A codable circRNA related to buffalo skeletal muscle development and its application

Abstract

The present invention relates to a codable circRNA related to buffalo skeletal muscle development and its application. The codable circRNA is circMYBPCC, and its sequence is shown in SEQ ID NO: 1. Overexpression of circMYBPCC promotes myoblast proliferation and differentiation, and interference with circMYBPCC expression inhibits myoblast proliferation and differentiation. The circMYBPCC forms a circMYBPCC nucleic acid complex with liposomes as a component of a drug for treating muscle damage, which is locally injected at the damaged muscle site. The present invention verifies the cyclic structure of buffalo-derived circMYBPCC and the potential of its codable protein, and finds that administration of circMYBPCC can significantly promote the regeneration and repair of damaged muscles, providing a new selection target for molecular regulation of buffalo muscle development.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a codable circRNA related to buffalo skeletal muscle development and an application thereof. Background Art

[0002] Skeletal muscle plays a vital role in exercise, metabolism and homeostasis. Skeletal muscle development is inseparable from the proliferation and differentiation of myoblasts. In addition to being regulated by genes, signaling pathways, transcription factors and miRNA, it is also regulated by circRNA. CircRNA is a special type of non-coding RNA. They are produced by a non-canonical splicing event called backsplicing. They lack a 5' cap and a 3' poly (A) tail. They are closed circles formed by covalent bonds and are not easily degraded by nuclease exonucleases. Compared with linear RNA, the structure is more stable. Studies have found that circRNA participates in biological processes such as body growth, development, and disease occurrence and development, and plays an important role in cell proliferation and differentiation, cell cycle, cell metabolism, apoptosis and maintenance of pluripotency. With the deepening of research, circRNA has been shown to encode polypeptides, and the encoded functional peptides are involved in regulating the development of skeletal muscle. CircZNF609 is one of the earliest endogenous circRNAs reported to bind to polysomes for translation, and CircZNF609 has been shown to promote myoblast proliferation; CircFAM188B encodes a protein that regulates chicken myoblast proliferation and differentiation. These research results show that circRNA can regulate muscle generation by encoding polypeptides.

[0003] At present, the topical drugs for treating muscle injuries on the market include flurbiprofen cataplasm, Yunnan Baiyao aerosol and swelling and pain aerosol spray. Oral Chinese patent medicines for promoting blood circulation and removing blood stasis, such as Huoxue Zhitong capsules, Panax notoginseng powder or Panax notoginseng capsules, Hulisan capsules, etc. If the local swelling is particularly severe, you can use drugs to reduce swelling and dehydration, such as intravenous infusion of mannitol. If the nerves are damaged at the same time, you need to take oral drugs to nourish the nerves, such as methylcobalamin or vitamin B1. After the injury, it will cause obvious pain. Non-steroidal anti-inflammatory analgesics need to be selected according to the degree of pain. For mild pain, celecoxib capsules can be selected for pain relief; if it is moderate pain, ibuprofen sustained-release capsules can be selected. If the injury is more serious and severe pain occurs, tramadol sustained-release tablets can be selected. Minor muscle injuries can be recovered in about two weeks, while severe muscle injuries will take a long time to gradually recover. These drugs have different effects on muscle damage. After muscle damage, blood congestion and muscle tissue fragments will cause an inflammatory immune response in the body. Anti-inflammatory and analgesic drugs can effectively reduce the degree of inflammatory immune response and reduce the patient's pain, but will prolong muscle repair time. Methylcobalamin and other nerve-nourishing drugs can effectively help reshape nerve cells in the muscle and promote muscle regeneration, but they cannot directly promote muscle regeneration.

[0004] It can be seen that the drugs currently used in clinical practice do not have the function of directly promoting muscle tissue regeneration. The therapeutic drugs are mainly represented by auxiliary functions such as alleviating patient pain and providing nutrition, and mainly rely on the self-regeneration and repair function of human muscles. Nucleic acid drugs can directly promote muscle cell proliferation and differentiation and promote muscle tissue regeneration, but there are currently no reports of nucleic acid drugs that directly treat damaged muscles.

[0005] In response to this problem, the present invention provides a buffalo-derived circRNA that can promote muscle repair after injury. By significantly promoting myoblast growth and related gene expression, it can help muscle fiber remodeling and promote muscle regeneration. Buffalo meat has low fat content, low cholesterol, and low calories, and is suitable for all kinds of people. With the rapid development of molecular biology technology, the expression of related genes can be controlled at the molecular level. Therefore, using related genes to improve the growth performance and meat quality of buffalo can improve the growth rate and meat quality of buffalo faster and more accurately. Summary of the invention

[0006] To solve the above problems, the present invention provides a codable circRNA related to buffalo skeletal muscle development and its application.

[0007] The present invention provides an application of a codable circRNA related to buffalo skeletal muscle development in the preparation of a drug for treating muscle injury. The codable circRNA is circMYBPCC, and its sequence is shown in SEQ ID NO: 1. Overexpression of circMYBPCC promotes myoblast proliferation and differentiation, and interference with circMYBPCC expression inhibits myoblast proliferation and differentiation.

[0008] Furthermore, the mouse source sequence of the circMYBPCC is shown in SEQ ID NO:3.

[0009] Furthermore, the human sequence of circMYBPCC is shown in SEQ ID NO:4.

[0010] Furthermore, the circMYBPCC forms a circMYBPCC nucleic acid complex with liposomes as a component of a drug for treating muscle damage.

[0011] Furthermore, when the circMYBPCC nucleic acid complex is used as a component for preparing a drug for treating muscle damage, the dosage per kilogram of damaged muscle is 0.5-2 mg.

[0012] Furthermore, the medicine for treating muscle damage is an injection, which is injected locally at the site of muscle damage.

[0013] Compared with the prior art, the present invention has the following beneficial effects in application:

[0014] 1. The present invention first verified the ring structure of buffalo-derived circMYBPCC and its potential to encode proteins, and prepared its polyclonal antibodies. Further functional verification at the cellular level found that circMYBPCC promoted the proliferation and differentiation of buffalo myoblasts; at the same time, a mouse muscle injury model was constructed, and it was found that after administration of circMYBPCC, it could significantly promote the regeneration and repair of damaged muscles.

[0015] 2. The present invention discovered for the first time that circMYBPCC can encode polypeptides and promote the proliferation and differentiation of buffalo myoblasts, providing a new target for the molecular regulation of buffalo muscle development.

[0016] 3. Based on the buffalo-derived circMYBPCC sequence, the present invention provides mouse-derived circMYBPCC sequence and human-derived circMYBPCC sequence. Mouse experiments have verified that the circMYBPCC provided by the present invention has a therapeutic effect on damaged muscles and can be used as an RNA drug. It has the characteristics of rapid onset and high safety, and has great potential application value in treating muscle damage through local muscle injection.

[0017] 4. The present invention develops the circMYBPCC nucleic acid complex into an injection for injection into the local muscle where muscle damage occurs. The circMYBPCC nucleic acid complex can be translated into circMYBPCC polypeptide in the muscle, and then the circMYBPCC polypeptide significantly promotes muscle fiber repair. Compared with the current clinical muscle injury medication (such as: anti-inflammatory and analgesic drugs can effectively reduce the degree of inflammatory immune response and reduce patient pain, but will prolong muscle repair time; methylcobalamin and other nerve nutrition drugs can effectively help remodel nerve cells in the muscle, but cannot directly promote muscle regeneration), the circMYBPCC polypeptide nucleic acid complex can directly and effectively promote the repair of damaged muscles, filling the gap in muscle injury treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 , identification of the circMYBPCC ring structure in the present invention;

[0019] Figure 2 , expression of the circMYBPCC-encoded peptide of the present invention in buffalo muscle;

[0020] Figure 3 , after overexpressing circMYBPCC in the present invention, expression efficiency detection;

[0021] Figure 4, after interfering with circMYBPCC in the present invention, interference efficiency detection;

[0022] Figure 5 , CCK8 test to detect cell proliferation after overexpression of circMYBPCC in the present invention;

[0023] Figure 6 , flow cytometry detection of cell cycle after overexpression of circMYBPCC in the present invention;

[0024] Figure 7 , the EdU test was used to detect cell proliferation after interfering with circMYBPCC in the present invention;

[0025] Figure 8 , after overexpressing circMYBPCC in the present invention, the expression of myoblast proliferation marker genes at the RNA and protein levels was detected;

[0026] Fig. 9 , after interfering with circMYBPCC in the present invention, the expression of myoblast proliferation marker genes at the RNA and protein levels was detected;

[0027] Fig.10 , after overexpressing circMYBPCC in the present invention, the expression of myoblast differentiation marker genes at the RNA and protein levels was detected;

[0028] Fig.11 , in the present invention, after interfering with circMYBPCC, the expression of myoblast differentiation marker genes at the RNA and protein levels was detected;

[0029] Fig.12 , the effect of overexpression of circMYBPCC on the number of myotubes differentiated from buffalo myoblasts was detected by cell immunofluorescence staining of the present invention;

[0030] Fig.13 , Slice analysis diagram of the construction of the mouse skeletal muscle injury model in the present invention;

[0031] Fig.14 , the present invention detects the expression of circMYBPCC in mouse muscle after administration of circMYBPCC;

[0032] Fig.15 , HE staining results of muscle tissue after circMYBPCC administration for 3 days and 7 days in the present invention;

[0033] Fig.16 , in the present invention, the expression of myoblast proliferation, differentiation and apoptosis marker genes at the RNA and protein levels was detected 7 days after administration of circMYBPCC. DETAILED DESCRIPTION

[0034] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] Experimental materials and their sources:

[0036] (1) pCD2.1-CIR was purchased from Wuhan Puint Biotechnology Co., Ltd.; siRNA was designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.;

[0037] (2) 3-month-old fetuses were collected from a slaughterhouse in Nanning, Guangxi; 4- to 5-month-old New Zealand white rabbits were obtained from the Animal Experimental Base of Guangxi University in Nanning, Guangxi; 4-week-old C57BL / 6 strain SPF (specific pathogen-free) experimental mice were purchased from Hunan SJA Experimental Animal Co., Ltd.;

[0038] (3) The antibodies used for Western Blot and immunofluorescence staining are as follows: anti-β-actin (66009-1-Ig), CDK2 (60312-1-Ig), MyoD1 (18943-1-AP), MyoG (67082-1-Ig), MyHC (22281-1-AP), goat anti-mouse (SA00001-1), goat anti-rabbit (SA00001-2), (FITC)–Goat Anti-Rabbit (SA00003-2), (FITC)–Goat Anti-mouse (SA00003-1) (Proteintech, USA); CyclinD1 (WL01435a), PCNA (WL03213) (Wanlei Biological, Shenyang);

[0039] (4) Primer synthesis: synthesized by Shanghai Shenggong Biotechnology Service Co., Ltd.;

[0040] (5) Horse serum, fetal bovine serum, trypsin-EDTA (0.25%) (Gibco, USA); 2X Taq PCR Mastermix (Tiangen, Beijing); DMEM (Corning, USA); HiScript 1st Strand cDNA Synthesis Kit, CCK-8 Cell Counting Kit, HiScript III RT SuperMix for qPCR (+gDNA wiper), 2XCham QTM Universal qPCR Master Mix (Nanjing, Novozyme); Trizol Reagent (Invitrogent, USA); Anhydrous ethanol (Shanghai, Sinopharm Group); Ribo-Zero TM Gold Kits (Epicentre, USA); RNase R (Guangzhou, Jisai); Freund's complete adjuvant, Freund's incomplete adjuvant, penicillin-streptomycin double antibody, RIPA lysis buffer, PMSF protease inhibitor, 4X protein loading buffer (containing DTT), ECL ultrasensitive luminescent liquid A, ECL ultrasensitive luminescent liquid B (Beijing, Solebao); E. coli DH5α competent Escherichia coli (Beijing, Quanshijin); Gel recovery kit (Beijing, Tiangen); Endotoxin-free plasmid DNA mini-extraction kit (USA, OMEGA); Endotoxin-free plasmid DNA mini-extraction kit (Beijing, Tianmo); BamHI, Kpn I restriction endonuclease (Japan, TaKara); T4 DNA ligase (BioLabs, USA); EdU kit (Reibo, Guangdong); cardiotoxin (CTX) (Kemin, Shanghai); physiological saline, slides, hematoxylin dye, eosin dye, neutral resin, OTX, 4% paraformaldehyde, sucrose (Solarbo, Beijing); surgical blades, tweezers, embedding boxes, surgical scissors (Shitai, Jiangsu).

[0041] Example 1: Isolation and culture of primary buffalo myoblasts

[0042] Enzymatic digestion was used to isolate primary buffalo myoblasts. The process strictly controlled aseptic operation. The specific steps were as follows:

[0043] 1. Peel off the fetal membranes of the fetus and rinse the fetus three times with PBS containing 2% double antibody;

[0044] 2. Cut the skin with sterile ophthalmic scissors, peel off the fascia and other tissues with forceps, separate the longissimus dorsi muscle, wash it in 75% alcohol for 3 seconds, wash it three times with PBS containing 2× double antibody, wash off the alcohol on the surface, and then transfer it to 37℃ preheated PBS solution containing 2× double antibody to fully immerse;

[0045] 3. Transfer to a sterile clean bench and use a new set of sterile surgical instruments to remove blood vessels and connective tissue between muscles;

[0046] 4. Use sterile ophthalmic scissors to cut the muscle tissue into minced meat as small as possible, collect it into a 15 mL centrifuge tube, add an appropriate amount of type I collagenase, and place it in a 37°C water bath for digestion for 1.5 hours;

[0047] 5. Centrifuge and discard the supernatant, add appropriate amount of trypsin for digestion, and digest at 37℃ for 30min;

[0048] 6. At the end of digestion, add an equal volume of termination medium to terminate digestion;

[0049] 7. Centrifuge to obtain primary buffalo myoblasts, resuspend the myoblasts in warm DMEM (37°C), filter with 100-mesh and 70-mesh cell sieves, collect the filtrate, centrifuge and discard the supernatant, and retain the precipitated primary buffalo myoblasts;

[0050] 8. Resuspend the buffalo primary myoblasts in DMEM containing 20% ​​FBS and 1% penicillin-streptomycin and culture in a 37°C, 5% CO2 incubator for 2 hours;

[0051] 9. Aspirate the culture supernatant of buffalo primary myoblasts and inoculate it into a new cell culture plate for purification;

[0052] 10. Replace the primary culture medium every two days and continue culturing to obtain buffalo primary myoblasts.

[0053] Example 2: Amplification and determination of circMYBPCC and its nucleotide sequence using PCR

[0054] 1. Total RNA extraction and cDNA synthesis from myoblasts

[0055] (1) Harvest 1 to 5 × 10 7 The culture medium of the buffalo primary myoblasts of Example 1 was discarded, and the cells were washed once with pre-cooled PBS, and the PBS was discarded. 1 mL of Trizol was added, and the myoblasts were blown off and collected into a 1.5 ml centrifuge tube without RNase, and the supernatant was discarded after centrifugation at 4°C.

[0056] (2) Add 500 μL of pre-cooled chloroform to the centrifuge tube in 1, shake vigorously for 30 seconds, place on ice for 10 minutes, and centrifuge at 4°C, 12,000 rpm for 10 minutes;

[0057] (3) Pipette the top aqueous phase and transfer to a new 1.5 mL centrifuge tube. Add 500 μL of pre-cooled isopropanol, shake vigorously for 30 seconds, place on ice for 5 minutes, and centrifuge at 4°C, 12,000 rpm for 10 minutes.

[0058] (4) Discard the supernatant, wash with 1 ml of 75% ethanol, flick to mix, and centrifuge at 4°C, 12,000 rpm for 5 min;

[0059] (5) Discard the supernatant and blow dry the precipitated RNA in a clean bench.

[0060] (6) Dissolve RNA in RNA-free ddH2O; detect the quality and concentration of total RNA using a spectrophotometer.

[0061] 2. Synthesize cDNA using HiScript 1st Strand cDNA Synthesis Kit

[0062] (1) Removal of genomic DNA: Add the following liquids to an RNase-free PCR tube: template RNA (total RNA amount is 1 pg -1 μg), 4×gDNA wiper Mix 4μL, RNase-free ddH2O to 16μL, mix well; PCR instrument 42℃, 2min;

[0063] (2) Prepare the reverse transcription reaction system: directly add 4 μL of 5×HisScriptqRT SuperMix to the centrifuge tube used in the first step and mix well;

[0064] (3) Perform reverse transcription reaction: 37°C, 15 min; 85°C, 5 s. Store the product in a -20°C refrigerator.

[0065] 3. PCR amplification of the full length of circMYBPCC

[0066] PCR amplification was performed using buffalo myoblast cDNA as a template. The primers used were: circMYBPCC-full-length-upstream primer: GGGGTACCAGCCAAAGAGAACTATGCAGG; circMYBPCC-full-length-downstream primer: TTGATGATCTGCATCTCGAATGGATCCCG. PCR amplification was performed according to the instructions of 2X Taq PCR Master mix, and the PCR product was detected using agarose gel. The gel detection results are shown in Figure 2. Figure 1 As shown in A, the PCR amplification product is a single band, and the band of the same size as the target gene is cut out for gel recovery. The recovered product is sent to Shanghai Bioengineering for Sanger sequencing. The obtained sequence circMYBPCC is 378bp in length, and its nucleotide sequence is shown in SEQ ID NO:1.

[0067] Example 3: Using qPCR and RNase R digestion method to prove the circular structure of circMYBPCC

[0068] 1. Design primers: β-actin-buffalo-upstream primer: CTGGCATTGTCATGGACTCTG;

[0069] β-actin-buffalo-downstream primer: GCTCGGCTGTGGTGGTAAA; back primer designed across the circMYBPCC circular structure linker: circMYBPCC-back primer-upstream primer: TGCAGGAAACTACAGATGTGA; circMYBPCC-back primer-downstream primer: GACTGTTGGCATTCTGCTTGT.

[0070] 2. RNase R enzyme digestion of RNA

[0071] RNase R can digest linear RNA but not circular RNA, so it can be used to identify circular RNA. Treat buffalo muscle RNA samples with RNase R. Add 1 μL (20U / μL) RNaseR, 3 μL 10x RNase R Buffer, and 6 μL ddH2O to 20 μL (total 20 μg) of buffalo muscle RNA, mix well, and incubate at 37°C for 15 minutes. After digestion, heat at 75°C for 10 seconds to inactivate the enzyme. Use a reverse transcription kit to reversely synthesize RNA into cDNA for subsequent qPCR detection.

[0072] 3. qPCR detection

[0073] The cDNA samples synthesized by reverse synthesis of buffalo muscle RNA treated with RNase R were detected using the fluorescence quantitative kit ChamQ Universal SYBR qPCR Master Mix. The reaction was performed on the real-time fluorescence quantitative PCR system-7500 system, with β-actin as the linear internal reference and 2 -ΔΔCT Methods The relative expression of genes was calculated (n = 3). Figure 1 As shown in B, after RNase R treatment, qPCR detected that the expression of the Actin gene representing the linear transcript decreased significantly, while the relative expression of the circMYBPCC transcript increased significantly. This is because RNase R digested the mRNA of the Actin gene but could not digest the circular structure of circMYBPCC. The qPCR results showed that circMYBPCC was tolerant to RNase R digestion, indicating that circMYBPCC is a stable circular RNA.

[0074] Example 4: Identification of circMYBPCC coding capacity

[0075] 1. Peptide antigen design and antibody preparation

[0076] ORF Finder was used to predict the open reading frame (ORF) and internal ribosome entry site (IRES) of the full-length sequence of circMYBPCC. The antigenic epitope of the circMYBPCC-encoded polypeptide recognized by B cells was predicted based on the neural network algorithm on an online website (https: / / webs.iiitd.edu.in / raghava / abcpred / ), with the parameters: ABCpred, Threshold>0.8, length=16aa. The amino acid sequence of the antigenic epitope located at the N-terminal with the highest score was determined: RCEVTYKDKFDSCSFD, which was commissioned to be synthesized by Shanghai Shenggong Biotechnology Co., Ltd.;

[0077] The synthesized polypeptide was dissolved in PBS and used to immunize rabbits. For the first immunization, 10 mg of the dissolved polypeptide was mixed with Freund's complete adjuvant for emulsification. For the booster immunization, 5 mg of the polypeptide was mixed with Freund's incomplete adjuvant for emulsification. Multiple subcutaneous injections were performed on the back of the rabbit's neck for a total of 4 immunizations, with an interval of 1 week between each immunization. Seven days after the last immunization, blood samples were drawn from the rabbit's heart and the antiserum was separated by centrifugation.

[0078] 2. Immunofluorescence

[0079] Buffalo proliferating and differentiating myoblasts were collected, rinsed with PBS three times, fixed with 4% paraformaldehyde for 30 minutes, rinsed with PBS three times; permeabilized with 0.1% Triton X-100 for 30 minutes, washed with PBS three times; blocked with 2% goat serum for 1 hour, covered with diluted circMYBPCC primary antibody, and incubated at 4°C overnight. After discarding the primary antibody, wash with PBS, add diluted fluorescent secondary antibody, and incubate at room temperature in the dark for 1 hour; after washing with PBS, incubate with DAPI solution at room temperature for 15 minutes; finally wash three times with PBS and observe under a fluorescence microscope. The immunofluorescence results are shown in Figure 2 As shown in A, myoblasts in the proliferative stage are spindle-shaped, and circMYBPCC polypeptide (fluorescent signal) is mainly expressed in the cytoplasm of myoblasts in the proliferative stage. Figure 2 The differentiated myoblasts in A are multinuclear and long, and the circMYBPCC polypeptide (fluorescent signal) is expressed in both the nucleus and cytoplasm of the differentiated myoblasts.

[0080] 3. Protein Extraction and Western Blotting

[0081] Proteins in cell or tissue samples were extracted using RIPA lysis buffer containing 1% PMSF. Protein concentration was determined using a BCA kit. Proteins were separated using 10% SDS-polyacrylamide gel electrophoresis and transferred to NC membranes; after incubation with specific primary antibodies and corresponding secondary antibodies, the resulting images were captured using the ChemiDoc XRS+ system;

[0082] The test results showed that there were IRES and ORF on circMYBPCC, and it could encode a protein containing 439 amino acids, the amino acid sequence of which was shown in SEQ ID NO: 2, and the expected size of the encoded protein was 50 kDa. Figure 2 As shown in B, using the antibody described in step 1 of Example 4, a circMYBPCC protein band of 50 KDa was specifically detected in the buffalo muscle tissue protein lysate, which is consistent with the theoretical size of the protein, indicating that the protein encoded by circMYBPCC is expressed in buffalo muscle tissue.

[0083] Example 5: Design and construction of circMYBPCC overexpression vector and interfering RNA

[0084] 1. Design the full-length sequence primers of circMYBPCC, and add protection bases and restriction sites to the upstream and downstream primers. The primer sequences are: (the underlined part is the restriction site)

[0085] PCD2.1-circMYBPCC-F:

[0086] GG GGTACC AGCCAAAGAGAACTATGCAGG;

[0087] PCD2.1-circMYBPCC-R:

[0088] TTGATGATCTGCATCTCGAAT GGATCC CG;

[0089] The full-length circMYBPCC was cloned using buffalo myoblast cDNA as a template. The amplified full-length circMYBPCC sequence was ligated into the pCD2.1-CIR vector to obtain the overexpression vector pCD2.1-circMYBPCC.

[0090] like Figure 3 As shown in the figure, to detect whether the overexpression vector can express circMYBPCC in large quantities in myoblasts, pCD2.1-circMYBPCC was transfected into myoblasts, and the expression of circMYBPCC was detected by qPCR after culturing for 18-24 hours. The qPCR results showed that the expression of circMYBPCC increased by nearly 17 times compared with normal myoblasts after transfection with pCD2.1-circMYBPCC, indicating that the overexpression vector pCD2.1-circMYBPCC can express circMYBPCC in large quantities and can be used for subsequent functional verification.

[0091] 2. Based on the full-length sequence of circMYBPCC, its interference fragment was designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. The sequence is: CTTGAAGTACTTGAATGGT;

[0092] like Figure 4 As shown, the circMYBPCC interference fragment was transfected into myoblasts and cultured for 18-24h, and the expression of circMYBPCC in myoblasts was detected by qPCR. The results showed that the expression of circMYBPCC in the circMYBPCC interference group was significantly reduced by about 80% compared with the control group, indicating that the circMYBPCC interference fragment was successfully designed and can be used for subsequent functional verification.

[0093] Example 6: Detecting the effect of overexpression or interference of circMYBPCC on the proliferation capacity of buffalo myoblasts

[0094] According to different test requirements, the buffalo primary myoblasts in Example 1 were inoculated into different types of cell culture dishes. When the myoblast density reached 60%, the pCD2.1-circMYBPCC plasmid and si-circMYBPCC (pCD2.1 plasmid and si-NC were used as controls) were transfected into buffalo myoblasts. After transfection, the myoblasts were cultured continuously until the myoblast density reached about 80%, and the myoblasts were processed for subsequent tests.

[0095] 6.1. CCK8 detection of myoblast proliferation

[0096] 6.1.1 Take logarithmic phase buffalo myoblasts and inoculate them into 96-well plates. When the cell density reaches 60%, transfect the myoblasts with pCD2.1 and pCD2.1-circMYBPCC and continue to culture.

[0097] 6.1.2 When the density of myoblasts reaches about 80%, use complete culture medium to prepare CCK8 dilution at a ratio of 10%; discard the complete culture medium in the 96-wells, add 100 μL of CCK8 dilution to each well; continue to culture in the incubator for 4 hours;

[0098] 6.1.3 Use an ELISA reader to measure the OD value at a wavelength of 450 nm (the operation should be performed in a dark environment) and perform statistical analysis;

[0099] 6.1.4 The calculation formula is: Myoblast proliferation percentage = [(AC) / (BC)] × 100%, A: absorbance value of the experimental group (the absorbance value containing culture medium, pCD2.1-circMYBPCC transfected myoblasts and CCK8 Solution) B: absorbance value of the control group (the absorbance value containing culture medium, pCD2.1 transfected myoblasts and CCK8 Solution) C: absorbance value of the blank group (the absorbance value containing culture medium and CCK8 Solution).

[0100] like Figure 5 As shown in the figure, the proliferation of buffalo myoblasts was detected by CCK8, and the cell proliferation rate of the circMYBPCC overexpression group was significantly higher than that of the control group. Taking the proliferation rate of the control group transfected with pCD2.1 as a reference, the proliferation rate of the circMYBPCC overexpression group increased by about 20%, indicating that increasing the expression of circMYBPCC has a promoting effect on myoblast proliferation.

[0101] 6.2 Flow cytometry for cell cycle detection

[0102] 6.2.1 Cell culture: Logarithmic phase buffalo myoblasts were inoculated into 96-well plates. When the density of myoblasts reached 60%, pCD2.1 and pCD2.1-circMYBPCC were used to transfect myoblasts respectively. The myoblasts were cultured until the density reached 80% before the next step of the experiment.

[0103] 6.2.2 Collect and fix myoblasts: discard the culture medium, wash once with PBS; add appropriate amount of 0.25% trypsin to completely digest the myoblasts at 37°C, then add stop culture medium to stop digestion, collect into 1.5 ml centrifuge tube, centrifuge and discard supernatant; wash 3 times with PBS, discard supernatant; add 250 μL pre-cooled PBS to resuspend the cells, add 750 μL pre-cooled anhydrous ethanol, mix well, and fix at -20°C for 24 hours;

[0104] 6.2.3 Myoblast staining: Remove the myoblasts, centrifuge and discard the supernatant, wash 3 times with PBS; add FxCycleTM PI / RNAse Solution to the myoblast pellet and incubate at room temperature in the dark for 30 minutes, then wash once with PBS;

[0105] 6.2.4 Detection: Resuspend myoblasts with PBS, then detect using flow cytometry and analyze the results using ModFit software.

[0106] like Figure 6 As shown, Figure 6 A is the result of cell cycle analysis using ModFit software. Figure 6 A1 is the control group, Figure 6A2 is the circMYBPCC overexpression group, Figure 6 A1 and Figure 6 The leftmost peak of A2 represents the proportion of cells in the G1 / G0 phase, the broad peak in the middle represents the proportion of cells in the S phase, and the rightmost peak represents the proportion of cells in the G2 / M phase. Figure 6 B is the statistical results of the G1 / G0, S and G2 / M periods. Figure 6 As can be seen in B, compared with the control group, the proportion of cells in the G1 / G0 phase in the circMYBPCC overexpression group was significantly downregulated, the proportion of cells in the S phase was significantly upregulated, and there was no significant difference in the proportion of cells in the G2 / M phase, which indicates that a higher proportion of myoblasts in the circMYBPCC overexpression group are in the proliferation cycle, which is consistent with the result that circMYBPCC promotes cell proliferation.

[0107] 6.3 EdU detection of myoblast proliferation

[0108] 6.3.1 Take logarithmic phase buffalo myoblasts and inoculate them into 96-well plates. When the cell density reaches 60%, transfect the cells with si-NC and si-circMYBPCC and continue to culture for 18 hours. When the density reaches 80%, perform the EdU test according to the EdU kit. The specific detection steps are as follows;

[0109] 6.3.2 Use complete culture medium to dilute EdU solution at a ratio of 1000:1 to prepare 50μmol / L EdU dilution. Add 100μL EdU dilution to each well and incubate in the incubator for 2h; discard the liquid and wash the cells with PBS twice, 5min each time;

[0110] 6.3.3 Add 50 μL of 4% paraformaldehyde to each well and fix at room temperature for 30 min. Discard the liquid and add 50 μL of 2 mg / mL glycine to each well and incubate for 5 min. After discarding the glycine, wash once with PBS. Then add 100 μL of 0.5% TritonX-100 solution to each well to permeabilize the myoblasts for 10 min. Wash the myoblasts with PBS for 5 min.

[0111] 6.3.4 Add 100 μL of Apollo staining reaction solution to each well and incubate at room temperature for 30 min in the dark; discard the liquid, add 100 μL of 0.5% TritonX-100 PBS to each well and wash on a shaker for 3 times, 10 min each time; add 100 μL of methanol to each well and wash twice, 5 min each time, and wash once with PBS;

[0112] 6.3.5 DNA staining: Prepare 1×Hoechst33342 reaction solution with ddH2O at a ratio of 100:1, add 100 μL of 1×Hoechst33342 reaction solution to each well, incubate at room temperature in the dark for 30 min, discard the reaction solution; wash with PBS 3 times, 5 min each time;

[0113] 6.3.6 Perform myoblast imaging analysis using a fluorescence microscope.

[0114] like Figure 7 As shown, the effect of circMYBPCC interference in buffalo myoblasts on myoblast proliferation was analyzed by calculating the ratio of Hochest-stained and EdU-stained nuclei. Figure 7 In A, Hochest can stain all cell nuclei, while EdU dye only stains proliferating cell nuclei. The cell proliferation rates of the two groups were analyzed by statistically calculating the proportion of EdU-stained cell nuclei to Hochest-stained cell nuclei in the circMYBPCC interference group and the control group. The analysis results are shown in Figure 2. Figure 7 As shown in B, the number of newly proliferated myoblast nuclei in the circMYBPCC interference group was significantly reduced compared with the control group, indicating that circMYBPCC interference significantly inhibited myoblast proliferation.

[0115] 6.4. Detection of proliferation-related gene expression by qPCR and Western blotting assays

[0116] The reverse transcription kit of Nanjing Novozyme was used to reverse transcribe RNA into cDNA, and the expression changes of myoblast proliferation-related genes PCNA, cyclinD1 and CDK2 at the RNA level were detected by quantitative PCR. The expression changes of circMYBPCC and myoblast proliferation-related genes PCNA, cyclinD1 and CDK2 at the protein level were detected by WB technology.

[0117] like Figure 8 As shown in Figure 2, qPCR results showed that overexpression of circMYBPCC significantly increased the transcriptional expression of PCNA, CDK2, and cyclinD1 genes compared with the control group ( Figure 8 A); Western blotting revealed that the protein expression levels of myoblast-related proliferation genes (PCNA, cyclinD1, and CDK2) were significantly upregulated, and the expression level of circMYBPCC-encoded peptide was also significantly upregulated after overexpression of circMYBPCC ( Figure 8 B).

[0118] Correspondingly, Fig. 9As shown in the figure, after interfering with circMYBPCC in buffalo myoblasts, the transcriptional expression levels of CDK2, PCNA and cyclinD1 genes were detected by qPCR. The gene expression in the circMYBPCC interference group was significantly lower than that in the control group ( Fig. 9 A); Western blotting also found that the protein expression levels of related myoblast proliferation genes (PCNA, cyclinD1 and CDK2) in the circMYBPCC interference group were significantly decreased compared with the control group ( Fig. 9 B), and the expression level of circMYBPCC-encoded peptide also decreased significantly after interfering with circMYBPCC ( Fig. 9 B) These results indicate that the proliferation of buffalo myoblasts lacking circMYBPCC is inhibited.

[0119] Example 7: Detecting the effect of overexpression or interference of circMYBPCC on the differentiation ability of buffalo myoblasts

[0120] The buffalo myoblasts isolated in Example 1 were inoculated into a 6-well plate until the cell density reached more than 60%, and the pCD2.1-circMYBPCC plasmid and si-circMYBPCC (pCD2.1 plasmid, si-NC as control) were transfected into buffalo myoblasts. After transfection, the myoblasts were cultured continuously until the density of myoblasts reached about 80%, and then replaced with DMEM containing 2% horse serum for induction of differentiation. After inducing the differentiation of buffalo myoblasts for 5-6 days, total cell RNA was extracted, and total myoblast protein was extracted at the same time. Reverse transcription was performed using the Nanjing Novozyme reverse transcription kit, and RNA was reversely transcribed into cDNA, and the expression changes of myogenic differentiation-related genes MyoD1, MyoG and MyHC at the RNA level were detected using qPCR technology. The expression changes of circMYBPCC and myogenic differentiation-related genes MyoD1, MyoG and MyHC at the protein level were detected using Western blotting technology. Myoblasts were seeded into 24-well plates, and transfected and induced to differentiate using the same steps as above. Myotubes were observed and counted using immunofluorescence technology on day 5 of differentiation.

[0121] like Fig.10 As shown in A, after transfection and differentiation induction for 5 days, the transcriptional expression changes of myoblast differentiation-related genes were detected, and it was found that after overexpression of circMYBPCC, the expression of MyoD, MyHC and MyoG was significantly higher than that of the control group. Fig.10 As shown in B, Western blotting detected changes in protein levels, and the expression of MyoD, MyHC and MyoG proteins was also significantly upregulated. After interfering with circMYBPCC, the transcriptional expression of MyoD, MyHC and MyoG ( Fig.11A) and protein expression ( Fig.11 These results indicate that circMYBPCC promotes the differentiation of buffalo myoblasts.

[0122] Then, the differentiated myotubes and myocyte nuclei were stained by immunofluorescence staining ( Fig.12 A). The number of myotubes after overexpression of circMYBPCC was observed and counted. The results showed that after overexpression of circMYBPCC, the number of myotubes in the circMYBPCC overexpression group was significantly increased compared with the control group ( Fig.12 B).

[0123] Example 8: Effects of circMYBPCC administration on muscle damage in mice

[0124] According to the buffalo circMYBPCC sequence in the above example, the mouse circMYBPCC sequence can be determined. We downloaded the mouse MYBPCC gene from NCBI and found a sequence that was highly similar to the buffalo circMYBPCC sequence through homology comparison, with a homology greater than 87%, and the mouse circMYBPCC sequence encoding polypeptide was predicted to have homology with the buffalo circMYBPCC (55%). Therefore, it can be determined that the sequence is a mouse circMYBPCC sequence, and its sequence is shown in SEQ ID NO:3.

[0125] 50mL of CTX solution (10mM) was injected into the tibialis anterior muscle of 5-week-old mice to induce skeletal muscle injury. After 24 hours of CTX treatment, the tibialis anterior muscle tissues of the left hind leg (injected with 50mL of saline) and the right hind leg (injected with 50mL of CTX) of the mice were collected, and the fresh tissues were fixed with 4% formaldehyde solution for 48 hours, and then dehydrated with continuous 10%, 20% and 30% sucrose solutions, and each concentration was dehydrated for 24 hours; embedded and frozen sections were made, and H&E staining was used to analyze the damage. Fig.13 As shown, H&E staining was performed to analyze the damage after sectioning. Compared with the control group, HE staining of tissue sections in the muscle injury model group showed that the gaps between the muscle fibers in the injury group were significantly widened, the muscle fiber morphology was changed, vacuolation occurred, and a large number of inflammatory cells infiltrated.

[0126] 50 μL of nucleic acid complexes containing 20-25 μg pCD2.1-circMYBPCC plasmid and Entransterin vivo transfection reagent were injected into the tibialis anterior muscle of the left hind leg of 8 mice in the experimental group. The control group was injected with 50 μL of nucleic acid complexes containing 20-25 μg pCD2.1 plasmid and Entransterin vivo transfection reagent. The expression levels of circMYBPCC in the two groups of samples at 7 days after muscle injury were detected by qPCR, as shown in Figure 2. Fig.14 As shown in Figure 3, the expression level of circMYBPCC in the circMYBPCC transfection group was significantly higher than that in the control group. Fig.15 As shown, compared with the control group, the number of broken muscle fibers in the circMYBPCC transfection group was significantly reduced 3 days after muscle injury; there were only a few new muscle fibers in the control group 7 days after muscle injury, while most of the damaged muscle fibers in the circMYBPCC transfection group were replaced by new muscle fibers.

[0127] Then, to explore the changes in gene expression of muscle regeneration, qPCR was used to detect the expression of related genes. Fig.16 As shown in A, compared with the control group, the mRNA expression of proliferation and differentiation-related genes (MyOG, MyoD, MyHC and PCNA) in the muscles of mice overexpressing circMYBPCC was significantly increased. Furthermore, western blotting technology was used to detect the expression of related gene protein levels. Fig.16 As shown in B, the protein expression levels of circMYBPCC protein and proliferation and differentiation genes (PCNA, MyoD, and MyoG) were significantly upregulated. In summary, circMYBPCC promoted muscle damage repair in mice and promoted the transcription and protein expression of related genes, and can be used as a nucleic acid drug to treat muscle damage.

[0128] Example 9: Determination of human circMYBPCC sequence

[0129] The human circMYBPCC sequence can be determined by the buffalo circMYBPCC sequence. We downloaded the human MYBPCC gene from NCBI and found a sequence that is highly similar to the buffalo circMYBPCC sequence through homology comparison. The homology is greater than 90%, and the polypeptide encoded by the human circMYBPCC sequence is predicted to have homology with the buffalo circMYBPCC (93%). Therefore, it can be determined that the sequence is a human circMYBPCC sequence. The human circMYBPCC sequence is shown in SEQ ID NO: 4. According to the experimental results of Examples 1-8, it can be inferred that the human circMYBPCC sequence shown in SEQ ID NO: 4 can be used to develop drugs for treating human muscle damage.

[0130] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Use of a codable circRNA related to buffalo skeletal muscle development in the preparation of a drug for treating muscle damage in buffalo and mice, characterized in that: The encodable circRNA is circMYBPCC, and its sequence is shown in SEQ ID NO:

1. Overexpression of circMYBPCC promotes myoblast proliferation and differentiation, while interference with circMYBPCC expression inhibits myoblast proliferation and differentiation.

2. The use of the codable circRNA related to buffalo skeletal muscle development according to claim 1 in the preparation of a drug for treating muscle damage in buffalo and mice, characterized in that: The mouse source sequence of the circMYBPCC is shown in SEQ ID NO:

3.

3. The use of the codable circRNA related to buffalo skeletal muscle development according to claim 1 in the preparation of a drug for treating muscle damage in buffalo and mice, characterized in that: The human sequence of circMYBPCC is shown in SEQ ID NO:

4.

4. Use of the codable circRNA related to buffalo skeletal muscle development according to any one of claims 1 to 3 in the preparation of a drug for treating muscle damage in buffalo and mice, characterized in that: The circMYBPCC forms a circMYBPCC nucleic acid complex with liposomes as a component of a drug for treating muscle damage.

5. Use of the codable circRNA related to buffalo skeletal muscle development according to any one of claims 1 to 3 in the preparation of a drug for treating muscle damage in buffalo and mice, characterized in that: The circMYBPCC and liposome form a circMYBPCC nucleic acid complex as a component of a drug for treating muscle damage, with a dosage of 0.5-2 mg per kilogram of damaged muscle.

6. Use of the codable circRNA related to buffalo skeletal muscle development according to any one of claims 1 to 3 in the preparation of a drug for treating muscle damage in buffalo and mice, characterized in that: The medicine for treating muscle damage is an injection.

Images