A nucleic acid aptamer AS2-3 for human thrombin protein and its screening method and application

Abstract

The invention discloses a nucleic acid aptamer AS2-3 of a human thrombin protein and a screening method and application thereof. The sequence of the nucleic acid aptamer AS2-3 is shown in SEQ ID NO:1. The screening method comprises the following steps: on the basis of a human thrombin protein aptamer obtained by previous screening, retaining its specific sequence for library construction, performing primary screening by using a Capture-SELEX method, and then performing screening again by using a transcription process of a cell-free transcription and translation system. The invention successfully obtains a nucleic acid aptamer sequence AS2-3 which can not only specifically bind to the human thrombin protein, but also can respond to 0.5 μM human thrombin protein in a cell-free transcription process in the form of a linear or plasmid, and inhibit and regulate the transcription of a downstream gene. By combining the two screening methods, it is expected that the nucleic acid aptamer AS2-3 can be applied to the screening of aptamer sequences of other target ligands, thereby having the opportunity to replace transcription regulatory factors as gene elements and be applied to biological circuits for regulation.

Description

Technical Field

[0001] The invention specifically relates to a nucleic acid aptamer AS2-3 of human thrombin protein and a screening method and application thereof, belonging to the technical field of molecular biology. Background Art

[0002] Thrombin is a Na + An activated allosteric serine protease that contains a heparin binding site and a fibrin binding site. It plays the role of a central protease in the coagulation cascade. After vascular injury, thrombin is rapidly generated from inactivated prothrombin through a series of enzyme cleavages. Activated thrombin breaks down fibrinogen into fibrin and forms a clot at the site of vascular injury to prevent bleeding. Thrombin and inactivated prothrombin play a key role in physiological and pathological coagulation and are associated with a variety of diseases, such as Alzheimer's disease and cancer.

[0003] Aptamers are short, single-stranded oligonucleotides (ssDNA or RNA), usually composed of 20 to 80 nucleotides, with high affinity and specificity for target ligands. Aptamers are usually screened by the SELEX (systematic evolution of ligands by exponential enrichment) method. Since aptamers were studied in 1990, 20% of the papers published on aptamers have involved the study of thrombin and its aptamers. Since thrombin aptamers were screened at a relatively early stage and can show strong anticoagulant activity against the procoagulant function of thrombin at nanomolar concentrations, the binding of thrombin to its aptamer is the most commonly used model system in the proof of concept of aptamer-based affinity analysis.

[0004] Most human thrombin detection involves complete α-thrombin (295 amino acids). Human α-thrombin can generate β-thrombin and γ-thrombin through proteolysis. At present, the mature aptamers that can specifically bind to thrombin are: 15mer DNA oligonucleotides (5'-GGTTGGTGTGGTTGG-3') that can interact with one of the two anion binding sites of thrombin, the fibrinogen recognition site, and the dissociation constant K d ~100nM, and a 29mer DNA oligonucleotide (5'AGTCCGTGGTAGGGCAGGTGGGGGTGACT-3') with high affinity to the heparin-binding outer surface of thrombin, with a dissociation constant K d ~0.5nM.

[0005] With the rapid development of synthetic biology, countless gene circuits have been designed and verified. Among them, molecular tools for signal perception and regulation of gene expression are essential for designing and constructing synthetic gene circuits in cell-free and cell-free transcription and translation systems. Although the existing transcription regulatory factors are relatively mature and robust, their number and types are limited, which restricts the construction of synthetic gene circuits in which they participate. Therefore, some studies have begun to use aptamers as genetic elements, regulating downstream genes in the circuit in a manner similar to transcription regulatory factors, and can screen aptamer sequences with affinity to any target ligand through SELEX, so that the combination of aptamers and ligands as regulatory elements has great room for development in future research.

[0006] Experiments have shown that neither of the two thrombin aptamers mentioned above is suitable for directly acting as a gene element in a biological circuit to respond to the presence of a target ligand in the system to affect the transcription process. Therefore, it is necessary to use mature thrombin as a model to screen for an aptamer that can specifically bind to thrombin in vitro and can be used as a gene element in a biological circuit for gene regulation, thereby overcoming the limitations caused by the lack of natural regulatory factors.

[0007] The Cell-Free Transcription-Translation System (TX-TL) is an in vitro expression system that uses crude cell extracts instead of intact cells to perform transcription and translation processes. Since the natural transcription and translation mechanisms are retained in the cell extracts, transcription and translation can be achieved by adding exogenous energy (including amino acids, nucleotides, etc. and secondary energy substrates) in vitro. The cell-free transcription-translation system plays an important role as an intermediate layer for rapid design and testing of prototype circuits before transferring the prototype design to a more complex in vivo environment. Summary of the invention

[0008] In order to solve the problems existing in the prior art, the present invention provides a nucleic acid aptamer AS2-3 that can respond to human thrombin protein in a biological circuit of a cell-free transcription and translation system, and a screening method and application thereof. Using the cell-free transcription and translation system as a medium, an aptamer sequence that can respond to the presence of thrombin protein in the system during the transcription process of this system and regulate the transcription process is screened.

[0009] The technical solution of the present invention is as follows:

[0010] One of the purposes of the present invention is to provide a nucleic acid aptamer AS2-3 for human thrombin protein, the sequence of the nucleic acid aptamer AS2-3 is shown in SEQ ID NO:1.

[0011] Furthermore, the 5' end or 3' end of the nucleic acid aptamer AS2-3 is chemically modified with FITC, amino, biotin or digoxigenin.

[0012] The present invention also provides a nucleic acid aptamer AS2-3, which is a mutant or a truncated sequence or an extended sequence of the sequence shown in SEQ ID NO: 1.

[0013] Furthermore, the 5' end or 3' end of the mutant or truncated sequence or extended sequence of the nucleic acid aptamer AS2-3 is chemically modified with any one of FITC, amino, biotin or digoxigenin.

[0014] The second object of the present invention is to provide a method for screening the nucleic acid aptamer AS2-3 of human thrombin protein, which combines the in vitro SELEX screening method based on nucleic acid aptamers with the screening of cell-free transcription process.

[0015] Furthermore, the screening method comprises the following steps:

[0016] (1) Preparation of screening library: Prepare a random ssDNA library shown in the following sequence:

[0017] 5'-CGCAACCAGGTCTCTAAGC-N40-TAGGGCAGGGTT-N10-AATGTGAGACCGGCCTGTG-3';

[0018] (2) Perform positive screening: Complementary pairing of the ssDNA library with the single-stranded DNA Capture Oligo labeled with biotin at the 3' end to form partial double-stranded DNA;

[0019] (3) Incubating the partial double-stranded DNA obtained in step (2) with streptavidin magnetic beads overnight, so that the ssDNA library is fixed on the streptavidin magnetic beads using DNA Capture Oligo as a medium, and washing away the ssDNA sequences that have not been fixed;

[0020] (4) incubating the magnetic bead-CO-ssDNA Library complex obtained in step (3) with the target ligand human thrombin protein to compete for binding with the ssDNA aptamer sequence with specific affinity;

[0021] (5) magnetically separating the incubation mixture after step (4), collecting the eluted ssDNA aptamer sequence that specifically binds to the human thrombin protein, i.e., the ssDNA enriched library, and continuously reducing the concentration of the target ligand in the subsequent screening process to increase the screening pressure;

[0022] (6) PCR amplification: The ssDNA enriched library obtained in step (5) is subjected to PCR amplification, wherein the primers used for PCR amplification are:

[0023] Primer P1: 5′-CGCAACCAGGTCTCTAAGC-3′;

[0024] Primer P2: 5′-CACAGGCCGGTCTCACATT-3′;

[0025] (7) Obtaining and purifying the ssDNA library: The enriched phosphorylation-labeled dsDNA library obtained by amplification in step (6) is digested with Lambda Exonuclease in a 37°C water bath for 30 min to obtain a ssDNA library, and after ethanol precipitation, a secondary ssDNA library for the next round of screening is obtained;

[0026] (8) Cyclic screening: The secondary ssDNA library obtained in step (7) is used as the secondary library for the next round of screening, and the screening process of (2) to (7) is repeated to complete the forward screening;

[0027] (9) Negative screening: The ssDNA library that has completed the last positive screening is used as the initial library for negative screening, and the above steps (2) and (3) are performed. Before adding the target ligand for incubation, the magnetic bead-CO-ssDNA Library complex is incubated in the cell-free transcription and translation system for 60 minutes, and the non-specific sequences bound to the cell-free transcription and translation system are washed away by magnetic separation, and then the above screening steps (4) to (7) are repeated.

[0028] Furthermore, the steps of screening the cell-free transcription process in step (10) are as follows:

[0029] 101. After the positive and negative screenings are completed, the cell-free transcription process is screened: the ssDNA library after the positive and negative screenings is amplified into a dsDNA library by PCR, and the vector carrying the promoter, output signal and terminator is connected to the dsDNA library by the Golden Gate Assembly method;

[0030] 102. The ligation product with the dsDNA library inserted in step 101 is transformed, coated, picked, colony PCR and verified by gel electrophoresis, and the correct insertion band is selected. The PCR product is recovered and the corresponding linear DNA product after colony PCR is numbered;

[0031] 103. All the recovered linear DNAs containing promoter, aptamer sequence, output signal and terminator are transcribed in a cell-free transcription and translation system with or without target ligand human thrombin protein, and the changes in the output signal are observed to select the aptamer sequence that can respond to the target ligand and affect the transcription of downstream genes.

[0032] The third purpose of the present invention is to apply the nucleic acid aptamer AS2-3 of human thrombin protein to the identification, analysis and detection of human thrombin protein.

[0033] The fourth object of the present invention is to apply the nucleic acid aptamer AS2-3 of human thrombin protein to the anticoagulant activity of thrombin in the coagulation function of thrombin.

[0034] Compared with the prior art, the beneficial effects of the present invention are:

[0035] 1. The nucleic acid aptamer AS2-3 provided by the present invention is non-toxic, has a small molecular weight, and is easy to synthesize and label;

[0036] 2. The synthesis cost of the nucleic acid aptamer AS2-3 provided by the present invention is lower than that of antibody preparation, and has a short cycle and good reproducibility.

[0037] 3. The nucleic acid aptamer AS2-3 provided by the present invention can be "plug and play" as a gene element. After being inserted into the downstream of the promoter, it has little effect on transcription. In addition, it can specifically recognize its target ligand thrombin protein in a complex cell-free transcription and translation system, thereby playing a regulatory role.

[0038] 4. The present invention combines the SELEX screening method with the cell-free transcription process screening, and the obtained human thrombin protein nucleic acid aptamer AS2-3 not only ensures the specific binding with the target ligand, but is also suitable for the regulation at the transcription level of the gene circuit in the cell-free transcription and translation system, providing a new method and idea for screening other target aptamers and ligand combinations for gene circuit regulation, and has broad application prospects and important scientific, social and economic values ​​in the fields of nucleic acid aptamers as gene elements. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The bioinformatics simulation diagram of the spatial structure of the nucleic acid aptamer AS2-3 of the present invention;

[0040] Figure 2 It is a schematic diagram of the screening process of nucleic acid aptamer AS2-3 of the present invention;

[0041] Figure 3 When the nucleic acid aptamer AS2-3 of the present invention is inserted into the downstream of the pJ23151 promoter as a gene element and 3WJdB is used as a reporter gene, the obtained linear DNA responds to the fluorescence reporter output results of different concentrations of human thrombin protein in the cell-free system: Figure (A) shows the change of fluorescence peak value before and after adding different concentrations of human thrombin, Figure (B) shows the real-time fluorescence change, and Figure (C) shows the fluorescence rate change;

[0042] Figure 4When the nucleic acid aptamer AS2-3 of the present invention is inserted into the downstream of the pJ23151 promoter as a gene element and 3WJdB is used as a reporter gene, the obtained plasmid DNA responds to the fluorescence reporter output results of different concentrations of human thrombin protein in the cell-free system: Figure (A) is the result of the control group plasmid DNA without the aptamer inserted, and Figure (B) is the result of the experimental group;

[0043] Figure 5 The CD spectra of the full-length and truncated nucleic acid aptamer AS2-3 of the present invention are shown in Figure (A), wherein Figure (B) is the CD spectrum of the 51mer AS2-3 after truncating 10nt from the 3' end and retaining the N40 part, Figure (C) is the CD spectrum of the full-length 61mer AS2-3, and Figure (D) is the CD spectrum of the control group 29merTBA;

[0044] Figure 6 Schematic diagram of the affinity isothermal titration calorimeter analysis of the nucleic acid aptamer AS2-3 binding to human thrombin protein in the present invention. DETAILED DESCRIPTION

[0045] The present invention will be further described below in conjunction with the accompanying drawings and preferred embodiments. The given embodiments are only for illustrating the present invention, rather than for limiting the scope of the present invention.

[0046] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources;

[0047] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0048] The experimental methods in the following embodiments are conventional methods unless otherwise specified.

[0049] Example 1

[0050] A nucleic acid aptamer AS2-3 for human thrombin protein, wherein the sequence of the nucleic acid aptamer AS2-3 is shown in SEQ ID NO: 1; the 5' end or the 3' end of the nucleic acid aptamer AS2-3 is chemically modified with FITC, amino, biotin or digoxigenin;

[0051] SEQ ID NO: 1:

[0052] TACAGGCAGTAAGGCCGTGTCATCAGGATGGGCACTTTCCTAGGGCAGGTT

[0053] AGCAACAGGA

[0054] The linear DNA for transcription corresponding to the nucleic acid aptamer AS2-3 with the most significant output signal change before adding human thrombin protein was obtained by the screening method of the present invention, and Fuzhou Shangya Biotechnology Co., Ltd. was commissioned to sequence the aptamer sequence shown in SEQ ID NO: 1. The RNAFold network platform was used to analyze the aptamer sequence at 25°C and 100 mM Na + , 1 mM Mg + Under the condition of Figure 1 shown.

[0055] Magnet, a nucleic acid aptamer AS2-3 for human thrombin protein, is a mutant or truncated sequence or extended sequence of the sequence shown in SEQ ID NO: 1; the 5' end or 3' end of the mutant or truncated sequence or extended sequence of the nucleic acid aptamer AS2-3 is chemically modified with FITC, amino, biotin or digoxigenin.

[0056] Example 2

[0057] like Figure 2 As shown, the screening method of the nucleic acid aptamer AS2-3 of the human thrombin protein in Example 1 comprises the following steps:

[0058] (1) Preparation of screening library: The middle fixed region was designed to be 11 nucleotides. This design retained the conservative sequence of the G-tetramer of the existing thrombin aptamer. The random regions at both ends of the fixed part were 40 and 10 nucleotides respectively, and the 5' and 3' fixed primer parts were 19 nucleotides of random ssDNA library (5'-CGCAACCAGGTCTCTAAGC-N40-TAGGGCAGGTT-N10-AATGTGAGACCGGCCTGTG-3', where N40 is 40 random bases and N10 is 10 random bases. There are more than tens of millions of different base sequence combinations of N40 and N10 in the synthesized library). The library was commissioned to be synthesized by Sangon Biotechnology Co., Ltd. and was also synthesized with biotin label;

[0059] (2) Forward screening: Determine the concentration of the synthesized initial ssDNA library and the single-stranded DNA Capture Oligo (CO) labeled with biotin at the 3' end. Use 200 μL of streptavidin magnetic beads (1 mg of magnetic beads can bind >400 pmol of biotin-labeled Capture Oligo DNA) in each round of screening, which can bind approximately 320 pmol of CO. Anneal the ssDNA library and CO in an equimolar ratio in a washing buffer (Washing Buffer: 5 mM Tris-HCl, 1 M NaCl, 0.5 mM EDTA) system; annealing procedure: denaturation at 95°C for 10 min, -0.1°C per second, × 350 times, until 60°C, 5 min, and place at 4°C;

[0060] (3) Take 200 μL of magnetic beads and adsorb them on a magnetic stand to remove the supernatant. Repeat the washing of the magnetic beads three times with 200 μL of Washing Buffer. Incubate the annealed ssDNA Library-CO complex and the magnetic beads on a rotator at 35 rpm / min overnight to allow the ssDNA Library-CO complex to bind to the magnetic beads through the biotin label.

[0061] (4) Collect the supernatant by adsorbing the mixture incubated overnight in step (3) on a magnetic rack, and wash the magnetic bead mixture four times with 200 μL Washing Buffer, collecting the supernatant each time and numbering it;

[0062] (5) Add 100 μL of Binding Buffer (0 mM Tris-HCl, 100 mM NaCl, 1 mM MgCl2) containing 1 μM human thrombin target ligand to the washed ssDNA Library-CO-magnetic bead complex, mix well and place on a rotator at 35 r / min, incubate at 4°C for 60 min, and allow the target ligand to competitively bind to the aptamer sequence with affinity, causing it to fall off the CO-magnetic beads and be adsorbed on a magnetic rack. Collect the supernatant, and then use the above-mentioned equal volume of Binding Buffer containing the same concentration of ligand to elute and retain the supernatant. Repeat twice, numbering elution 1 / 2 / 3 respectively (in the process of positive screening, the concentration of target ligand in the system is continuously reduced to 0.25 μM to increase the screening pressure);

[0063] (6) Wash the magnetic beads with 100 μL SSC Buffer (20 mM Tris-HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, 100 mM NaCl), incubate at 95 °C for 10 min, and release the base complementary pairing between CO and the ssDNA Library that is not bound to the target ligand at high temperature. Repeat 3 times, and collect the supernatant each time and number it HOT1 / 2 / 3;

[0064] (7) RT-qPCR absolute quantitative calculation of elution rate to monitor the screening process. The ssDNA Library used in this round of screening was diluted to 2 ng / μL and used as the amplification template for the standard curve. A gradient dilution of 10 -1 ~10 -7 At the same time, the above-mentioned numbered elution 1 / 2 / 3, HOT1 / 2 / 3 and final magnetic beads were diluted to appropriate concentrations and RT-qPCR amplification was performed simultaneously; R was calculated according to the prepared standard curve 2 The values ​​and amplification efficiency were used to calculate the copy numbers of elution 1 / 2 / 3, HOT1 / 2 / 3 and the final magnetic beads, and then the elution rate was calculated by the formula: {(elution 1+elution 2+elution 3) copy number / (HOT1+HOT2+HOT3+final magnetic beads) copy number}×100%; 20μL amplification system: 10μL 2×SYBR qPCR SuperMix, 2μL each of primers P1 and P2, 1μL DNA template, and DEPC water was used to make up to 20μL; amplification program: 95℃ pre-denaturation for 1min, 95℃ denaturation for 20s, 58℃ annealing for 30s, reading data, 72℃ extension for 30s, and running for 39 cycles; melting curve program: 95℃ for 10s, 65℃→95℃ for 0.5℃ / 0.5s, reading data;

[0065] Among them, the RT-qPCR amplification primers are:

[0066] Primer P1: 5′-CGCAACCAGGTCTCTAAGC-3′;

[0067] Primer P2: 5′-CACAGGCCGGTCTCACATT-3′;

[0068] (8) The eluted 1 / 2 / 3 obtained by target competitive binding in each round of screening were mixed evenly into a 1.5 mL centrifuge tube, 1 / 10 of the volume of the mixed liquid was added with 3 M sodium acetate solution (pH = 5.2), and then 2.5 times the volume of the mixed liquid was added with anhydrous ethanol, all mixed evenly, placed in a -20 ° C refrigerator for 60 min, and then centrifuged in a refrigerated centrifuge at 12000 rpm and 4 ° C for 30 min to precipitate DNA, carefully remove the supernatant with a pipette, and add 19 μL of DEPC water to the centrifuge tube after the ethanol evaporates completely, shake it to completely dissolve the precipitated DNA in water, and amplify it using high-fidelity ExTaq enzyme;

[0069] Among them, the amplification primers were: SE-XP3-F: 5′-CGCAACCAGGTCTCTAAGC-3′ and SE-XP4-5′P: 5′-CACAGGCCGGTCTCACATT-3′;

[0070] The 50μL amplification system is: 19μL DEPC water + ssDNA template, 1μL dNTP Mixture, 25μL 2× Buffer Mix, 2μL each of primers SE-XP3-F and SE-XP4-5'P, 1μL High-Fidelity DNA polymerase; the amplification program is: 95℃ pre-denaturation for 30s, 95℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 10s, running 8-10 cycles, and 72℃ final extension for 5min (note that due to the sequence diversity of the ssDNA library, in order to reduce nonspecific amplification, the number of amplification cycles should be kept at 8-10 cycles);

[0071] (9) The amplified product was precipitated again according to the above method to obtain a 5' phosphorylation-labeled dsDNA library, which was dissolved in an appropriate amount of water and the concentration was measured. The dsDNA was digested with Lambda Exonuclease in a 37°C water bath for 30 min and then ethanol precipitated again to obtain the ssDNA library used for the next round of screening;

[0072] Among them, 50 μL enzyme digestion system includes: 5 μg dsDNA, 5 μL 10×Exonuclease Reaction Buffer, 1 μL Lambda Exonuclease, and DEPC water is used to make up to 50 μL;

[0073] (10) Negative screening: The ssDNA library enriched after 8 rounds of positive screening was used as the initial library for negative screening. The difference in the screening process was that the ssDNA Library-CO-magnetic bead complex was incubated in the Cell-free system at room temperature for 60 min before adding the target ligand to remove non-specific sequences bound to the Cell-free system, and then the system was replaced with Binding Buffer and the magnetic beads were washed;

[0074] (11) Screening was performed during the gene circuit transcription process of the cell-free transcription-translation system; first, the ssDNA library after 12 rounds of preliminary screening was amplified into dsDNA with the correct restriction sites and recognition sites, and then the library sequence was inserted into a vector fragment containing the backbone, promoter pJ23151, 3WJdB and terminator through the GoldenGate Assembly method to construct a complete circular ligation product, and the ligation product was divided into 10 groups of transformation cloning bacteria E. coli DH5α competent cells.

[0075] (12) A total of 1000 single colonies were picked from 10 successfully transformed plates for Colony PCR. Agarose gel electrophoresis showed that the connection was successful and that 832 complete linear DNAs for transcription with the promoter pJ23151, dsDNA aptamer sequence, output signal 3WJdB and terminator could be amplified. The linear DNAs for transcription were recovered and the corresponding single colonies were saved.

[0076] (13) A cell-free transcription-translation system was prepared. In the presence or absence of target ligands, 832 linear DNAs with inserted aptamer sequences were screened during the transcription process, and the difference in fluorescence change of the output signal 3WJdB before and after the addition of human thrombin protein was observed.

[0077] Example 3

[0078] The regulatory role of nucleic acid aptamer AS2-3 as a gene element, and the robustness of the regulatory role of nucleic acid aptamer AS2-3 as a gene element were verified;

[0079] The RNA aptamer 3WJdB was used as the reporter output. After successful transcription, it specifically combined with the small molecule DFHBI to emit fluorescence, thereby characterizing the regulatory effect of the nucleic acid aptamer AS2-3 as a gene element. The linear DNA for transcription was obtained by purifying the product after colony PCR in Example 1:

[0080] pJ23151-AS2-3-3WJdB-T500, add the linear DNA for transcription into the TX-TL reaction system with a final concentration of 50 nM, and the concentrations of human thrombin protein are 0, 0.5, and 1 μM, respectively. React at 29°C for 4 h, and use a multifunctional microplate reader to monitor the fluorescence at 472 nm of excitation light and 507 nm of emission light in real time to characterize the transcription efficiency;

[0081] like Figure 3 The linear DNA for transcription corresponding to the nucleic acid aptamer AS2-3 shown in the figure can respond to the addition of the target ligand human thrombin during the transcription process, and the fluorescence peak is significantly reduced. The real-time fluorescence and fluorescence rate of the experimental group with the addition of human thrombin protein are always lower than those of the control group without the addition, and this inhibitory effect is more obvious when the ligand concentration is increased. The insertion of nucleic acid aptamer AS2-3 as a gene element in the gene circuit did not affect the downstream transcription compared with the control group, indicating that its sequence structure is relatively loose, and transcription will be significantly inhibited only when the thrombin ligand is present. This may be because thrombin binds to the loose aptamer sequence to make its structure more compact, making it difficult for RNA polymerase to proceed downstream, thereby showing inhibitory regulation of the transcription process;

[0082] The preserved bacterial strain corresponding to the nucleic acid aptamer AS2-3 in Example 1 was selected, and the plasmid was extracted by shaking overnight culture to obtain a stable transcription plasmid DNA: V-pJ23151-AS2-3-3WJdB-T500 and a control group plasmid DNA: V-pJ23151-3WJdB-T500. The transcription plasmid DNA was added to the TX-TL reaction system at a final concentration of 30 nM, and the concentrations of human thrombin protein were 0, 0.5, and 1 μM, respectively. The reaction was carried out at 29° C. for 6 h, and the fluorescence at the excitation light of 472 nm and the emission light of 507 nm was monitored in real time by a multifunctional microplate reader to characterize the transcription efficiency;

[0083] like Figure 4 The results show that the transcription efficiency in the experimental group system where the nucleic acid aptamer AS2-3 is located is reduced to varying degrees in the presence of human thrombin protein, while there is no significant effect on the fluorescence of the control group in which the aptamer sequence is not inserted downstream of the promoter, further indicating that the human thrombin protein can specifically recognize the aptamer sequence in the transcription plasmid DNA to regulate the transcription efficiency of the downstream gene, and this inhibitory effect is significant with the increase of the ligand concentration in the system.

[0084] Example 4

[0085] The circular dichroism characterization of nucleic acid aptamer AS2-3 and target ligand human thrombin protein and the affinity characterization of nucleic acid aptamer AS2-3 and target ligand human thrombin protein were performed respectively;

[0086] The specific operation of circular dichroism characterization of nucleic acid aptamer AS2-3 and target ligand human thrombin protein is as follows:

[0087] (1) 1×Binding Buffer was used to prepare 0.5 μM human thrombin, 5 μM aptamer AS2-3 ssDNA and a mixture of the two with the same concentration, with a total volume of 200 μL. The groups containing ssDNA were incubated at 95°C for 10 min before adding ligands, and then immediately placed on ice to denature ssDNA and reduce its secondary structure. The target ligand was added and incubated for 1 h before scanning. The circular dichroism spectrometer parameters were set as follows: nitrogen flow rate 4-5 L / min, scanning wavelength 220 nm-320 nm, scanning speed 50 nm / min, bandwidth 1 nm, and the data of 3 accumulated scans were averaged.

[0088] (2) the nucleic acid aptamer AS2-3 was truncated to retain the 40mer of the N40 portion, the 51mer of the N40 and DS sequence portions, and the 61mer of the full-length aptamer sequence; Figure 5 As shown in the figure, the CD spectrum shows that the nucleic acid aptamer AS2-3 has a maximum peak at about 260-270nm and a minimum peak at about 245nm, while the CD spectrum of the existing 29mer TBA shows a typical G-tetramer structure, with two maximum peaks at 260 / 295nm and a minimum peak at 245nm. The signal at 220-240nm changes after adding 0.5μM human thrombin protein ( Figure 5 D), indicating that the existing 29mer TBA can bind to the ligand;

[0089] (3) When the N40 part of the nucleic acid aptamer AS2-3 was retained, there was no significant difference in the signal after adding the ligand ( Figure 5 A), after adding 0.5 μM human thrombin protein, the signal of the full-length 61mer aptamer AS2-3 changed significantly at 220-240 nm and at the peak of 245 nm ( Figure 5 C), indicating that the 61merAS2-3 aptamer sequence can bind to the ligand and that its main binding site is located near the 3' end of the sequence;

[0090] Therefore, the CD spectroscopy data once again showed that the candidate aptamers screened by the study can not only bind to specific ligands, but also play a regulatory role in the transcription process.

[0091] In addition, the affinity of nucleic acid aptamer AS2-3 to the target ligand human thrombin protein was characterized as follows: the ITC experiment of human thrombin binding nucleic acid aptamer was performed using Nano ITC isothermal titration calorimeter of Waters Company. At 25°C, in each group of experiments, 1500 μL of 1 μM nucleic acid aptamer candidate was heated at 95°C for 10 min in 1×Binding Buffer and immediately cooled on ice. 100 μL of 1×Binding Buffer containing 10 μM human thrombin was loaded into the syringe; each injection titration was performed with a volume of 2 μL, 25 consecutive injections, 300 s intervals, and a rotation speed of 300 rpm; the data collected in the ITC experiment was analyzed using LaunchNanoAnalyze software, and the independent model was applied for data fitting as shown in Figure 2. Figure 6 As shown, its Kd = 3.356 μM.

[0092] The fourth object of the present invention is to apply the nucleic acid aptamer AS2-3 of human thrombin protein to the anticoagulant activity of thrombin in the coagulation function of thrombin.

[0093] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A nucleic acid aptamer AS2-3 for human thrombin protein, characterized in that: The sequence of the nucleic acid aptamer AS2-3 is shown in SEQ ID NO:

1.

2. The nucleic acid aptamer AS2-3 of human thrombin protein according to claim 1, characterized in that: The 5' end or 3' end of the nucleic acid aptamer AS2-3 is chemically modified with FITC, amino, biotin or digoxigenin.

3. A method for screening the nucleic acid aptamer AS2-3 of human thrombin protein as claimed in claim 1, characterized in that: The in vitro SELEX screening method based on nucleic acid aptamers is combined with the cell-free transcription process screening, including the following steps: (1) Preparation of screening library: Prepare a random ssDNA library shown in the following sequence: 5'-CGCAACCAGGTCTCTAAGC-N40-TAGGGCAGGGTT-N10-AATGTGAGA CCGGCCTGTG-3' (2) Perform positive screening: Complementary pairing of the ssDNA library with the single-stranded DNA Capture Oligo labeled with biotin at the 3' end to form partial double-stranded DNA; (3) Incubating the partial double-stranded DNA obtained in step (2) with streptavidin magnetic beads overnight, so that the ssDNA library is fixed on the streptavidin magnetic beads using DNA Capture Oligo as a medium, and washing away the ssDNA sequences that have not been fixed; (4) incubating the magnetic bead-CO-ssDNA Library complex obtained in step (3) with the target ligand human thrombin protein to compete for binding with the ssDNA aptamer sequence with specific affinity; (5) magnetically separating the incubation mixture after step (4), collecting the eluted ssDNA aptamer sequence that specifically binds to the human thrombin protein, i.e., the ssDNA enriched library, and continuously reducing the concentration of the target ligand in the subsequent screening process to increase the screening pressure; (6) PCR amplification: The ssDNA enriched library obtained in step (5) is subjected to PCR amplification, wherein the primers used for PCR amplification are: Primer P1: 5′-CGCAACCAGGTCTCTAAGC-3′; Primer P2: 5′-CACAGGCCGGTCTCACATT-3′; (7) Obtaining and purifying the ssDNA library: The enriched phosphorylation-labeled dsDNA library obtained by amplification in step (6) is digested with Lambda Exonuclease in a 37°C water bath for 30 min to obtain a ssDNA library, and after ethanol precipitation, a secondary ssDNA library for the next round of screening is obtained; (8) Cyclic screening: The secondary ssDNA library obtained in step (7) is used as the secondary library for the next round of screening, and the screening process of (2) to (7) is repeated to complete the forward screening; (9) Negative screening: The ssDNA library that has completed the last positive screening is used as the initial library for negative screening, and the above steps (2) and (3) are performed. Before adding the target ligand for incubation, the magnetic bead-CO-ssDNA Library complex is incubated in the cell-free transcription and translation system for 60 min, and the non-specific sequences bound to the cell-free transcription and translation system are washed away by magnetic separation, and then the above screening steps (4) to (7) are repeated; (10) After completing positive and negative screening, cell-free transcription process screening is performed.

4. The method for screening a nucleic acid aptamer AS2-3 for human thrombin protein according to claim 3, characterized in that: The steps of the cell-free transcription process screening in step (10) are as follows:

101. Amplify the ssDNA library after the positive and negative screening into a dsDNA library by PCR, and connect the vector carrying the promoter, output signal and terminator to the dsDNA library using the GoldenGate Assembly method; 102. The ligation product with the dsDNA library inserted in step 101 is transformed, coated, picked, colony PCR and verified by gel electrophoresis, and the correct insertion band is selected. The PCR product is recovered and the corresponding linear DNA product after colony PCR is numbered; 103. All the recovered linear DNAs containing promoter, aptamer sequence, output signal and terminator are transcribed in a cell-free transcription and translation system with or without target ligand human thrombin protein, and the changes in the output signal are observed to select the aptamer sequence that can respond to the target ligand and affect the transcription of downstream genes.

5. Use of the nucleic acid aptamer AS2-3 of human thrombin protein as claimed in claim 1 in non-disease diagnosis and treatment for identifying, analyzing and detecting human thrombin protein.

Images