'): UUCUCCGAACGUGUCACGUTT, as shown in SEQ NO. 7;

[0022] The antisense strand (5'-3') is ACGUGACACGUUCGGAGAATT, as shown in SEQ NO.8.

[0023] The present invention provides a psoriasis treatment preparation, comprising the reagent for inhibiting the expression of circular RNA circ_7598.

[0024] However, the present invention is not limited to the siRNA and negative control provided above.

[0025] The psoriasis treatment preparation also includes reagents required for transfection of siRNA. The present invention provides a reagent for inhibiting the expression of circ_7598 in the preparation of a preparation for slowing down keratinocyte proliferation and cell cycle progression; the sequence of circ_7598 is shown in SEQ NO.1.

[0026] The present invention also provides a preparation for slowing down keratinocyte proliferation and cell cycle progression, comprising the above-mentioned reagent for inhibiting the expression of circular RNA circ_7598.

[0027] The sequence of the circular RNA circ_7598 described in the present invention is as follows:

[0028] GTAAAGTGTTGAGAGAGGAGAACCAGTGCATTGCTCCTGTGGTTTCCAGCCGCGTGAGTCCAGGGACAAGACCAACAGCTATGGGGTCTTTCAGCTCACACATGACAGAGTTTCCACGAAAACGCAAAGGAAGTGATTCAGACCCATCCCAGTCAGGAATCATGACAGAAAAAGTGGTGGAAAAGCTTTCTCAGAATCCCCTTACCTATCTTCTTTCAACAAGGATA GAAATATCAGCCTCCAGTGGCAGCAGAGTGGAAGATGGTGAACACCAAGTTAAAATGAAGGCCTTCAGAGAAGCTCATAGCCAAACTGAAAAGCGGAGGAGAGATAAAATGAATAACCTGATTGAAGAACTGTCTGCAATGATCCCTCAGTGCAACCCCATGGCGCGTAAACTGGACAAACTTACAGTTTTAAGAATGGCTGTTCAACACTTGAGATCTTTAAAAG.

[0029] The present study detected the cyclization site signal of circ_7598 in skin tissue using circRNA sequencing technology, confirming its existence as a real cytoplasmic circRNA. Further experiments revealed that this circRNA is abnormally highly expressed in psoriatic lesions, and inhibiting its expression in keratinocytes slowed cell proliferation and cell cycle progression. These findings suggest that circ_7598 has the potential to serve as a diagnostic marker and new therapeutic target for psoriasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1Sequence verification results of the circ_7598 cyclization site; A. First-generation sequencing peak diagram of the circ_7598 cyclization site, B. Nucleic acid electrophoresis diagram.

[0031] Figure 2 Results of the circularity verification of circ_7598; A. qRT-PCR detection of the relative expression levels of circ_7598 and parental gene linear transcripts; B. Electrophoresis of RT-PCR products.

[0032] Figure 3 Relative expression levels of circ_7598, U6, and GAPDH in the cytoplasm and nucleus of HaCaT cells.

[0033] Figure 4 FISH localization map of circ_7598, U6, and GAPDH in HaCaT cells; scale bar, 100 μm.

[0034] Figure 5 Figure 3 Diagnostic value of circ_7598 expression level in skin tissue for psoriasis; A. qRT-PCR detection of circ_7598 expression level in psoriatic lesional tissue and normal skin tissue; circ_7598 expression level analysis used the internal reference gene RPLP0 as a reference, and normal skin tissue was normalized to 1. Two-sided Mann-Whitney U test was used. Statistical significance was indicated when p < 0.05, **** p < 0.0001. B. Receiver operating characteristic (ROC) curve of skin circ_7598 as a psoriasis biomarker.

[0035] Figure 6 Figure 3 Diagnostic value of circ_7598 expression level in epidermal tissue for psoriasis; A. qRT-PCR detection of circ_7598 expression level in psoriatic lesional epidermis and normal epidermis; circ_7598 expression level analysis used the internal reference gene RPLP0 as a reference, normal epidermis was normalized to 1, and a two-sided Mann-Whitney U test was used. Statistical significance was indicated when p < 0.05, **** p < 0.0001. B. Receiver operating characteristic (ROC) curve of epidermal circ_7598 as a psoriasis biomarker.

[0036] Figure 7 qRT-PCR was used to detect the expression level of circ_7598 in the M5-induced psoriasis keratinocyte model and untreated cells; the expression level of circ_7598 was analyzed with the internal reference gene GAPDH as the reference, and the untreated cells were normalized to 1. A two-sided unpaired t-test was used. P < 0.05 was statistically significant, *p < 0.05.

[0037] Figure 8The silencing efficiency of si-circ_7598 in HaCaT cells was detected by qRT-PCR technology; the expression level of circ_7598 was analyzed with GAPDH as the reference, and the negative control group was normalized to 1. A two-sided unpaired t-test was used. p<0.05 was statistically significant, ***p<0.001.

[0038] Figure 9 The effect of silencing circ_7598 in vitro on the CCK8 detection value of HaCaT cells; ***p<0.001.

[0039] Figure 10 Effect of silencing circ_7598 in vitro on the EdU positive rate of HaCaT cells; A. Flow cytometry, B. Cell ratio statistics, ***p<0.001.

[0040] Figure 11 Effects of silencing circ_7598 on the cell cycle of HaCaT cells in vitro; A. Flow cytometry, B. Statistical diagram of the proportion of cells in each phase of the cell cycle, ***p<0.001, ****p<0.0001, ns, no statistical significance. DETAILED DESCRIPTION

[0041] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0042] Example 1: Verification of the true existence of circ_7598

[0043] 1. Sequence verification of circ_7598 cyclization site

[0044] Oligo 7 software was used to design divergent and convergent primers to amplify the circ_7598 cyclization site and parental gene sequence, respectively. RT-PCR reactions and agarose electrophoresis of PCR products were performed using cDNA and gDNA from skin tissue or HaCaT cells (human immortalized keratinocytes purchased from the National Biomedical Laboratory Cell Resource Bank) as templates using the above primers. Figure 1 B. Electrophoresis results showed that: using cDNA or gDNA as template, convergent primer amplified the target fragment with the expected size, while divergent primer amplified the target fragment with the expected size only when using cDNA as template. The target fragment was further sequenced by Sanger method, and the sequencing results were consistent with the predicted reverse splicing sequence ( Figure 1 A).

[0045] 2. Verification of the circularity of circ_7598

[0046] RNA from skin tissue was extracted using the TRIZOL method and divided equally into two aliquots. One aliquot was treated with a reaction buffer containing RNase R for linear RNA subtraction, while the other aliquot was treated with a reaction buffer without RNase R as a control. RT-PCR reactions were performed using divergent primers and convergent primers, and agarose electrophoresis of the PCR products was performed. The results of both experiments showed that RNase R significantly reduced the expression level of the linear transcripts of the parental genes, but did not reduce the expression of circ_7598 ( Figure 2 ), thus proving that circ_7598 is indeed a circular RNA molecule.

[0047] Example 2: Cellular localization study of circ_7598

[0048] To clarify the localization of circ_7598 in keratinocytes, the cytoplasmic and nuclear components of HaCaT cells were separated, RNA was extracted, and the expression of circ_7598 was detected by real-time fluorescence quantitative PCR using GAPDH as a cytoplasmic internal reference and U6 as a nuclear internal reference. The test results showed that circ_7598 was mainly localized in the cytoplasm ( Figure 3 In addition, the RNA in situ hybridization kit (F16501 / 50) of Shanghai GeneGene Co., Ltd. was used to carry out the experiment according to the instructions to visualize the localization of circ_7598, such as Figure 4 Shown: Red fluorescence of circ_7598 is surrounded by blue fluorescence of nuclear stain.

[0049] Example 3: Expression of circ_7598 in psoriasis tissues and cells

[0050] 1. 40 psoriatic skin lesion tissues and 40 normal skin tissues were collected from the Department of Dermatology, Xiangya Second Hospital, Central South University. Twenty psoriatic skin lesion tissues and 20 normal skin tissues were stored in liquid nitrogen to explore the expression differences of circ_7598 in the full-thickness skin of the two groups of samples. The remaining 20 specimens in each group were separated from the true epidermis and the epidermal tissues were retained to explore the expression differences of circ_7598 in the epidermal tissues of the two groups of samples. The skin lesion tissue providers underwent skin histopathology examination in our hospital. Patients were diagnosed with psoriasis vulgaris and were excluded from other skin diseases such as systemic lupus erythematosus, atopic dermatitis, eczema, and neurodermatitis. No topical glucocorticoids, retinoids, vitamin D3 derivatives, or calcineurin inhibitors were used on the affected skin within the past two weeks. Normal skin tissue donors were excluded from other skin diseases such as psoriasis, systemic lupus erythematosus, atopic dermatitis, eczema, and neurodermatitis. All tissue samples were collected with the Ethics Committee of the Second Xiangya Hospital of Central South University and the consent of the donors. A psoriasis keratinocyte model was established by stimulating human immortalized keratinocytes (HaCaT cells) with a cytokine cocktail (M5) consisting of IL-17A, IL-22, IL-1α, TNF-α, and oncostatin M to investigate the expression changes of circ_7598 in psoriatic keratinocytes.

[0051] 2. Extraction of tissue / cell RNA

[0052] Tissue RNA was manually extracted using the TRIZOL method, with strict enzyme-free operation and care taken to maintain low temperature.

[0053] (1) Personnel and environment preparation: Experimenters wear disposable masks and gloves, use 0.1% exogenous RNase inhibitor to spray and wipe the experimental table, and use experimental equipment such as pipettes, enzyme-free tips, 1.5mL enzyme-free EP tubes, and 2mL enzyme-free grinding tubes.

[0054] (2) Preparation of experimental materials: Cool down the high-speed low-temperature centrifuge to 4°C, and insert chloroform, isopropyl alcohol, anhydrous ethanol and enzyme-free water into an ice box or pre-cool in a 4°C refrigerator. Allow TRIZOL to equilibrate to room temperature.

[0055] (3) Collect the tissue powder or cell pellet after grinding with liquid nitrogen, add it to 1 mL of TRIZOL, and lyse it at room temperature for 10 minutes.

[0056] (4) Add 200 μL of chloroform to each tube, shake vigorously for at least 15 seconds, and let stand at room temperature for 5-10 minutes. Centrifuge at 12,000 g for 15 minutes at 4°C. During the centrifugation waiting period, prepare a new 1.5 mL EP tube without enzyme and label it.

[0057] (5) After centrifugation, gently remove the EP tube from the centrifuge hole and insert it into the EP tube rack in the ice box. Do not shake the EP tube vigorously to avoid damaging the liquid stratification. Observation shows that the liquid in the tube is divided into three layers: the upper layer is the colorless aqueous phase layer, which is the layer where RNA is located; the middle layer is the white membrane-like layer, which is the layer where protein is located; the bottom layer is the pink organic phase layer, which mainly contains organic substances such as phenol red and chloroform. Use a 200μL pipette to suspend and slowly draw the upper colorless liquid into the marked enzyme-free 1.5mL EP tube, avoiding touching the white protein layer and the lower pink liquid. You can draw three times to obtain 400-500μL of the upper aqueous phase liquid.

[0058] (6) Add an equal volume of pre-chilled isopropanol (about 500 μL) to each tube, cap the tube tightly, invert the EP tube upside down, mix gently, and let it stand at room temperature for 10 minutes (it can also be placed at -20°C for 30 minutes, or incubated at -80°C overnight).

[0059] (7) Centrifuge at 4°C, 12,000 g for 10 min. Prepare 75% ethanol (anhydrous ethanol: enzyme-free water = 3:1) during the centrifugation waiting period. After preparation, place the mixture in an ice box for pre-cooling.

[0060] (8) After centrifugation, carefully discard the supernatant and add 1 mL of the prepared 75% ethanol to each tube. Close the tube cap tightly, turn the EP tube upside down, and tap the tube wall to allow the RNA adhering to the bottom of the tube to float in the liquid. This will ensure more thorough washing and reduce organic contamination.

[0061] (9) Centrifuge at 7,500 g for 5 min at 4°C.

[0062] (10) After centrifugation, a white jelly-like precipitate can be seen at the bottom or side of the tube, which is RNA. After pouring out the liquid in the tube, centrifuge again at 4°C, 75.00g, and centrifuge for 5 minutes.

[0063] (11) Use a pipette to carefully aspirate the remaining liquid in the tube until it is completely aspirated. Place the EP tube open on an EP tube rack to dry naturally. When the precipitate becomes translucent, add an appropriate amount of enzyme-free water according to the size of the precipitate and place it in a 4°C refrigerator for half an hour to allow it to fully dissolve.

[0064] (12) Mix the RNA solution by pipetting and use a Nanodrop 2000 ultra-micro spectrophotometer to detect the RNA concentration and OD value. The RNA sample can be stored at -80°C or the subsequent experiment can be started directly.

[0065] 3. Reverse transcription of mRNA into cDNA

[0066] This experiment was performed using the reverse transcription kit Prime ScriptTM RT reagent Kit with gDNA Eraser (RR047) developed by TaKaRa, Japan. It includes two steps: genomic DNA removal and cDNA synthesis, and the operation was performed according to the kit instructions.

[0067] (1) Personnel and environment preparation: Experimenters wear disposable masks and gloves, use 0.1% exogenous RNase inhibitor to spray and wipe the experimental table, and use pipettes, enzyme-free tips, 1.5mL enzyme-free EP tubes, enzyme-free PCR tubes and other experimental equipment.

[0068] (2) Preparation of experimental items: Take out the required reagents in the test kit RR047 from -20℃, knock on the tube wall after thawing, mix the liquid in the tube, and then place it in an ice box for use.

[0069] (3) Removal of genomic DNA: Prepare the reaction solution in an enzyme-free PCR tube according to the system shown in Table 1 below.

[0070] Table 1 Reaction system for removing genomic DNA

[0071]

[0072] (4) Mix the above reagents and sample RNA, place them in a PCR instrument after centrifugation, and perform the reaction according to the following procedure:

[0073] ①42℃, 2min; ②4℃, ∞.

[0074] (5) Reverse transcription reaction: Prepare the reverse transcription reaction solution according to the system shown in Table 2 below.

[0075] Table 2 Reverse transcription reaction system

[0076]

[0077] (6) Mix the above reagents and sample RNA, place them in a PCR instrument after centrifugation, and perform the reaction according to the following procedure:

[0078] ①37℃, 15min; ②85℃, 5s ec; ③4℃, ∞.

[0079] (7) After reverse transcription, 20 μL of cDNA stock solution was obtained, which was diluted 4-fold by adding 60 μL of enzyme-free water and then aliquoted and stored at -20°C.

[0080] 4. Real-time fluorescence quantitative PCR reaction

[0081] Adopting TB from Japan TaKaRa Premix Ex Taq TMII (Tli RNaseH Plus) kit was used and the operation was performed according to the kit instructions. Table 3 shows the preparation system of the PCR reaction solution.

[0082] Table 3 Real-time fluorescence quantitative PCR reaction system

[0083]

[0084] (1) Preparation of experimental materials: Take out 2×TB green Premix Ex Taq II, forward primer, backward primer and cDNA from -20℃, knock on the tube wall after thawing, mix the liquid in the tube, and then put it into the ice box for use.

[0085] (2) For the same amplified gene, a mixture consisting of 2×TB green Premix ExTaq II, forward primer, backward primer and enzyme-free water can be prepared according to the amount of reaction number + 1. After mixing, 9 μL per well is added to the PCR reaction plate wells, and finally the corresponding templates are added.

[0086] (3) After the PCR reaction plate is completely sealed with the sealing film, centrifuge at 2,500 rpm for 20 seconds.

[0087] (4) Place the PCR reaction plate in the corresponding module of the Light Cycler 96 fluorescence quantitative PCR instrument, set the reaction program as shown in Table 4 below, start amplification, and detect the expression of the target gene.

[0088] Table 4 Real-time fluorescence quantitative PCR amplification reaction conditions

[0089]

[0090] Upstream primer: 5'-ATAACCTGATTGAAGAACTGTCTGC-3' as shown in SEQ NO.2;

[0091] Downstream primer: 5'-CTGGTTCTCCTCTCTCAACACTT-3', as shown in SEQ NO.3.

[0092] (5) Relative quantitative analysis of genes: After each cycle of denaturation, the instrument will automatically record the average fluorescence value of the last 10% of the time of the previous cycle, which represents the PCR yield at the end of the previous cycle, and accumulates it in sequence. After all reactions are completed, the fluorescence intensity values ​​of all reaction wells will be obtained, and an amplification curve will be automatically generated and converted into data for analysis. We set a threshold within the range of exponential growth of the curve, and perform relative quantitative analysis based on the number of cycles experienced when the fluorescence intensity of each reaction well reaches the threshold, that is, the Ct value. The calculation formula is: relative expression = 2 －ΔΔCt(where ΔCt = Ct value of target gene - Ct value of reference gene, ΔΔCt = average ΔCt of experimental group - ΔCt of control group).

[0093] The results showed that the expression level of circ_7598 in the full-thickness tissue of psoriatic lesions was significantly higher than that in the full-thickness tissue of normal skin ( Figure 5 A), the relative expression value of circ_7598 in the whole layer of skin tissue can serve as an effective parameter for the diagnosis of psoriasis, with an AUC value of 0.910 (95% CI: 0.822-0.998), a sensitivity of 80%, a specificity of 95%, and a critical value of 2.3779 ( Figure 5 B); Similarly, the expression level of circ_7598 in psoriatic lesional epidermis was significantly higher than that in normal epidermis ( Figure 6 A), the relative expression value of circ_7598 in the epidermis can also serve as an effective parameter for the diagnosis of psoriasis, with an AUC value of 0.938 (95% CI: 0.870-1.000), a sensitivity of 90%, a specificity of 80%, and a critical value of 1.2369 ( Figure 6 B); In addition, the expression level of circ_7598 in the psoriasis keratinocyte model was also significantly increased compared with the control group, as shown in Figure 7 .

[0094] Example 4: Detection of the effect of silencing circ_7598 expression in keratinocyte cell lines

[0095] Design specific siRNA targeting the circ_7598 cyclization site using Lipofectamine TM RNAiMAX liposomes were transfected into HaCaT cells, and fresh complete medium was replaced 6 hours after transfection. 48 hours after transfection, cells were harvested, and real-time fluorescence quantitative PCR was used to detect the expression level of circ_7598 in HaCaT cells transfected with si-circ_7598 and its corresponding negative control. The siRNAs are as follows:

[0096] The positive chain (5'-3') is CUUUAAAAGGUAAAGUGUUTT, as shown in SEQ NO.5.

[0097] The antisense strand (5'-3') is AACACUUUACCUUUUAAAGTT, as shown in SEQ NO.6.

[0098] The reagents for inhibiting circ_7598 include negative controls:

[0099] Sense strand (5'-3') UUCUCCGAACGUGUCACGUTT

[0100] Antisense strand (5'-3') ACGUGACACGUUCGGAGAATT.

[0101] The results showed that compared with the control group (the control group is the negative control mentioned above), si-circ_7598 could significantly reduce the expression of circ_7598 in HaCaT cells, proving that the silencing efficiency of si-circ_7598 on circ_7598 was greater than 50% ( Figure 8 ).

[0102] Example 5: Silencing circ_7598 in vitro inhibits keratinocyte proliferation

[0103] 1. CCK8 cell proliferation detection experiment

[0104] Using Lipofectamine TM RNAiMAX liposomes transfected si-circ_7598 and its corresponding negative control into HaCaT cells to silence the expression of circ_7598. The original culture medium in the cell well plate was aspirated at 6 time points before transfection, 1 day, 2 days, 3 days, 4 days, and 5 days after transfection, and fresh complete culture medium containing 10% CCK8 solution was added. The cells were placed in a 37°C cell culture incubator for incubation, and the absorbance at 450nm was detected after 40 minutes. The test results showed that before transfection, there was no significant difference in the CCK8 detection values ​​of the two groups of cells, indicating that the cells were evenly plated and the starting number of cells in the two groups was the same. Starting from the second day after transfection, the CCK8 detection value of the si-circ_7598 group was significantly lower than that of the control group, and this difference was maintained until the fourth day after transfection ( Figure 9 ), that is, silencing circ_7598 can inhibit the proliferation of keratinocytes, indicating that circ_7598 has a promoting effect on the proliferation of keratinocytes.

[0105] 2. EdU cell proliferation detection experiment

[0106] To verify the results of the above CCK8 experiment, the EdU cell proliferation assay was used to detect the EdU positive rate of HaCaT cells 48 hours after transfection with si-circ_7598 or the corresponding negative control. The results showed that the EdU positive cell rate in the si-circ_7598 group was significantly reduced compared with the control group, which once again indicated that silencing circ_7598 could significantly slow down the proliferation rate of HaCaT cells ( Figure 10 ).

[0107] This experiment used the EdU Cell Proliferation Detection Kit (C10338-3) from Guangzhou Ruibo Biotechnology Co., Ltd. for EdU labeling and staining, and the Foxp3 / Transcription Factor Staining Buffer Set (00-5523) from Invitrogen for nuclear membrane permeabilization and fixation. The specific experimental steps are as follows:

[0108] (1) Prepare EdU culture medium: Mix high-glucose DMEM complete medium and EdU solution at a ratio of 1000:1 to prepare 50 μM EdU culture medium. The total amount of preparation depends on the number of reactions. One reaction requires 500 μL EdU culture medium.

[0109] (2) Aspirate the original culture medium in the wells of the cell culture plate, add 500 μL of EdU culture medium to each well, and incubate in a 37°C incubator for 1.5 hours.

[0110] (3) Discard the EdU culture medium in the wells, add 1 mL of PBS to each well to wash the cells, discard the PBS in the wells, add 250 μL of trypsin containing EDTA to each well, and place in a 37°C incubator for digestion for 5-10 minutes.

[0111] (4) After the cells in the wells become round and fall off the bottom plate, add 750 μL of complete culture medium to each well to terminate the digestion.

[0112] (5) Collect the cell suspension in the wells into a flow cytometer and centrifuge at 18°C, 300g for 5 minutes.

[0113] (6) Discard the supernatant, add PBS to resuspend and wash the cells, and centrifuge at 18°C, 300g, for 5 minutes.

[0114] (7) Repeat the previous step.

[0115] (8) During the centrifugation waiting period, dilute the fixation / permeabilization concentrate with the fixation / permeabilization diluent at a ratio of 4:1 to prepare the fixation / permeabilization working solution.

[0116] (9) Discard the cell supernatant after centrifugation, add 1 mL of fixation / permeabilization working solution to each tube, resuspend the cells, and react at room temperature for 50 minutes.

[0117] (10) Add 1 mL of 1× permeabilization buffer diluted with double-distilled water to each tube and centrifuge at 18°C, 600 g, for 5 min.

[0118] (11) During the centrifugation waiting period, prepare 1× Staining reaction solution (Table 3-19 is the preparation system for one well in a 12-well cell culture plate)

[0119] Table 5 1× Dyeing reaction solution system

[0120]

[0121]

[0122] Note: Prepare appropriate amount of 1× To avoid damaging the normal reaction system, the dyeing reaction solution should be prepared immediately before use and used up within 30 minutes.

[0123] (12) Discard the supernatant and resuspend the cells with the remaining volume of liquid in the tube. Add 500 μL of 1× Mix the staining reaction solution thoroughly.

[0124] (13) Incubate at room temperature for 10 min in the dark.

[0125] (14) Centrifuge at 18°C, 600 g for 5 min.

[0126] (15) Discard the supernatant and add 1 mL of 1× permeabilization buffer to each tube. Centrifuge at 18°C, 600 g, and centrifuge for 5 min.

[0127] (16) Discard the supernatant, add 500 μL PBS to each tube to resuspend the cells, and immediately perform flow cytometry analysis.

[0128] Example 6: Silencing circ_7598 in vitro blocks cell cycle progression in keratinocytes

[0129] Using Lipofectamine TM RNAiMAX liposomes were used to transfect si-circ_7598 and its corresponding negative control into HaCaT cells to silence the expression of circ_7598. 48 hours after transfection, the cells were collected and fixed with 70% pre-cooled ethanol. DNA staining was performed using PI / RNase Staining Buffer (550825) from BD Biosciences, USA. Finally, the proportion of cells in each phase of the cell cycle was detected by flow cytometry. The results showed that inhibiting the expression of circ_7598 in HaCaT cells significantly increased the proportion of cells in the G1 phase and significantly reduced the proportion of cells in the S phase. That is, silencing circ_7598 can block the cell cycle progression of keratinocytes, indicating that circ_7598 can accelerate the cell cycle progression and promote the proliferation of keratinocytes ( Figure 11 ). Sequence Listing <110> The Second Xiangya Hospital of Central South University <120> Application of reagents for detecting or inhibiting circ_7598 <160> 8 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 453 <212> DNA <213> Homo sapiens <400> 1 gtaaagtgtt gagagaggag aaccagtgca ttgctcctgt ggtttccagc cgcgtgagtc 60 cagggacaag accaacagct atggggtctt tcagctcaca catgacagag tttccacgaa 120 aacgcaaagg aagtgattca gacccatccc agtcaggaat catgacagaa aaagtggtgg 180 aaaagctttc tcagaatccc cttacctatc ttctttcaac aaggatagaa atatcagcct 240 ccagtggcag cagagtggaa gatggtgaac accaagttaa aatgaaggcc ttcagagaag 300 ctcatagcca aactgaaaag cggaggagag ataaaatgaa taacctgatt gaagaactgt 360<so> ctgcaatgat ccctcagtgc aaccccatgg cgcgtaaact ggacaaactt acagttttaa 420 gaatggctgt tcaacacttg agatctttaa aag 453 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 ataacctgat tgaagaactg tctgc 25 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <400> 3 ctggttctcc tctctcaaca ctt 23 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <400> 4 atcacgcgct gtcatatcct gtgtagctga atata 35 <210> 5 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 5 cuuuaaaagg uaaaguguut t 21 <210> 6 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 6 aacacuuuac cuuuuaaagt t 21 <210> 7 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 7 uucuccgaac gugucacgut t 21 <210> 8 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 8 acgugacacg uucggagaat t 21

Claims

1. Use of a reagent for detecting the expression level of circ_7598 in the preparation of a product for diagnosing psoriasis; the sequence of circ_7598 is shown in SEQ NO.

1.

2. The use according to claim 1, characterized in that The reagents for detecting the expression level of circ_7598 include PCR or in situ hybridization detection reagents.

3. The use according to claim 2, characterized in that The PCR detection reagent includes qRT-PCR primers targeting the circ_7598 cyclization site, The qRT-PCR primer sequences are Upstream primer: 5'-ATAACCTGATTGAAGAACTGTCTGC-3' Downstream primer: 5′-CTGGTTCTCCTCTCTCAACACTT-3′; The in situ hybridization detection reagent includes an in situ hybridization probe, and the sequence of the in situ hybridization probe is: 5'-ATCACGCGCTGTCATATCCTGTGTAGCTGAATATA-3'.

4. Use of an agent for inhibiting the expression of circ_7598 in the preparation of a psoriasis treatment preparation, wherein the sequence of circ_7598 is shown in SEQ NO.1; The reagent for inhibiting the expression of circ_7598 includes siRNA; The siRNAs are as follows: Sense strand (5'-3') CUUUAAAAGGUAAAGUGUUTT Antisense strand (5'-3') AACACUUUACCUUUUAAAGTT.

5. The use according to claim 4, characterized in that The reagents for inhibiting circ_7598 include negative controls: Sense strand (5'-3') UUCUCCGAACGUGUCACGUTT Antisense strand (5'-3'): ACGUGACACGUUCGGAGAATT.

Images