Multiplex amplification system and kit for 23 short tandem repeat sequences

Abstract

The present invention belongs to the field of biotechnology, and relates to a composite amplification system and a kit of 23 short tandem repeat sequences, which are used to detect genetic marker genes with polymorphism in the human genome, and belongs to the field of biotechnology. The present invention relates to amplifying multiple short tandem repeat sequences simultaneously in a PCR system, and the specific loci are 22 short tandem repeat sequences with high genetic polymorphism and 1 sex determination site, and primers are designed and labeled with fluorescent groups respectively. The system has extremely high individual recognition rate and non-paternal exclusion rate, large amount of information, and good compatibility. The present invention can be used for forensic individual identification, paternity testing, and population genetics analysis, with higher accuracy and good sensitivity.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a fluorescently labeled composite PCR amplification system, which simultaneously amplifies multiple human genomic DNA short tandem repeat sequences (STRs), can quickly and accurately perform human STR typing, and further provide a judgment basis for forensic individual identification and paternity testing. Background Art

[0002] The eukaryotic cell genome is full of various repetitive DNA sequences, which are widely present around the chromosome centromere. The DNA region containing 2 to 6 base repeating units is called simple sequence repeat or short tandem repeat (STR). STR repeat units are small and widely distributed throughout the genome, with an average of one per 10,000 bases. The two alleles of heterozygous individuals are similar in size, so they are easy to amplify by PCR. There is no problem of differential amplification between the two alleles, so they have become widely used DNA repeat genetic markers. The number of core sequence repeats of STR genetic markers varies greatly between individuals, so STR can effectively identify human individuals. Many academic and commercial laboratories have analyzed a large number of STR genetic markers and applied them to disease gene positioning research, forensic individual identification, paternity testing and other aspects.

[0003] In forensic DNA typing, the use of DNA genetic markers with high variability, or the combined use of a large number of DNA genetic markers with low polymorphism to obtain sufficient sample identification capabilities, can both be used to identify and judge human individuals. However, small fragments of STR alleles (100-400bp) are more suitable for the needs of special samples in the field of forensic medicine. Therefore, based on biological and technical reasons, STR has more advantages in forensic identification.

[0004] In order to ensure the effectiveness of forensic DNA typing markers in the judicial system, the FBI laboratory in the United States initiated the construction of CODIS (Combined DNA Index System) in 1996, and selected 13 core STR loci (CSF1P0, FGA, TH01, TP0X, vWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11) as universal standard genetic markers. In the past two decades, some commercial STR kits have been launched, providing forensic science with available STR genetic marker detection methods, and with the rapid development of detection technology, the methods for detecting STR alleles have become more sensitive, rapid and accurate.

[0005] With the construction and development of forensic DNA typing STR databases, more STR loci are needed to meet the growth of data volume and more complex parent-child identification. On November 17, 2021, the new Technical Specification for Biological Full Sibling Identification (SF T0117-2021) was issued and implemented, adding the definition of the full sibling relationship index (FSI) and the FSI calculation and cumulative FSI (CFSI) calculation of a single autosomal short tandem repeat (STR) locus; at the same time, the number of autosomal STR loci recommended for testing was increased, including 19 mandatory loci and 36 other autosomal STR loci that are not in linkage disequilibrium with the 19 mandatory STR loci, in order to improve system performance. Summary of the invention

[0006] The present invention provides a composite amplification system and kit of 23 short tandem repeat sequences, which have five-color fluorescent labels and extremely high sensitivity, and can detect and obtain a complete genotyping map with a DNA template as low as 0.125ng. The site combinations used in the present invention are all loci required by the Technical Specification for Identification of Full Sibling Relationships (SF T0117-2021), with extremely high individual recognition rates and non-paternal exclusion rates. The present invention can be used for forensic individual identification, paternity testing, and population genetics analysis with higher accuracy and better sensitivity.

[0007] The technical solution provided by the present invention is as follows:

[0008] A composite amplification system for 23 short tandem repeat sequences, comprising 22 pairs of primers, which can simultaneously amplify 22 STR loci: D2S1776, D18S853, D12S391, D1S1677, D1GATA113, D14S1434, D1S1656, D22S1045, D1S1627, D6S1017, D7S1517, D4S2408, D3S4529, D3S1744, D12ATA63, D20S482, D11S4463, D17S1301, D9S1122, D6S474, D10S1248 and D2S441, wherein the 22 pairs of primers are:

[0009]

[0010]

[0011] The composite amplification system also includes a pair of primers capable of amplifying the sex recognition site Amelogenin, the sequence of which is:

[0012] AMEL-F TCCCTGGGCTCTGTAAAGAATA 0.28 SEQ NO.45 AMEL-R GATCAGAGCTTAAACTGGGAAG 0.28 SEQ NO.46

[0013] The amplified sites in the composite amplification system are respectively labeled with four colors of fluorescence, and the same fluorescent labels are regarded as the same group. The four groups are: the first group D2S1776, D18S853, D12S391, D1S1677, D1GATA113 and D14S1434; the second group AMEL, D1S1656, D22S1045, D1S1627, D6S1017 and D7S1517; the third group D4S2408, D3S4529, D3S1744, D12ATA63, D20S482 and D11S4463; the fourth group D17S1301, D9S1122, D2S441, D6S474 and D10S1248.

[0014] The four groups of fluorescent labels are FAM, HEX, TAMRA and ROX.

[0015] The marker of the first group is FAM marker, the marker of the second group is HEX marker, the marker of the third group is TAMRA marker, and the marker of the fourth group is ROX marker.

[0016] The amplification system also includes PCR buffer, template DNA and Taq DNA polymerase.

[0017] The PCR buffer components include: 10 mM ammonium sulfate, 10 mM potassium chloride, 50 mM Tris-HCl at pH 8.3, 2 mM magnesium ions and 0.2 mM dNTP, and the amount of Taq DNA polymerase used is 2 U.

[0018] The reaction conditions during amplification of the amplification system are:

[0019] Step 1: denaturation at 95°C for 11 minutes, step 2: denaturation at 94°C for 30 seconds, step 3: annealing at 59°C for 1 minute, step 4: extension at 72°C for 1 minute, repeat steps 2 to 4 28 times, and finally extend at 60°C for 30 minutes.

[0020] The template DNA comes from human bones, saliva, blood, hair or semen.

[0021] A kit comprises any one of the above-mentioned amplification systems.

[0022] Application of the above amplification system or kit in individual identification and paternity testing.

[0023] The present invention studies the genetic diversity of STR loci, and the selected 23 loci include one (D12S391) mandatory locus required by the full sibling relationship identification technical specification (SF T0117-2021); in addition, there are 21 (D2S1776, D2S441, D1S1656, D1S1677, D1GATA113, D14S1434, D22S1045, D1S1627, D6S1017, D7S1517, D4S2408, D3S4529, D3S1744, D12ATA63, D20S482, D11S4463, D17S1301, D9S1122, D18S853, D6S474 and D10S1248) supplementary detection loci required by the specification and one gender locus. These sites are highly independent of each other, with no chain effects, and can achieve higher system efficiency.

[0024] The present invention adopts a four-color fluorescent labeling system to group the above 23 loci and perform fluorescent labeling: FAM labels D2S1776, D18S853, D12S391, D1S1677, D1GATA113 and D14S1434; HEX labels AMEL, D1S1656, D22S1045, D1S1627, D6S1017 and D7S1517; TAMRA labels D4S2408, D3S4529, D3S1744, D12ATA63, D20S482 and D11S4463; R0X labels D17S1301, D9S1122, D2S441, D6S474 and D10S1248. A pair of primers is designed upstream and downstream of the core sequence of each locus, and the amplified products are separated according to the difference in molecular weight, and the two loci cannot overlap. All primers are mixed to perform a composite amplification experiment to determine that there is no non-specific amplification. At the same time, the standard substance in the detection component of the present invention is marked with Orange, which can clearly mark and distinguish the size of each gene locus point of the detection sample.

[0025] The PCR reaction of the present invention is carried out in a specific buffer environment, and the buffer composition includes: 10mM ammonium sulfate, 10mM potassium chloride, 50mM Tris-HCl (pH8.3, 25°C), 2mM magnesium ion and 0.2mM dNTP.

[0026] Each reaction of the present invention requires 2 U of hot-start Taq DNA polymerase.

[0027] The amplified product of the present invention needs to be subjected to capillary electrophoresis for fragment analysis.

[0028] The fluorescent labeling composite amplification detection system of the present invention is suitable for detecting DNA samples extracted from human bones, saliva, blood, hair, semen stains and other test materials.

[0029] The present invention selects loci that meet the requirements of the Technical Specifications for Full Sibling Relationship Identification (SF T0117-2021), amplifies 23 loci at one time, and is suitable for forensic DNA analysis and paternity testing in all cases involving physical evidence containing human cells.

[0030] The design idea of ​​the technical solution of the present invention is as follows:

[0031] 1. Selection of gene loci

[0032] The most widely used identity test kits on the market generally include 19 mandatory STR loci, such as the PowerPlex 21 kit from Promega in the United States, and the Microreader from Beijing Yuwei Gene. TM 21 DirectID System. However, with the increasing application in recent years, users have higher requirements for the number of loci, information content and compatibility of the kit.

[0033] In some genetic identifications, more loci are needed to provide more information. For example, full-sibling paternity testing and missing persons matching require the combined use of 42 or more loci. The current practice is usually to select two manufacturers' composite amplification kits as a supplement and use them together to meet daily work needs, which increases costs and reduces work efficiency. Therefore, there is an urgent need for a kit that can provide more information.

[0034] In terms of DNA database construction, new requirements have been put forward for the compatibility of test kits. In recent years, my country has further accelerated the construction of DNA databases, and the amount of data in the database has increased exponentially. The role of data comparison is becoming more and more important. Data comparison requires that each STR test kit has compatibility at the gene locus. The locus data currently used is reliable for exclusion, but it is often not enough for identification, and more locus data is needed.

[0035] At the same time, in recent years, more and more special kinship identifications have emerged, such as biological full-sibling relationship identification. The "Implementation Specifications for Biological Full-Sibling Relationship Identification" (SF T0117-2021) issued by the Judicial Identification Center of the Ministry of Justice requires that "when conducting biological full-sibling relationship identification, the 19 autosomal STR loci currently commonly used in kinship identification (vWA, D21S11, D18S51, D5S818, D7S820, D13S317, D16S539, FGA, D8S1179, D3S1358, CSF1P0, TH01, TP0X, Penta E, Penta D, D2S1338, D19S433, D12S391, D6S1043) are mandatory loci for testing", and there are 36 additional test loci. Microreader already available at our company TM 21 Direct ID System includes the above 19 mandatory STR loci; Microreader TM The 23sp-D ID System contains 16 supplementary detection loci required by the "Biological Full Siblings Identification Implementation Specification" (SF T0117-2021). The present invention uses D12S391 and 21 supplementary detection sites required by the "Biological Full Siblings Identification Implementation Specification" (SF T0117-2021), and uses 55 detection sites required by the specification in combination with the above two products. These loci cover the loci commonly used by most kits on the market, greatly improving the system performance.

[0036] The present invention amplifies 22 STR gene loci and one sex identification locus in a PCR reaction system. The STR loci used are D2S1776, D18S853, D12S391, D1S1677, D1GATA113, D14S1434, D1S1656, D22S1045, D1S1627, D6S1017, D7S1517, D4S2408, D3S4529, D3S1744, D12ATA63, D20S482, D11S4463, D17S1301, D9S1122, D6S474, D10S1248 and D2S441, and the sex identification locus uses the internationally used Amelogenin.

[0037] The present invention can detect gender and 22 STR loci. The non-paternity exclusion rate obtained through this information is higher than 0.99999999, and the individual identification rate is higher than 0.99999999, which can ensure that the probability of overlap of characteristics of two unrelated individuals is less than 10. 18 above.

[0038] 2. Primer Design

[0039] The primers are designed using software such as Primer Premier5 and NCBI Blast. When designing primers, the Tm value of each primer should be within the range of (60±3)°C, the amplification efficiency should be similar, and the size of the amplified product of each pair of primers should be different by more than 100bp. After the design is completed, the interaction between primer dimers and different primers is analyzed using software such as AutoDimer. If there is an interaction that can produce non-specific products or dimers, the design needs to be redesigned until the primer sequence that meets the requirements is obtained.

[0040] Select human DNA template, use the above 23 pairs of primers for single amplification, place the amplified products on 2.0% agarose gel electrophoresis, and adjust the PCR system and amplification conditions according to the electrophoresis results to obtain the common amplification conditions of the 23 pairs of primers. The final desired effect is: under the same system and amplification conditions, all primer pairs can produce bright and relatively single target bands. If any primer does not meet the above conditions, redesign the primer.

[0041] 3. Establishment of Fluorescent Labeling System

[0042] The four-color fluorescence composite amplification system was established by selecting FAM, HEX, TAMAR and ROX, and the designed 23 pairs of primers were divided into four groups for fluorescence labeling. Each group adopted a fluorescent label, namely FAM, HEX, TMR and ROX. After obtaining the fluorescent labeled primers, the non-fluorescent primer combination matched with them was used, and then single amplification was performed respectively, and the amplified product was placed on a 3500 genetic analyzer for capillary electrophoresis, and the amplification efficiency of each pair of primers was assessed according to the result of capillary electrophoresis detection. Thereafter, the same fluorescently labeled primer was mixed and placed in the same tube for amplification, and the amplified product was placed on a 3500 genetic analyzer for capillary electrophoresis, and the amplification efficiency of each pair of primers was determined according to the result of capillary electrophoresis detection, and it was judged whether the group of primer mixed amplification caused non-specificity. Finally, the amount of each primer pair to be added was preliminarily determined based on the capillary electrophoresis results of single-plex amplification and combined amplification, and the 23 primer pairs were mixed and placed in the same tube for amplification. The concentrations of each primer pair were then adjusted based on the electrophoresis results of the composite amplification, so that the amplification efficiency of each primer pair (reflected in the peak height of the electrophoresis results) was basically consistent. The sequences of the 23 primer pairs were finally determined.

[0043] 4. Optimization of amplification reaction system

[0044] The parameters of the 23 loci complex amplification system were determined through repeated experiments, including the selection of Taq DNA polymerase, Mg 2+ concentration, ionic strength of the buffer, amount of Taq DNA polymerase, and amount of DNA template.

[0045] 5. Optimization of reaction procedures

[0046] After a lot of experiments, we explored the temperature and time range of denaturation, annealing and extension of the reaction program. We believe that amplification under the following conditions (see Table 1) can obtain better results:

[0047] Table 1 Polymerase chain reaction amplification conditions

[0048]

[0049] Beneficial Effects

[0050] 1. Contains 22 STR loci and 1 gender locus Amelogenin, with Microreader TM 21Direct ID System and Microreader TM The 23sp-D ID System can cover all sites used by mainstream test kits on the market and all sites included in the "Technical Specifications for Identification of Biological Full Sibling Relationships" (SF T0117-2021), with a large amount of information and good compatibility.

[0051] 2. The template has a wide range of applications and is suitable for forensic DNA analysis in all cases involving physical evidence containing cells. All biological samples containing cells, such as bloodstains, semen stains, saliva, hair, nails, cartilage and other human tissues, can be identified.

[0052] 3. The system has good specificity and stability. After repeated verification, no non-specific amplification products are produced and the signal intensity is stable.

[0053] 4. High sensitivity, accurate typing can be obtained with as little as 0.125ng of DNA template. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 This is the amplification graph of sample 1 (anticoagulated whole blood extraction);

[0055] Figure 2 This is the amplification diagram of sample 2 (blood card extraction).

[0056] Figure 3 This is the amplification diagram of sample 3 (oral swab extraction).

[0057] Figure 4 This is the amplification diagram of sample 4 (saliva card extraction).

[0058] Figure 5 This is the annealing temperature gradient amplification diagram of sample 5 (9948 standard DNA).

[0059] Figure 6This is the sensitivity amplification graph of sample 6 (M308 standard DNA). DETAILED DESCRIPTION

[0060] Example 1

[0061] Detection of genotyping of 1 locus in volunteers using a multiplex amplification kit of 23 short tandem repeat sequences

[0062] 1. Collection of blood samples (blood samples are donated by volunteers)

[0063] 2. DNA Extraction

[0064] The genomic DNA was extracted using the Chelex-100 method (ref.<Forensic DNA Protocol> >.Humana Press, 1998) Take 0.5-5μL of anticoagulated whole blood (sample 1) and 1-3mm×2-5mm blood card (sample 2) and place them in a 500μL centrifuge tube, shake and mix the Chelex solution to fully suspend the Chelex, add 195μL Chelex-100 (5%) solution and 5μL proteinase K (20mg / ml1) to each tube and shake and mix, keep warm at 56℃ for two hours or overnight, take out and shake for 2 minutes, heat in boiling water for 10 minutes, centrifuge at 13000rpm for 5 minutes, and carefully transfer 150μL supernatant to a new centrifuge tube.

[0065] 3. Reaction system:

[0066] After oscillating and mixing each reaction reagent (Buffer, Primer Mix, dNTP, etc.), prepare a PCR reaction mixture according to the surface volume ratio (except template), dispense 9 μL into PCR reaction tubes, and finally add 1 μL template to each reaction tube, centrifuge and proceed to the next step. The composition of the reaction system is shown in Table 2.

[0067] Table 2 Standard amplification reaction system

[0068] Component name Volume (μL) Sterile deionized water 2.8 2.5× reaction buffer 4 Primer mix 2 Tag DNA polymerase 0.2 template 1 Total volume 10μL

[0069] 4.PCR reaction procedure:

[0070] Place the PCR reaction tube on the thermal amplification instrument, design and run the following program:

[0071] Step 1: denaturation at 95°C for 10 minutes, step 2: denaturation at 94°C for 30 seconds, step 3: annealing at 59°C for 1 minute, step 4: extension at 72°C for 1 minute, repeat steps 2 to 4 28 times, and finally extend at 60°C for 30 minutes. After the run, store the product in a refrigerator at 4°C.

[0072] 5. Capillary electrophoresis detection

[0073] Mix Orange 500 internal standard and formamide in a ratio of 2.5:100, take 12.5μL of the mixture and add it to a 96-well plate, then add 1μL of the amplified product sample or allele standard, mix and let stand for a few minutes, denature at 95℃ for 3min, immediately put in an ice bath for 3min, centrifuge and place in the ABI5000xL sequencer for detection.

[0074] 6. Data Analysis

[0075] Import raw data, select Add sample to project from the File menu on the main page, find the sample file, select the folder, click add to list, click add, and the sample file will be displayed in the Project window: select the analysis parameters. Define the analysis method, panel, and size standard. Browse the raw data of sample electrophoresis, choose any sample file name, and select "raw data" under the "sample" menu. Move the tracking line so that the cursor stops on the right side of the primer peak (before the first red internal standard peak), and use the value displayed on the X-axis in the lower left corner of the window as the starting point in the analysis method analysis parameters; click the green analysis button, and the save project dialog box will appear. Save after naming, and the software will start processing the data. After the analysis is completed, analysis completed will be displayed in the lower left corner. Use GeneMapper software to analyze the data and generate a spectrum, see Figure 1 and Figure 2 .

[0076] 7. Experimental Results

[0077] DNA extracted from blood samples of the same volunteer treated differently can be well amplified and accurately typed. The DNA amplification patterns of anticoagulated blood and blood card extracted using the Chelex-100 method are as follows: Figure 1 and Figure 2 As shown, the typing of the two samples was completely consistent.

[0078] Example 2

[0079] Detection of 2 loci typing in volunteers using a multiplex amplification kit of 23 short tandem repeat sequences

[0080] 1. Collection of saliva samples (saliva samples are donated by volunteers)

[0081] 2. DNA Extraction

[0082] The genomic DNA was extracted using the Chelex-100 method (ref.<Forensic DNA Protocol> >.Humana Press, 1998) Take an oral swab (sample 3) and a 1-3mm×2-5mm saliva card (sample 4) and place them in a 1500μL centrifuge tube. Shake and mix the Chelex solution to fully suspend the Chelex. Add 880μL Chelex-100 (5%) solution and 20μL proteinase K (20mg / ml1) to each tube and shake and mix. Incubate at 56℃ for two hours or overnight, take out and shake for 2 minutes, heat in boiling water for 10 minutes, centrifuge at 13000rpm for 5 minutes, and carefully transfer 150μL supernatant to a new centrifuge tube.

[0083] 3. Reaction system:

[0084] After oscillating and mixing each reaction reagent (Buffer, Primer Mix, dNTP, etc.), prepare a PCR reaction mixture according to the surface volume ratio (except template), dispense 9 μL into PCR reaction tubes, and finally add 1 μL template to each reaction tube, centrifuge and proceed to the next step. The composition of the reaction system is shown in Table 2.

[0085] 4.PCR reaction procedure:

[0086] Place the PCR reaction tube on the thermal amplification instrument, design and run the following program:

[0087] Step 1: denaturation at 95°C for 10 minutes, step 2: denaturation at 94°C for 30 seconds, step 3: annealing at 59°C for 1 minute, step 4: extension at 72°C for 1 minute, repeat steps 2 to 4 28 times, and finally extend at 60°C for 30 minutes. After the run, store the product in a refrigerator at 4°C.

[0088] 5. Capillary electrophoresis detection

[0089] Mix Orange 500 internal standard and formamide in a ratio of 2.5:100, take 12.5μL of the mixture and add it to a 96-well plate, then add 1μL of the amplified product sample or allele standard, mix and let stand for a few minutes, denature at 95℃ for 3min, immediately put in an ice bath for 3min, centrifuge and place in the ABI5000xL sequencer for detection.

[0090] 6. Data Analysis

[0091] Import raw data, select Add sample to project from the File menu on the main page, find the sample file, select the folder, click add to list, click add, and the sample file will be displayed in the Project window: select the analysis parameters. Define the analysis method, panel, and size standard. Browse the raw data of sample electrophoresis, choose any sample file name, and select "raw data" under the "sample" menu. Move the tracking line so that the cursor stops on the right side of the primer peak (before the first red internal standard peak), and use the value displayed on the X-axis in the lower left corner of the window as the starting point in the analysis method analysis parameters; click the green analysis button, and the save project dialog box will appear. Save after naming, and the software will start processing the data. After the analysis is completed, analysis completed will be displayed in the lower left corner. Use GeneMapper software to analyze the data and generate a spectrum, see Figure 3 and Figure 4 .

[0092] 7. Experimental Results

[0093] The DNA extracted from saliva samples of the same volunteer with different treatment methods can be well amplified and accurately typed. The DNA amplification patterns of oral swabs and saliva cards extracted using the Chelex-100 method are as follows: Figure 3 and Figure 4 As shown, the typing of the two samples was completely consistent.

[0094] Example 3

[0095] Annealing temperature test of the composite amplification kit for 23 short tandem repeat sequences

[0096] 1. The cell line samples come from 9948 DNA produced by Suzhou Yuwei Gene

[0097] 2. Experimental Setup

[0098] The 9948 DNA produced by Suzhou Yuwei Gene was diluted to 0.5 ng / μL and used as a template for PCR reaction.

[0099] 3. Reaction system:

[0100] After oscillating and mixing each reaction reagent (Buffer, Primer Mix, dNTP, etc.), prepare a PCR reaction mixture according to the surface volume ratio (except template), dispense 9 μL into PCR reaction tubes, and finally add 1 μL template to each reaction tube, centrifuge and proceed to the next step. The composition of the reaction system is shown in Table 2.

[0101] 4.PCR reaction procedure:

[0102] Place the PCR reaction tube on the thermal amplification instrument, design and run the following program:

[0103] Step 1: denaturation at 95°C for 10 minutes, step 2: denaturation at 94°C for 30 seconds, step 3: annealing at 57°C, 58°C, 59°C, 60°C, 61°C for 1 minute, step 4: extension at 72°C for 1 minute, repeat steps 2 to 4 28 times, and finally extend at 60°C for 30 minutes. After the run, store the product in a refrigerator at 4°C.

[0104] 5. Capillary electrophoresis detection

[0105] Mix Orange 500 internal standard and formamide in a ratio of 2.5:100, take 12.5μL of the mixture and add it to a 96-well plate, then add 1μL of the amplified product sample or allele standard, mix and let stand for a few minutes, denature at 95℃ for 3min, immediately put in an ice bath for 3min, centrifuge and place in the ABI5000xL sequencer for detection.

[0106] 6. Data Analysis

[0107] Import raw data, select Add sample to project from the File menu on the main page, find the sample file, select the folder, click add to list, click add, and the sample file will be displayed in the Project window: select the analysis parameters. Define the analysis method, panel, and size standard. Browse the raw data of sample electrophoresis, choose any sample file name, and select "raw data" under the "sample" menu. Move the tracking line so that the cursor stops on the right side of the primer peak (before the first red internal standard peak), and use the value displayed on the X-axis in the lower left corner of the window as the starting point in the analysis method analysis parameters; click the green analysis button, and the save project dialog box will appear. Save after naming, and the software will start processing the data. After the analysis is completed, analysis completed will be displayed in the lower left corner. Use GeneMapper software to analyze the data and generate a spectrum, see Figure 5 .

[0108] 7. Experimental Results

[0109] 0.5ng of 9948 DNA can be well amplified and accurately typed at 57℃, 58℃, 59℃, 60℃, and 61℃. The amplification pattern is shown in Figure 5 As shown in the figure, the sample typing is completely consistent, and no non-specific amplification peak appears. This shows that the 23 loci composite amplification system has good stability and can tolerate ±2°C annealing temperature changes.

[0110] Example 4

[0111] Sensitivity test of the multiplex amplification kit for 23 short tandem repeat sequences

[0112] 3. The cell line sample comes from M308 DNA produced by Suzhou Yuwei Gene

[0113] 4. Experimental Setup

[0114] The M308 DNA produced by Suzhou Yuwei Gene was diluted to 0.5 ng / μL, 0.25 ng / μL, 0.125 ng / μL, 0.625 ng / μL and 0.3125 ng / μL respectively and used as template for PCR reaction.

[0115] 3. Reaction system:

[0116] After oscillating and mixing each reaction reagent (Buffer, Primer Mix, dNTP, etc.), prepare a PCR reaction mixture according to the surface volume ratio (except template), dispense 9 μL into PCR reaction tubes, and finally add 1 μL template to each reaction tube, centrifuge and proceed to the next step. The composition of the reaction system is shown in Table 2.

[0117] 4.PCR reaction procedure:

[0118] Place the PCR reaction tube on the thermal amplification instrument, design and run the following program:

[0119] Step 1: denaturation at 95°C for 10 minutes, step 2: denaturation at 94°C for 30 seconds, step 3: annealing at 59°C for 1 minute, step 4: extension at 72°C for 1 minute, repeat steps 2 to 4 28 times, and finally extend at 60°C for 30 minutes. After the run, store the product in a refrigerator at 4°C.

[0120] 5. Capillary electrophoresis detection

[0121] Mix Orange 500 internal standard and formamide in a ratio of 2.5:100, take 12.5μL of the mixture and add it to a 96-well plate, then add 1μL of the amplified product sample or allele standard, mix and let stand for a few minutes, denature at 95℃ for 3min, immediately put in an ice bath for 3min, centrifuge and place in the ABI5000xL sequencer for detection.

[0122] 6. Data Analysis

[0123] Import raw data, select Add sample to project from the File menu on the main page, find the sample file, select the folder, click add to list, click add, and the sample file will be displayed in the Project window: select the analysis parameters. Define the analysis method, panel, and size standard. Browse the raw data of sample electrophoresis, choose any sample file name, and select "raw data" under the "sample" menu. Move the tracking line so that the cursor stops on the right side of the primer peak (before the first red internal standard peak), and use the value displayed on the X-axis in the lower left corner of the window as the starting point in the analysis method analysis parameters; click the green analysis button, and the save project dialog box will appear. Save after naming, and the software will start processing the data. After the analysis is completed, analysis completed will be displayed in the lower left corner. Use GeneMapper software to analyze the data and generate a spectrum, see Figure 6 .

[0124] 7. Experimental Results

[0125] M308 can perform good amplification when the DNA template input is more than 0.125ng. The amplification pattern is as follows Figure 6 As shown in the figure, the sample typing is completely consistent, and no non-specific amplification peak appears. This shows that the 23-locus composite amplification system has high sensitivity, and accurate typing can be obtained with a DNA template amount as low as 0.125ng.

Claims

1. A composite amplification system of 23 short tandem repeat sequences, characterized in that: The composite amplification system includes 23 pairs of primers, which can simultaneously amplify 22 STR loci: D2S1776, D18S853, D12S391, D1S1677, D1GATA113, D14S1434, D1S1656, D22S1045, D1S1627, D6S1017, D7S1517, D4S2408, D3S4529, D3S1744, D12ATA63, D20S482, D11S4463, D17S1301, D9S1122, D6S474, D10S1248 and D2S441. The primers for the 22 STR loci are: The composite amplification system also includes a pair of primers capable of amplifying the sex recognition site Amelogenin, the sequence of which is: AMEL-F TCCCTGGGCTCTGTAAAGAATA; AMEL-R GATCAGAGCTTAAACTGGGAAG; The amplified sites in the composite amplification system are respectively marked with four colors of fluorescent markers, and the same fluorescent markers are considered as the same group. The four groups are: Group I: D2S1776, D18S853, D12S391, D1S1677, D1GATA113, and D14S1434; The second group is AMEL, D1S1656, D22S1045, D1S1627, D6S1017 and D7S1517; The third group includes D4S2408, D3S4529, D3S1744, D12ATA63, D20S482, and D11S4463; Group 4: D17S1301, D9S1122, D2S441, D6S474, and D10S1248; The first group was labeled with FAM, the second group was labeled with HEX, the third group was labeled with TAMRA, and the fourth group was labeled with ROX.

2. The composite amplification system according to claim 1, further comprising a PCR buffer, a template DNA and a Taq DNA polymerase.

3. The composite amplification system according to claim 2, wherein the PCR buffer components include: 10 mM ammonium sulfate, 10 mM potassium chloride, 50 mM Tris-HCl at pH 8.3, 2 mM magnesium ion and 0.2 mM dNTP, and the amount of Taq DNA polymerase used is 2 U.

4. The composite amplification system according to claim 2, characterized in that: The template DNA comes from human bones, saliva, blood, hair or semen.

5. The composite amplification system according to claim 1, wherein the reaction conditions during amplification of the amplification system are: Step 1: denaturation at 95°C for 10 minutes, step 2: denaturation at 94°C for 30 seconds, step 3: annealing at 59°C for 1 minute, step 4: extension at 72°C for 1 minute, repeat steps 2 to 4 28 times, and finally extend at 60°C for 30 minutes.

6. A kit comprising the composite amplification system according to any one of claims 1 to 5.

7. Use of the amplification system according to any one of claims 1 to 5 or the kit according to claim 6 in individual identification and paternity testing.

Images