ACE inhibiting peptide, screening method and application thereof
By extracting and screening ACE inhibitory peptides with amino acid sequences of HIIARPH, LRLKE, SFR, or REVDKPF from Spirulina, the problems of insufficient activity and high identification cost of ACE inhibitory peptides in existing technologies have been solved, realizing efficient and low-cost screening of ACE inhibitory peptides and their application in skin care products.
Patent Information
- Application Number
- CN202211480206.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-24
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2042-11-24
AI Technical Summary
There are few ACE-inhibiting peptides with good ACE-inhibiting activity in the existing technology, and the existing methods for identifying active peptides are time-consuming and costly, making it difficult to separate high-purity and highly active peptides from complex mixtures.
Spirulina was used as raw material. Proteins were extracted by high-pressure homogenization and freeze-thaw process. After alkaline protease digestion and LC-MS/MS identification, ACE inhibitory peptides with amino acid sequences of HIIARPH, LRLKE, SFR or REVDKPF were screened. Amino acid modification was performed, and peptides with high ACE inhibitory activity were screened by molecular docking and computational chemistry analysis.
It has achieved efficient and low-cost screening of peptides with good ACE inhibitory activity, which can be applied to skin care products to have effects such as skin barrier repair and protection and improvement of dark circles, showing significant cell repair and protection capabilities and the effect of removing eye bags.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_4
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioactive peptide technology, and in particular to an ACE inhibitory peptide, its screening method, and its application. Background Technology
[0002] Bioactive peptides are a collective term for peptides composed of 2 to 20 natural amino acids from proteins, arranged in different compositions and configurations. They are multifunctional compounds derived from proteins and are closely related to human life activities. Bioactive peptides derived from food proteins are a hot topic in modern applied science and food science research and a functional factor with great development potential.
[0003] Spirulina is one of the most nutritionally rich and comprehensive organisms in nature, abundant in high-quality protein, polysaccharides, carotenoids, and unsaturated fatty acids such as gamma-linolenic acid. The protein in spirulina contains 18 amino acids, accounting for 60%–70% of its composition, making it a potentially valuable resource for obtaining natural bioactive peptides. Studies have shown that ACE is associated with UVB damage to the skin, skin barrier problems, and scar formation; however, currently, there are few ACE-inhibiting peptides with good ACE-inhibiting activity. Therefore, there is a need to provide a new ACE-inhibiting peptide with good ACE-inhibiting activity. Summary of the Invention
[0004] This invention aims to at least solve one of the technical problems existing in the prior art. To this end, this invention proposes an ACE-inhibiting peptide with excellent ACE-inhibiting activity.
[0005] The present invention also provides a derivative of an ACE-inhibiting peptide.
[0006] The present invention also provides a biomaterial.
[0007] The present invention also provides the use of the above-mentioned ACE inhibitory peptides, preparations or derivatives.
[0008] The present invention also provides a product.
[0009] The present invention also provides a method for screening the above-mentioned ACE inhibitory peptides.
[0010] According to the first aspect of the present invention, the ACE inhibitory peptide or its cosmetically or pharmaceutically acceptable salt thereof has the amino acid sequence HIIARPH, LRLKE, SFR or REVDKPF.
[0011] The ACE-inhibiting peptide according to embodiments of the present invention has at least the following beneficial effects:
[0012] The ACE-inhibiting peptide in this embodiment has excellent ACE-inhibiting activity, good cell repair and protection capabilities, and the ability to remove eye bags. It can be applied to skin care products that have the effects of skin barrier repair and protection, and improving dark circles.
[0013] According to some embodiments of the present invention, the ACE inhibitory peptide can be synthesized by any one of methods a, b, c, and d:
[0014] a) Synthesized via liquid-phase synthesis;
[0015] b) Synthesized by solid-state synthesis;
[0016] c) Obtained by culturing recombinant microorganisms or transgenic cells capable of encoding and expressing the ACE repressor peptide;
[0017] d) Extracted from spirulina.
[0018] According to a second aspect of the present invention, a derivative of an ACE inhibitory peptide or a cosmetically or pharmaceutically acceptable salt thereof comprises a derivative of an ACE inhibitory peptide that has been modified with amino acids and has the same function.
[0019] The amino acid modification includes at least one of hydroxylation, carboxylation, carbonylation, acetylation, methylation, phosphorylation, glycosylation, and esterification.
[0020] According to some embodiments of the present invention, the sites for amino acid modification include at least one of amino acid side chain groups, the amino terminus of ACE inhibitory peptides, and the carboxyl terminus of ACE inhibitory peptides.
[0021] A biomaterial related to the above-described ACE inhibitory peptide or its derivative according to a third aspect of the present invention comprises any one of A1 to A6:
[0022] A1: A nucleic acid molecule encoding the ACE inhibitory peptide of the first aspect of the present invention or a derivative of the second aspect of the present invention;
[0023] A2: An expression cassette containing the nucleic acid molecules described in A1;
[0024] A3: A recombinant vector containing the nucleic acid molecules described in A1;
[0025] A4: A recombinant vector containing the expression cassette described in A2;
[0026] A5: Recombinant microorganisms containing any one of A1 to A4;
[0027] A6: Transgenic cells containing any one of A1 to A4.
[0028] According to some embodiments of the present invention, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.
[0029] According to some embodiments of the present invention, the transgenic cells do not contain reproductive material. Reproductive material includes, but is not limited to, embryonic stem cells, germ cells, and fertilized eggs.
[0030] The use of the ACE inhibitory peptide of the first aspect of the present invention, or a derivative of the second aspect of the present invention, or a biomaterial of the third aspect of the present invention, in the preparation of a product having at least one function of B1 to B5, according to the fourth aspect of the present invention:
[0031] B1: Inhibits ACE activity;
[0032] B2: Reduces oxidative damage;
[0033] B3: Reduces damage from medium-wave ultraviolet radiation;
[0034] B4: Reduces the volume of eye bags;
[0035] B5: Reduces transepidermal water loss from the skin.
[0036] According to some embodiments of the present invention, B2 specifically refers to reducing oxidative damage to cells.
[0037] According to some embodiments of the present invention, B3 specifically refers to reducing mid-wave ultraviolet damage to cells.
[0038] A product according to a fourth aspect of the present invention includes at least one of C1 to C3;
[0039] C1: At least one of the following: a polypeptide with the amino acid sequence HIIARPH, LRLKE, SFR, REVDKPF or a cosmetically or pharmaceutically acceptable salt thereof;
[0040] C2: A derivative of the second aspect of the present invention or a cosmetically or pharmaceutically acceptable salt thereof;
[0041] C3: The biomaterial of the third aspect of this invention. Since the product employs all the technical solutions of the ACE inhibitory peptides described in the above embodiments, it possesses at least all the beneficial effects brought about by the technical solutions of the above embodiments.
[0042] According to some embodiments of the present invention, the product has at least one of the functions B1 to B5:
[0043] B1: Inhibits ACE activity;
[0044] B2: Reduces oxidative damage;
[0045] B3: Reduces damage from medium-wave ultraviolet radiation;
[0046] B4: Reduces the volume of eye bags;
[0047] B5: Reduces transepidermal water loss from the skin.
[0048] According to some embodiments of the present invention, B2 specifically refers to reducing oxidative damage to cells.
[0049] According to some embodiments of the present invention, B3 specifically refers to reducing mid-wave ultraviolet damage to cells.
[0050] According to some embodiments of the present invention, the product further includes a polypeptide with the amino acid sequence IER or a cosmetically or pharmaceutically acceptable salt thereof; or any one of D1 to D6 biological materials;
[0051] D1: A nucleic acid molecule encoding a polypeptide with the amino acid sequence IER;
[0052] D2: An expression cassette containing the nucleic acid molecules described in D1;
[0053] D3: A recombinant vector containing the nucleic acid molecules described in D1;
[0054] D4: A recombinant vector containing the expression cassette described in D2;
[0055] D5: Recombinant microorganisms containing any one of D1 to D4;
[0056] D6: Transgenic cells containing any one of D1 to D4.
[0057] According to some embodiments of the present invention, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.
[0058] According to some embodiments of the present invention, the transgenic cells do not contain reproductive material. Reproductive material includes, but is not limited to, embryonic stem cells, germ cells, and fertilized eggs.
[0059] According to some embodiments of the present invention, the product is a cosmetic or a pharmaceutical.
[0060] According to some embodiments of the present invention, the product further includes excipients acceptable for cosmetics or pharmaceuticals.
[0061] According to some embodiments of the present invention, the product is a cosmetic, and the ACE inhibitory peptide in the product comprises 1% to 5% by mass, preferably 2%.
[0062] According to some embodiments of the present invention, the product comprises a polypeptide with the amino acid sequence HIIARPH, LRLKE. There is a significant synergistic effect between the two. The CI index is 0.562.
[0063] According to some embodiments of the present invention, the product comprises a polypeptide with the amino acid sequences LRLKE and REVDKPF. There is a good synergistic effect between the two. The CI index is 0.619.
[0064] A method for screening ACE inhibitory peptides according to a fifth aspect of the present invention includes the following steps:
[0065] S1: Extracting algal proteins from algae;
[0066] S2: The algal protein is enzymatically hydrolyzed to obtain an enzymatically hydrolyzed peptide solution;
[0067] S3: Identify and analyze the polypeptides in the enzymatically hydrolyzed peptide solution.
[0068] The screening method according to embodiments of the present invention has at least the following beneficial effects:
[0069] The screening method described in this embodiment is technically stable and reliable, highly feasible, simple to operate, quick, and low in cost, and can be used for screening a large number of active peptides.
[0070] In related technologies, the identification of bioactive peptides requires continuous separation and purification from hydrolysis products, which is time-consuming and costly, and it is difficult to isolate high-purity, highly active peptides from complex mixtures. This study uses proteolytic enzymes and peptidomics technology to obtain peptides and their sequences from spirulina protein sources, and combines molecular docking and computational chemistry analysis to screen for peptides with high ACE inhibitory activity, simplifying the bioactive peptide identification process.
[0071] According to some embodiments of the present invention, in step S1, the algae includes at least one of Spirulina, Elodea, and Red Algae. Spirulina is preferred.
[0072] According to some embodiments of the present invention, in step S1, the algal protein is extracted by homogenization and freeze-thaw extraction.
[0073] According to some embodiments of the present invention, the homogenization pressure is 800 bar to 1000 bar.
[0074] According to some embodiments of the present invention, the number of freeze-thaw cycles is 2 to 4.
[0075] According to some embodiments of the present invention, the ratio of spirulina to water is 1:8 to 12, preferably 1:10.
[0076] According to some embodiments of the present invention, in step S2, the enzyme used for enzymatic hydrolysis includes at least one selected from neutral protease, alkaline protease, bromelain, and papain. Alkaline protease is preferred.
[0077] According to some embodiments of the present invention, the nucleotide sequence encoding the alkaline protease is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0078] According to some embodiments of the present invention, in the enzymatic hydrolysis, the amount of alkaline protease used is 0.8 kU to 1.2 kU / g algal protein. Preferably, it is 1 kU / g algal protein.
[0079] According to some embodiments of the present invention, the enzymatic hydrolysis temperature is 50°C to 60°C, preferably 55°C.
[0080] According to some embodiments of the present invention, the pH conditions for enzymatic hydrolysis are 8 to 9, preferably 8.5.
[0081] According to some embodiments of the present invention, the enzymatic hydrolysis time is 2 h to 4 h, preferably 3 h.
[0082] According to some embodiments of the present invention, step S2 further requires enzyme inactivation treatment after enzymatic hydrolysis.
[0083] According to some embodiments of the present invention, in step S3, the identification is performed by LC-MS / MS.
[0084] According to some embodiments of the present invention, in step S3, the analysis includes at least one of relative abundance analysis, confidence analysis combined with identification results, toxicity analysis, binding energy analysis with ACE, frontier orbital energy level difference analysis, and ACE inhibitory activity analysis.
[0085] According to some embodiments of the present invention, the analysis of the identification results of the LC-MS / MS is performed using the software Byonic.
[0086] According to some embodiments of the present invention, the relative abundance analysis includes: screening peptides that meet the desired relative abundance.
[0087] According to some embodiments of the present invention, the credibility analysis based on the identification results includes: screening peptides that meet the expected peptide scores.
[0088] According to some embodiments of the present invention, the identification method is LC-MS / MS, and the desired peptide score is: the peptide score of the polypeptide is greater than 100.
[0089] According to some embodiments of the present invention, the toxicity analysis includes: performing toxicity analysis using the peptide toxicity prediction software ToxinPred (http: / / crdd.osdd.net / raghava / toxinpred / ) to screen for non-toxic peptides.
[0090] According to some embodiments of the present invention, the binding energy analysis with ACE includes: docking the peptide with the receptor protein using the software AutodockVina, calculating the binding energy, and screening peptides that meet the desired binding energy. Binding energy is the primary screening criterion; the lower the binding energy, the more stable the binding between the peptide and the enzyme.
[0091] According to some embodiments of the present invention, the desired binding energy is: the binding energy of the polypeptide is <-8.0 kcal / mol.
[0092] According to some embodiments of the present invention, the frontier orbital energy level difference analysis includes: using the ab initio DFT method, selecting 6-31G(d) basis sets to calculate the frontier orbital energy level difference, and screening peptides that meet the desired frontier orbital energy level difference. The frontier orbital energy level difference = highest occupied orbital energy - lowest unoccupied orbital energy.
[0093] According to some embodiments of the present invention, the desired frontier orbital energy level difference is: the frontier orbital energy level difference of the polypeptide is >0.18465 au.
[0094] According to some embodiments of the present invention, ACE inhibitory activity analysis includes testing the ACE inhibitory activity of peptides and screening peptides that meet the desired ACE inhibitory activity. The testing method is ethyl acetate extraction.
[0095] According to some embodiments of the present invention, the desired ACE inhibitory activity is: the peptide's IC50 value for inhibiting ACE activity. 50 <1000 μM.
[0096] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description
[0097] Figure 1 This is the repair result of UVB-damaged cells by the ACE inhibitory peptide in Test Example 2 of this invention. In this example, 1 refers to the peptide 1 treatment group, 2 refers to the peptide 2 treatment group, 3 refers to the peptide 3 treatment group, and 4 refers to the peptide 4 treatment group; ** indicates that compared with the model group, p < 0.01; ## indicates that compared with the positive control group, p < 0.01.
[0098] Figure 2 This is the repair result of H2O2-damaged cells by the ACE inhibitory peptide in Test Example 2 of this invention. Here, 1 refers to the peptide 1 treatment group, 2 refers to the peptide 2 treatment group, 3 refers to the peptide 3 treatment group, and 4 refers to the peptide 4 treatment group; ** indicates comparison with the model group (p<0.01); ## indicates comparison with the positive control group (p<0.01).
[0099] Figure 3 This is the result of the reduction rate of eye bag volume in Test Example 4 of this invention; ** indicates that compared with the blank group, p<0.01;
[0100] Figure 4 This is the result of skin transdermal water loss in test example 4 of this invention; ** indicates that compared with the blank group, p<0.01; Detailed Implementation
[0101] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0102] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0103] In the description of this invention, it should be understood that the orientation descriptions, such as up, down, etc., are based on the orientation or positional relationship shown in the accompanying drawings. They are only for the convenience of describing this invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limiting this invention.
[0104] In the description of this invention, the terms “comprising” and “having”, and any variations thereof, are intended to cover non-exclusive inclusion, for example, a process, method, system, product, or device that includes a series of steps or units is not necessarily limited to those steps or units that are explicitly listed, but may include other steps or units that are not explicitly listed or that are inherent to such process, method, product, or device.
[0105] Unless otherwise specified, "about" in this invention means that the allowable error is within ±2%.
[0106] The culture medium formulation used in the following examples is as follows:
[0107] (1) YPD medium: glucose 20 g / L, peptone 20 g / L, 1% glycerol (V / V), YNB 13.4 g / L, biotin 0.004 g / L.
[0108] (2) MD solid medium: glucose 20 g / L, agarose 20 g / L, YNB 13.4 g / L, biotin 0.004 g / L.
[0109] (3) BMGY medium: yeast extract 10 g / L, peptone 20 g / L, 1% glycerol, YNB 13.4 g / L, biological 0.004 g / L.
[0110] (4) BMMY medium: yeast extract 10 g / L, peptone 20 g / L, YNB 13.4 g / L, biotin 0.004 g / L, 0.5% methanol (V / V).
[0111] (5) Complete culture medium: DMEM high glucose medium containing 10% FBS and 1% penicillin-streptomycin double antibiotics.
[0112] The alkaline protease used in the following examples was obtained as follows:
[0113] S1. Obtain the alkaline protease gene sequence.
[0114] (1) Refer to the NCBI database Bacillus amyloliquefaciens strain A pair of primers was designed based on the SP1 genome sequence (GeneBank: KP259872) targeting the alkaline protease gene lap. The nucleotide sequences of the primers are as follows:
[0115] Forward primer PF: 5'- TGCTCTAGA ATGAGAGGCAAAAAGGTATGG -3', the underlined part is the Xbal restriction site;
[0116] Reverse primer PR: 3'- CCCAAGCTT CTGAGCTGCCGCC, the underlined part is the HindIII restriction site.
[0117] Based on homologous cloning, Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens The gene sequence of the alkaline protease of LXZ is shown in SEQ ID NO.1.
[0118] 5'- ATGAGAGGCAAAAAGGTATGG GGCGGCAGCTCAG -3' (SEQ ID NO.1).
[0119] Genomic DNA of Bacillus amyloliquefaciens was extracted using the phenol-chloroform method. The genomic DNA was then amplified by PCR using primer pair PF / PR to obtain the alkaline protease gene lap. The PCR product was then purified using the SanPrep column PCR product purification kit (provided by Shanghai Sangon Biotech) to obtain the purified PCR product.
[0120] The PCR amplification procedure is as follows:
[0121] 94℃ 5 min; 94℃ 1 min, 54℃ 1 min, 72℃ 2 min 30 seconds, 30 cycles; 72℃ 5min; 4℃.
[0122] (2) pET30ax and the purified PCR product were double-digested with restriction endonucleases Xbal and HindIII, respectively, at 37℃ for 3 h. The double-digested products of the expression vector and the double-digested products of the purified PCR product were then recovered by 1% agarose gel electrophoresis.
[0123] (3) The two double-digested products recovered in step (2) were ligated at 22°C for 6 hours using T4 DNA ligase to obtain ligation products. The ligation products were transformed into BL21 competent cells, plated on LB plates (containing kanamycin sulfate), and allowed to grow overnight. Clones were then picked. The clones were identified and sequenced using colony PCR with primer pair PF / PR. The clones that were correctly identified by sequencing were cultured and preserved.
[0124] S2. Construct a Pichia pastoris engineered strain capable of expressing the alkaline protease gene lap.
[0125] (1) The alkaline protease gene lap obtained in step S1 was codon optimized and Shanghai Sangon Biotech Co., Ltd. was commissioned to synthesize the gene. The optimized nucleotide sequence is shown in SEQ ID NO.2. The synthesized gene sequence was digested with enzymes and inserted into the pPIC9 plasmid to obtain the recombinant plasmid pPIC9-lap.
[0126]
[0127] (2) The pPIC9-lap plasmid was linearized using the restriction endonuclease SacI, digested at 37°C for 3 h, and then the digested product was recovered by 1% agarose gel electrophoresis.
[0128] (3) The purified and recovered enzyme digestion products were transferred into Pichia pastoris GS115 competent cells by electroporation. The electroporated bacterial culture was then plated on MD plates and incubated at 30°C for 2 days. Ten single clones were picked from the MD plates, their genomes were extracted, and the clones were identified by colony PCR using primer pair PF / PR. The positively identified strain was named GS115-lap.
[0129] S3, heterologous expression and purification of alkaline protease lap
[0130] (1) Heterologous expression of alkaline protease lap.
[0131] The GS115-lap obtained in step S2 was inoculated into BMGY medium and cultured at 30℃ and 200 rpm for 48 h. Then, the bacterial culture was centrifuged at 4℃ and 4000 rpm for 5 min, the supernatant was discarded, and the bacterial culture was resuspended in BMMY medium for continuous induction for 48 h. Methanol was added every 24 h to a concentration of 1.0%.
[0132] (2) Purification of alkaline protease lap.
[0133] The fermentation broth obtained in step (1) was centrifuged at 4℃ and 10,000 rpm for 10 min, and the supernatant was collected to obtain the crude alkaline protease solution. A 10 kDa ultrafiltration membrane was used to concentrate the crude enzyme solution. The concentrated crude enzyme solution was purified using a Ni-NTA pre-packed gravity column (provided by Shanghai Sangon Biotech) according to the instructions to obtain the eluent. The eluent was dialyzed (cutoff: 10 kDa) to remove imidazole, and the purity and molecular weight of the protein were verified using SDS-PAGE.
[0134] (3) Identification of the activity of alkaline protease lap.
[0135] The Folin-Ciocalteu method was used to determine protease activity. The determination conditions followed the People's Republic of China National Standard GB / T 23527-2009 "Protein Preparations" for alkaline protease activity. All reactions were performed in triplicate.
[0136] The purified protease had an activity of 2198±32.5 U / mg.
[0137] The definition of an alkaline protease activity unit is: 1 mg of enzyme hydrolyzing casein to produce 1 μg of tyrosine within 1 min at 40℃ and pH 10.5 is defined as 1 enzyme activity unit, expressed as U / mg.
[0138] Example 1
[0139] This embodiment provides a method for screening angiotensin-converting enzyme (ACE) inhibitory peptides, the steps of which are as follows:
[0140] S1. Extraction of Spirulina-derived Protein
[0141] A combination of high-pressure homogenization and repeated freeze-thaw cycles was used. Spirulina powder (purchased from Shanghai Guangyu Biotechnology Co., Ltd.) was suspended in water (solid-to-liquid ratio 10 g: 100 mL), and homogenized at 800 bar for 5 cycles, each cycle lasting 3 minutes. Then, the mixture was subjected to 3 freeze-thaw cycles, centrifuged at 8000–10000 rpm for 20 minutes, and the precipitate was removed to obtain a spirulina-derived protein solution. The spirulina-derived protein solution was then freeze-dried under vacuum to obtain a powder, which was then used for later use.
[0142] S2, protein hydrolysis
[0143] Weigh 1g of the spirulina protein obtained in step S1 and dissolve it in 10mL of PBS buffer (pH=8.5). Add alkaline protease solution (1 kU), hydrolyze at 55℃ for 3 h, inactivate by heating after enzymatic hydrolysis, and collect the supernatant after centrifugation.
[0144] S3, LC-MS / MS detection and peptide database retrieval
[0145] The supernatant obtained in step S2 was sent to Beijing Baitaipaike Biotechnology Co., Ltd. for analysis using liquid chromatography-mass spectrometry (LC-MS / MS). The raw file of the mass spectrometry results was obtained, and the identification results were obtained through analysis using Byonic software. The LC-MS / MS detection conditions are as follows:
[0146] (1) Capillary liquid chromatography conditions 8000
[0147] Analytical column: 150 μm id × 150 mm, packed with Acclaim PepMap RPLC C18, 1.9 μm, 100 Å
[0148] Mobile phase A: 0.1% formic acid;
[0149] Mobile phase B: 0.1% formic acid, 80% ACN;
[0150] Flow rate: 600 nL / min;
[0151] The mobile phase gradient elution parameters were: 0 min 4%B, 2 min 8%B, 45 min 28%B, 55 min 40%B, 56 min 95%B, and 66 min 95%B.
[0152] (2) Mass spectrometry conditions
[0153] Primary mass spectrometry parameters: Resolution: 70,000, AGC target: 3e6, Maximum IT: 50 ms, Scan range: 300 to 1800 m / z;
[0154] Secondary mass spectrometry parameters: Resolution: 17,500, AGC target: 1e5, Maximum IT: 100ms, TopN: 20, NCE / steppedNCE: 28.
[0155] More than 800 peptides were identified. The peptides were ranked according to their relative abundance (intensity), and the top 20 peptides are shown in Table 1.
[0156] Table 1
[0157]
[0158] Among them, intensity represents the content of the peptide in the total peptide; the higher the intensity, the higher the relative content. The larger the peptide score, the more reliable the matching result is. Generally, a score greater than 100 is considered reliable. The closer the actual molecular weight (Observed m / z) is to the theoretical molecular weight, the better. That is, the closer the absolute value of the molecular weight error (Mass error) is to 0, the more reliable it is.
[0159] S4. Screening of peptides
[0160] Taking into account factors such as relative abundance and peptide score (>100), 10 peptides were initially screened, and their toxicity was predicted using the peptide toxicity prediction software ToxinPred (http: / / crdd.osdd.net / raghava / toxinpred / ). The results are shown in Table 2.
[0161] In quantum chemical calculations, frontier orbital correlation coefficients are often used to characterize the antioxidant activity of molecules. The highest occupied orbital energy (EHOMO) characterizes a molecule's electron-donating ability; a larger EHOMO indicates a stronger electron-donating ability. The lowest empty orbital energy (ELUMO) characterizes its electron-accepting ability; a smaller ELUMO indicates a stronger electron-accepting ability. The frontier orbital energy level difference ΔE (ΔE = EHOMO - ELUMO) characterizes the energy required for a molecule to transition from its ground state to an excited state; a smaller energy level difference, i.e., a smaller ΔE, indicates a more efficient electron transition, meaning a more reactive molecule. A higher absolute value of the binding free energy (Affinity) indicates better binding between the acceptor and ligand, i.e., higher potential inhibition.
[0162] The 3D structure of the peptide was constructed using ChemOffice 2017 software, and the initial structure of the peptide was optimized using molecular mechanics (MM2) to minimize its energy. The semi-empirical algorithm AM1 in Gaussian 09 was then used for preliminary optimization of the peptide geometry. Ab initio DFT calculations were performed, selecting a 6-31G(d) basis set to calculate the frontier orbital parameters of the chosen peptide. The optimized molecular structure was imported into AutoDock, defined as a ligand, and exported as a pdbqt file. The crystal structure of ACE(1O86) was downloaded from the PDB database, imported into AutoDock, and processed by dehydration and hydrogenation. It was then defined as a receptor and exported as a pdbqt file. A suitable binding pocket was selected, and the constructed peptide was docked with the ACE receptor using Autodock vina software. The binding energy (affinity) was calculated.
[0163] The calculation results are shown in Table 2.
[0164] Table 2
[0165]
[0166] Among the peptides shown in Table 1, IER and VAF are peptides that have been proven to have good ACE inhibitory activity in related technologies. The calculated parameters of IER and VAF were used as controls to comprehensively consider the ACE inhibitory potential of the remaining peptides.
[0167] The top 10 peptides in terms of score from Table 1 were selected for calculation. Based on binding free energy, the predicted binding energies of HIIARPH, REVDKPF, LRLKE, and SFR were all superior to those of the known ACE inhibitory peptides IER and VAF, indicating their potential for ACE inhibition. Except for peptide LHI, the ΔE values of the other peptides HIIARPH, REVDKPF, LRLKE, and SFR were all lower than those of the control peptide VAF. Furthermore, except for HIIARPH, the ΔE values of the other peptides were greater than those of IER, suggesting that the reactivity of the obtained peptides may fall between that of VAF and IER. (See Table 2). Considering all factors, HIIARPH, REVDKPF, LRLKE, and SFR were selected for synthesis and ACE inhibitory activity testing.
[0168] Example 2
[0169] The peptides HIIARPH, REVDKPF, LRLKE and SFR were artificially synthesized by Shanghai Sangon Biotech (Shanghai) Co., Ltd., and the purity of the synthesized peptides was >98%.
[0170] Test Example 1
[0171] This test case evaluated the ACE inhibitory activity of the peptides HIIARPH, LRLKE, SFR, and REVDKPF obtained in Example 1, with three replicates for each group. IER and VAF were used as positive controls. The test method is as follows:
[0172] ACE inhibitory activity was tested using FAPGG (purchased from Shanghai Yuanye Biotechnology Co., Ltd.) as a substrate. ACE storage buffer (80 mM HEPES, 50% glycerol (w / w), 0.1 mM ZnCl2) and HEPES buffer (80 mM, pH 8.3, containing 200 mM NaCl) were prepared separately. The detection system is shown in Table 3. ACE enzyme activity A after adding the peptide sample and ACE enzyme activity B of the blank control were measured. The operating procedures are shown in Table 3. The formula for calculating the ACE inhibition rate is as follows:
[0173] ;
[0174] The inhibitor concentration at which 50% of the inhibitory activity is achieved is called the half-inhibitory concentration, denoted as IC50. 50 IC 50 The test results are shown in Table 4.
[0175] Table 3
[0176]
[0177] Table 4
[0178]
[0179] Selected peptide ICs using FAPGG as substrate 50 All of them are less than 1000 μM, and have good inhibitory activity and application potential. Among them, HIIARPH, LRLKE, SFR and REVDKPF have better ACE inhibitory activity than peptide VAF. LRLKE has even better inhibitory activity than another ACE inhibitory peptide IER.
[0180] Test Example 2
[0181] This test case investigated the protective effects of the peptides HIIARPH (peptide 1), LRLKE (peptide 2), SFR (peptide 3), REVDKPF (peptide 4), and IER obtained in Example 1 on cells. Six replicates were performed for each group, with peptide IER serving as the positive control. The testing method is as follows:
[0182] (1) HaCaT cells (provided by Beijing Beina Biotechnology Co., Ltd.) were seeded in 96-well plates at a seeding density of 10-1. 5 Cells were inoculated at a density of 100 μL per mL in complete culture medium and cultured in a cell culture incubator at 37°C and 5% CO2. After 24 h of culture, the culture medium was removed, and residual culture medium was washed away with PBS.
[0183] (2) UVB damage group: 100 μL of PBS was added to the washed cells, and the cells were subjected to UV crosslinking at 36 mJ / cm². 2 Cells were irradiated with UVB for 12 min, then treated with 100 μL of serum-free culture medium and peptide sample (final concentration 200 μM) for 24 h.
[0184] H2O2 damage group: 200 μM peptide sample was added to the washed cells for pretreatment for 12 h, followed by treatment with H2O2 at a final concentration of 200 μM for 12 h.
[0185] Undamaged cells were used as the blank group, while damaged cells that were not treated with drugs were used as the model group.
[0186] (3) After incubation, add 100 μL of 0.5 g / mL MTT solution (solvent is DMEM medium). After incubation for 4 h, remove the supernatant, add 100 μL of DMSO to dissolve the generated formazan, mix thoroughly, measure the absorbance at 490 nm wavelength using an ELISA reader, and calculate the cell viability.
[0187] ;
[0188] The treatment group consisted of the experimental group, control group, or model group treated with 1-4 peptides.
[0189] In the UVB damage group, peptides 1, 2, 3, and 4 improved cell viability by 10%–30%. Specifically, the cell viability of the peptide 4 (REVDKPF) treatment group reached 70.62%, approximately 30% higher than the model group. Compared to the IER (control group), treatment with peptides 1–4 resulted in even higher cell viability (p<0.01). Figure 1 As shown.
[0190] In the H2O2-damaged group, compared with the blank group, H2O2 treatment significantly reduced cell viability. Pretreatment with active peptides reduced H2O2-induced cell damage and improved cell viability (p<0.01), with peptide 4 increasing HaCaT cell viability by 35% (p<0.01). Compared with the IER (control group), treatment with peptides 1-4 resulted in higher cell viability (p<0.01). Figure 2 As shown.
[0191] Test Example 3
[0192] This test case evaluated the combination activity between different peptides, with three replicates per group. Peptides 1, 2, 3, 4, and 5 (IER) were combined in pairs, and their ACE inhibitory activity was measured. The combination index (CI) was calculated using the Chou-Talady intermediate-efficacy principle to evaluate the ACE inhibitory effect of the combined application of active peptides. The formula for calculating CI is as follows:
[0193] ;
[0194] In this test, peptide A and peptide B refer to the two peptides used in the compounding test, and D1 is the IC50 of peptide A. 50 D2 is the IC50 of polypeptide B. 50 D X1 and D X2 The combined action of peptide A and peptide B achieved IC50. 50 At that time, the interaction concentrations of polypeptide A and polypeptide B; here, IC50 is... 50 This indicates that the ACE inhibitory activity reaches 50%.
[0195] The criteria for judgment are as follows: when 0.9≤CI≤1.1, it is an additive effect; when 0.8≤CI≤0.9, it is a low-degree synergistic effect; and when 0.6≤CI≤0.4, it is a strong synergistic effect.
[0196] The test results are shown in Table 5.
[0197] Table 5
[0198]
[0199] As shown in Table 4, peptides 1, 2, 3, 4, and 5 all exhibit synergistic effects in pairs. Specifically, the CI value of peptide 1 + peptide 2 is less than 0.6, indicating a strong synergistic effect; these two peptides have a significant synergistic inhibitory capacity for ACE activity. The CI value of peptide 2 + peptide 4 is close to 0.6, also indicating a significant synergistic inhibitory capacity for ACE activity.
[0200] Test Example 4
[0201] ACE inhibitory peptides can inhibit the conversion of angiotensin I to angiotensin II by inhibiting ACE activity, thereby inhibiting vasoconstriction and helping lymphatic drainage, thus improving the problem of eye bags.
[0202] This test case evaluates the effects of peptide 1 + peptide 2 on reducing eye bags and improving transepidermal water loss. The test method is as follows:
[0203] The peptides to be tested were prepared into an eye cream, and the formula of the eye cream is shown in Table 6. Thirty volunteers aged 25-40 years were randomly divided into two groups (test group and blank control group), with 15 people in each group. The test conditions were: constant temperature of 20℃ and humidity of 60%. After facial cleansing, volunteers waited for 30 minutes in the temperature- and humidity-controlled room before the test began. The lower eyelid and outer corner of the eye were selected as the test areas. Approximately 0.5 g of sample was applied to the eye area once a day. After 30 days, the volume of the under-eye bags was measured, and transepidermal water loss (TEWL) was measured every 10 days. The formula for calculating the reduction rate of under-eye bag volume is as follows:
[0204] ;
[0205] The volume is taken as the average value of each group.
[0206] Table 6
[0207]
[0208] Test results are as follows Figure 3 and 4 As shown.
[0209] Compared with the blank control group (5%), the test group volunteers had a significant reduction of 34% in eye bag volume (p<0.01) and significantly improved transepidermal water loss.
[0210] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention.
Claims
1. An ACE-inhibiting peptide or a cosmetically or pharmaceutically acceptable salt thereof, characterized in that, The amino acid sequence of the ACE inhibitory peptide is HIIARPH.
2. A biomaterial related to the ACE-inhibiting peptide of claim 1, characterized in that, Includes at least one of A1 to A6: A1: A nucleic acid molecule encoding the ACE inhibitory peptide of claim 1; A2: An expression cassette containing the nucleic acid molecules described in A1; A3: A recombinant vector containing the nucleic acid molecules described in A1; A4: A recombinant vector containing the expression cassette described in A2; A5: Recombinant microorganisms containing any one of A1 to A4; A6: Transgenic cells containing any one of A1 to A4.
3. The use of the ACE inhibitory peptide of claim 1 or the biomaterial of claim 2 in the preparation of products having at least one function of B2 to B5: B2: Reduces oxidative damage; B3: Reduces damage from medium-wave ultraviolet radiation; B4: Reduces the volume of eye bags; B5: Reduces transepidermal water loss from the skin; The product in question is a cosmetic or a pharmaceutical.
4. A product characterized in that, Includes at least one of C1 and C3; C1: At least one of a polypeptide with the amino acid sequence HIIARPH or a cosmetically or pharmaceutically acceptable salt thereof; C3: The biomaterial as described in claim 2; The product in question is a cosmetic or a pharmaceutical.
5. The product according to claim 4, characterized in that, The product also includes a polypeptide with the amino acid sequence IER or a cosmetically or pharmaceutically acceptable salt thereof, a polypeptide with the amino acid sequence REVDKPF or a cosmetically or pharmaceutically acceptable salt thereof, a polypeptide with the amino acid sequence LRLKE or a cosmetically or pharmaceutically acceptable salt thereof, or a polypeptide with the amino acid sequence SFR or a cosmetically or pharmaceutically acceptable salt thereof; or any one of the biological materials D1 to D6. D1: A nucleic acid molecule encoding a polypeptide with the amino acid sequence IER; D2: An expression cassette containing the nucleic acid molecules described in D1; D3: A recombinant vector containing the nucleic acid molecules described in D1; D4: A recombinant vector containing the expression cassette described in D2; D5: Recombinant microorganisms containing any one of D1 to D4; D6: Transgenic cells containing any one of D1 to D4.
6. The product according to claim 4, characterized in that, The product also includes excipients acceptable for use in cosmetics or pharmaceuticals.
7. The product according to claim 4, characterized in that, The product is a cosmetic, and the polypeptide in the product is 1% to 5% by mass.
8. The method for screening ACE inhibitory peptides according to claim 1, characterized in that, Includes the following steps: S1: Extract algal proteins from algae; the algae is Spirulina; S2: The algal protein is enzymatically hydrolyzed to obtain an enzymatically hydrolyzed peptide solution; in step S2, the enzyme used for enzymatic hydrolysis is an alkaline protease; S3: Identify and analyze the polypeptides in the enzymatically hydrolyzed peptide solution.
9. The screening method according to claim 8, characterized in that, In the enzymatic hydrolysis in step S2, the amount of alkaline protease used is 0.8 kU~1.2 kU / g algal protein.
10. The screening method according to claim 8, characterized in that, In step S2, the temperature conditions for enzymatic hydrolysis are 50℃~60℃.
11. The screening method according to claim 8, characterized in that, In step S2, the pH conditions for the enzymatic hydrolysis are 8-9.
12. The screening method according to claim 8, characterized in that, In step S2, the enzymatic hydrolysis time is 2 h to 4 h.
13. The screening method according to claim 8, characterized in that, In step S3, the identification is performed by LC-MS / MS.
14. The screening method according to claim 8, characterized in that, The analysis includes at least one of the following: relative abundance analysis, reliability analysis combined with identification results, toxicity analysis, binding energy analysis with ACE, frontier orbital energy level difference analysis, and ACE inhibitory activity analysis.
Citation Information
Patent Citations
Peptides and Their Use in the Treatment of Skin
US20160367463A1