Method and kit for determining the content of rc aav in a recombinant adeno-associated viral vector preparation
By combining multiple rounds of cell infection with qPCR to detect rcAAV content, the problems of low detection sensitivity and high cost in existing technologies have been solved, achieving efficient and low-cost detection of rcAAV, which is applicable to recombinant adeno-associated virus vectors of different serotypes.
Patent Information
- Application Number
- CN202211723118.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-30
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2042-12-30
AI Technical Summary
Existing technologies are insufficient for high-sensitivity detection of the content of replicating adeno-associated virus (rcAAV) in recombinant adeno-associated virus vector products, especially rcAAV9, resulting in limited detection sensitivity and high cost.
The rcAAV content was detected by combining multiple rounds of cell infection with qPCR. The presence of rcAAV in the sample was determined by comparing the changes in Ct values before and after multiple rounds of infection. Specific primers and probes were used for detection, and the concentration and dilution ratios of the samples during the infection process were optimized to reduce detection costs.
This method improves the sensitivity of rcAAV detection, reduces detection costs, and is applicable to recombinant adeno-associated virus vectors of different serotypes, achieving efficient and low-cost detection of rcAAV.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of quality testing of recombinant adeno-associated virus (rAAV) vector products. Specifically, this invention relates to a method for determining the rcAAV content in recombinant adeno-associated virus (rAAV) vector products and a detection kit for determining the rcAAV content. Background Technology
[0002] Recombinant adeno-associated virus (rAAV) vectors are non-pathogenic, have low immunogenicity, and good safety profiles. They can transduce a wide variety of tissue cells and stably express their carried genes over a long period. These characteristics make them highly suitable as a tool for in vivo gene transfer. Recombinant adeno-associated virus (rAAV) vectors are viral vectors with high targeting ability and good safety profiles, and have been widely used in gene therapy.
[0003] Currently, the construction of recombinant AAV vectors typically involves replacing the rep and cap genes in the wild-type adeno-associated virus (AAV) genome with the target gene, and then packaging the recombinant genome into infectious viral particles. Recombinant AAV vectors may form replicating adeno-associated virus (rcAAV) during production through homologous or non-homologous recombination between AAV ITRs and the rep and cap gene sequences present in helper components or production cells. Recent animal studies have shown that expression of the cap gene in rcAAV in vivo can trigger a severe immune response, and rcAAV packaged with other DNA impurities also poses a potential risk of tumorigenesis or the introduction of antibiotic resistance. Therefore, components used in the production of recombinant AAV vectors should be designed to eliminate the possibility of rcAAV generation, and clinically used rAAV vector products require rcAAV testing to strictly control rcAAV contamination in rAAV vector products.
[0004] As a product-related impurity in the production process of rAAV vector products, there are currently no clear standard requirements for the limits of rcAAV. The quality standard of recombinant AAV-2 / human coagulation factor IX injection stipulates that the number of rcAAV particles (i.e., the genome copy number) in 1E+06vg of rAAV-hFIX should not exceed 1, and the detection method is PCR (Biotechnology Drug Research and Development and Quality Control (Third Edition)).
[0005] With the development of gene therapy technology, researchers have developed qPCR to detect rcAAV genome copy number. However, qPCR-amplified rcAAV genome does not necessarily possess replication or infectious activity. Therefore, qPCR cannot accurately determine rcAAV content. Furthermore, the detection limit of qPCR is limited by the concentration of rAAV products, making it unable to detect residual rcAAV genome copy number in low-concentration rAAV products, thus limiting its application for quality control of intermediate products during manufacturing.
[0006] For rAAV2 serotype vectors, the infectious center assay can be used to detect replicative rcAAV remnants. Developing an assay for rcAAV in non-rAAV2 serotype vector products is challenging because rcAAV in most non-rAAV2 serotype vector products has been observed to have low infection efficiency in in vitro cultured cells.
[0007] Wright and Zelenaia (“Vector Characterization Methods for Quality Control Testing of Recombinant Adeno-Associated Viruses”, Viral Vectors for Gene Therapy, Chapter 11, edited by Otto-Wilhelm Merten) disclosed a method for detecting rcAAV content in rAAV2 products by collecting cell supernatants after two rounds of cell infection and performing dot hybridization. The detection limit for rcAAV is 1 rcAAV / 1E+06 vg rAAV sample. Specifically, the first round of infection of HEK293 cells was performed in 15×100 mm culture dishes, and the second round of infection of HEK293 cells was performed in 6-well plates. Given the need to add fresh culture medium to supplement the nutrients during cell culture, the volume of virus-infecting liquid added is limited. Therefore, the second round of infection material is 250 μL of the first round harvest supernatant (of which, the first round harvest supernatant totals 10 mL), only 0.25% of the total harvest volume, resulting in limited rcAAV detection sensitivity. The dot hybridization method used to detect rcAAV particles involves adsorbing target DNA onto a nitrocellulose or nylon membrane, then using labeled, sequence-specific probes to hybridize with the DNA fragment inserted into the rcAAV membrane, and finally detecting the DNA using fluorescence or colorimetric methods. However, due to factors such as some components in the hybridization solution interfering with the binding of genomic DNA to the nitrocellulose or nylon membrane, the results can exhibit high variability between experiments.
[0008] Allay JA et al. (“Good Manufacturing Practice Production of Self-Complementary Serotype 8 Adeno-Associated Viral Vector for a Hemophilia BClinical Trial”, Human Gene Therapy, Vol. 22, No. 5, 2011) disclosed a method for detecting rcAAV content in AAV8 products: 293T cells were infected three times with AAV8 products, and the supernatant was harvested for qPCR detection. The detection limit of rcAAV for this method was 1 rcAAV / 2.25E+06vg rAAV sample. From the second round of cell infection onwards, the inoculum used was 1 mL of cell supernatant from the previous round of harvested culture (total 20 mL), accounting for only 5% of the total harvested liquid, which was inoculated into 20 mL of fresh culture medium. After three rounds of infection, the supernatant was harvested, and genomic DNA was isolated using the ArchivePure DNA Isolation Kit (5 PRIME, Gaithersburg, MD). The concentration of rcAAV in each round of samples was then detected by qPCR, and Ct values were calculated and plotted as a line graph. A decreasing Ct value was considered indicative of rcAAV detection. However, this method resulted in a 95% loss of rcAAV in each of the three infection rounds. Adding 1 mL of the harvested cell supernatant to 20 mL of fresh culture medium diluted the rcAAV concentration 20-fold, significantly reducing its infection efficiency in subsequent rounds and greatly increasing the possibility of false negatives, thus limiting the detection sensitivity. Furthermore, the method uses 15 × 100 mm culture dishes, requiring a large 20 mL culture medium volume, which increases the cost of rcAAV detection.
[0009] Because rAAV9 infects and invades cells by binding to the terminal galactose of the asparagine glycan chain of cell surface glycoproteins, most cultured cell types express only a small amount of terminal galactose but highly express sialic acid residues. The abundant sialic acid residues mask the terminal galactose, resulting in poor transduction efficiency of rAAV9 virus in vitro. Currently, no method has been shown for detecting rcAAV9 content in rAAV9 products. Since rAAV9 is less sensitive to cells than rAAV8, and much less sensitive than rAAV2, and qPCR cannot distinguish replicating rcAAV9, detecting rcAAV9 content in rAAV9 products has always been a challenge in this field.
[0010] There is an urgent need in this field to establish a method for detecting the rcAAV content (especially the rcAAV9 content) in recombinant adeno-associated virus vector products, as well as a detection kit for determining the rcAAV content. Summary of the Invention
[0011] The inventors have developed a highly sensitive detection method for recombinant adeno-associated virus (rcAAV) vector products. This method uses qPCR to detect whether the Ct value after multiple rounds (e.g., three, four, or more) of infection is lower than the Ct value after the first round of infection, thus determining whether the test sample contains rcAAV. The method of this invention determines the detection limit for rcAAV by setting a minimum detectable amount of rcAAV in the positive control group.
[0012] In a first aspect, the present invention provides a method for detecting rcAAV content in a recombinant adeno-associated virus vector sample, comprising the following steps:
[0013] (1) Culture cells in a cell culture flask with a capacity of about 4 to 5 mL, such as a T25 culture flask;
[0014] (2) Add the following groups of inoculum to the respective cell culture flasks to perform the first round of cell infection:
[0015] i) Positive control group (PC): helper virus and rcAAV standard, wherein the helper virus is used for the replication of rcAAV standard, and the rcAAV standard is approximately 1E+3vg to 4E+5vg rcAAV, for example, 1E+4vg, 2E+4vg, 4E+4vg, 6E+4vg, 8E+4vg, 1E+5vg, 2E+5vg rcAAV;
[0016] ii) Spike group: This consists of helper virus and rcAAV standard, as well as the test sample. The helper virus is used for the replication of the rcAAV standard, and the rcAAV standard is approximately 1E+3vg to 4E+5vg rcAAV, for example, 1E+4vg, 2E+4vg, 4E+4vg, 6E+4vg, 8E+4vg, 1E+5vg, 2E+5vg rcAAV; the test sample is approximately 1E+08vg to 1E+11vgrAAV, for example, 1E+08vg, 1E+09vg, 1E+10vg, 1E+11vg rAAV.
[0017] iii) Test sample group: for auxiliary virus and test sample, wherein the test sample is approximately 1E+08vg to 1E+11vg rAAV, for example, 1E+08vg, 1E+09vg, 1E+10vg, 1E+11vg rAAV.
[0018] (3) After the first round of infection, freeze-thaw the cells and supernatant in each culture flask, and transfer all the cells and supernatant in each culture flask to separate centrifuge tubes. After inactivation at 56°C, concentrate the solution to 1 mL by ultrafiltration. Take about 500 μL of the concentrate and store it at ≤-70°C for qPCR detection. Take another 500 μL of the concentrate as the inoculum for the next round of infection.
[0019] (4) Add approximately 500 μL of concentrated solution obtained after the first round of infection to approximately 4 mL of fresh culture medium for the second round of cell infection. Similar to step (3), 1 mL of ultrafiltration concentrate is obtained from each culture flask and used entirely for the next round of infection.
[0020] (5) The third round of infection (optional, the fourth round of infection) is performed in the same way as the second round of infection; after the third round of infection (optional, the fourth round of infection) is completed, 1 mL of ultrafiltration concentrate from each culture flask is used for qPCR detection.
[0021] (6) After completing three rounds (optionally four rounds) of infection, DNA was extracted from the ultrafiltration concentrate harvested from the first and last rounds of infection and used as a DNA template for qPCR. Specific primers and Taqman probes were designed using the Rep gene as a template for qPCR detection.
[0022] (7) Results analysis and judgment:
[0023] If the positive control group (PC) has the mean Ct value in the first round > the mean Ct value in the last round;
[0024] Spike group: The mean Ct value in the first round is greater than the mean Ct value in the last round;
[0025] Furthermore, for the tested sample group (Test): the mean Ct value in the first round is less than the mean Ct value in the last round, then the rcAAV content in the tested sample is: less than the amount of rcAAV standard added / the amount of rAAV sample added (vg).
[0026] If the positive control group (PC) has a first-round mean Ct value greater than the last-round mean Ct value;
[0027] Spike group: The mean Ct value in the first round is greater than the mean Ct value in the last round;
[0028] If the mean Ct value of the first round of the test sample group (Test) is greater than the mean Ct value of the last round, then the test sample needs to be further diluted and the detection steps (1) to (6) are implemented until the mean Ct value of the first round of the test sample group (Test) is less than the mean Ct value of the last round. Then the rcAAV content in the test sample is: rcAAV standard added amount / diluted rAAV sample added amount (vg).
[0029] In one embodiment, the method for detecting rcAAV content in a recombinant adeno-associated virus vector sample of the present invention includes the following steps:
[0030] (1) Culture cells in a cell culture flask with a capacity of about 4 to 5 mL, such as a T25 culture flask;
[0031] (2) Add the following groups of inoculum to each of the two cell culture flasks described above to perform the first round of cell infection:
[0032] i) Positive control group (PC): helper virus and rcAAV standard, wherein the helper virus is used for the replication of rcAAV standard, and the rcAAV standard is approximately 1E+3vg to 4E+5vg rcAAV, for example, 1E+4vg, 2E+4vg, 4E+4vg, 6E+4vg, 8E+4vg, 1E+5vg, 2E+5vg rcAAV;
[0033] ii) Spike group: This consists of helper virus and rcAAV standard, as well as the test sample. The helper virus is used for the replication of the rcAAV standard, and the rcAAV standard is approximately 1E+3vg to 4E+5vg rcAAV, for example, 1E+4vg, 2E+4vg, 4E+4vg, 6E+4vg, 8E+4vg, 1E+5vg, 2E+5vg rcAAV; the test sample is approximately 1E+08vg to 1E+11vgrAAV, for example, 1E+08vg, 1E+09vg, 1E+10vg, 1E+11vg rAAV.
[0034] iii) Test sample group: for auxiliary virus and test sample, wherein the test sample is approximately 1E+08vg to 1E+11vg rAAV, for example, 1E+08vg, 1E+09vg, 1E+10vg, 1E+11vg rAAV.
[0035] (3) After the first round of infection, freeze-thaw the cells and supernatant in the two culture flasks of each group, and transfer all the cells and supernatant in each culture flask to separate centrifuge tubes. After inactivation at 56°C, the cells and supernatant in each flask are concentrated to 1 mL by ultrafiltration. The concentrate of one culture flask is stored at ≤-70°C for qPCR detection. The concentrate of the other culture flask is used as the inoculum for the next round of infection.
[0036] (4) Add about 1 mL of concentrated solution obtained after the first round of infection to about 4 mL of fresh culture medium to carry out the second round of infection of cells in a cell culture flask with a capacity of about 4 to 5 mL in each group. Similar to step (3), 1 mL of ultrafiltration concentrate is obtained from each culture flask and used entirely for the next round of infection.
[0037] (5) The third round of infection (optional, the fourth round of infection) is performed in the same way as the second round of infection; after the third round of infection (optional, the fourth round of infection) is completed, 1 mL of ultrafiltration concentrate from each culture flask is used for qPCR detection.
[0038] (6) After completing three rounds (optionally four rounds) of infection, DNA was extracted from the ultrafiltration concentrate harvested from the first and last rounds of infection and used as a DNA template for qPCR. Specific primers and Taqman probes were designed using the Rep gene as a template for qPCR detection.
[0039] (7) Results analysis and judgment:
[0040] If the positive control group (PC) has a first-round mean Ct value greater than the last-round mean Ct value;
[0041] Spike group: The mean Ct value in the first round is greater than the mean Ct value in the last round;
[0042] Furthermore, for the tested sample group (Test): the mean Ct value in the first round is less than the mean Ct value in the last round, then the rcAAV content in the tested sample is: less than the amount of rcAAV standard added / the amount of rAAV sample added (vg).
[0043] If the positive control group (PC) has a first-round mean Ct value greater than the last-round mean Ct value;
[0044] Spike group: The mean Ct value in the first round is greater than the mean Ct value in the last round;
[0045] If the mean Ct value of the first round of the test sample group (Test) is greater than the mean Ct value of the last round, then the test sample needs to be further diluted and the detection steps (1) to (6) are implemented until the mean Ct value of the first round of the test sample group (Test) is less than the mean Ct value of the last round. Then the rcAAV content in the test sample is: rcAAV standard added amount / diluted rAAV sample added amount (vg).
[0046] In one embodiment, the infected cells used in the method of the present invention are selected from Vero, HEK-293, Hela, and BHK-21 cells.
[0047] In one embodiment, the method of the present invention infects cells four or more times, for example, five, six, seven, or eight times, thereby further reducing the amount of detectable rcAAV.
[0048] In one embodiment, the recombinant adeno-associated virus vector sample detected by the method of the present invention is an AAV virus vector sample of different serotypes, such as AAV1, AAV2, AAV5, AAV8, AAV9, and AAVDJ virus vector samples.
[0049] In some embodiments, the culture medium used to culture cells in the method of the present invention is RPMI 1640 or DMEM medium containing 10% fetal bovine serum, but is not limited thereto.
[0050] In some embodiments, the helper virus used in the method of the present invention is an adenovirus or herpes simplex virus, which infects cells with an MOI of 2 to 5.
[0051] In some embodiments, the method of the present invention uses the specific primers shown in SEQ ID NO: 1 and 2 and the Taqman probe shown in SEQ ID NO: 3 to perform qPCR.
[0052] In a second aspect, the present invention provides a kit for detecting the rcAAV content in a recombinant adeno-associated virus vector sample, comprising:
[0053] (1) Helper viruses, such as AdV-EGFP;
[0054] (2) rcAAV standard;
[0055] (3) The rep2 gene-specific primers shown in SEQ ID NO: 1 and 2 and the Taqman probe shown in SEQ ID NO: 3.
[0056] In some embodiments, the kit of the present invention for detecting rcAAV content in recombinant adeno-associated virus vector samples further comprises:
[0057] (4) rAAV vector-sensitive cells, such as BHK-21 cells, HEK-293, Hela, Vero and / or A549 cells.
[0058] The effects of the invention
[0059] The present invention has the following beneficial technical effects:
[0060] Firstly, the rcAAV detection method of the present invention uses a culture container such as a T25 culture flask, and the required culture medium volume is about 4 mL to 5 mL, which greatly reduces the amount of rAAV product and culture medium required for rcAAV detection, and effectively saves detection costs.
[0061] Secondly, in the detection method of Ally JA et al., starting from the second round of cell infection, the inoculum is 1 mL of the previous round of cell culture supernatant (total 20 mL), resulting in a 95% loss of rcAAV during this process. Furthermore, adding this 1 mL of supernatant to 20 mL of fresh culture medium further dilutes the rcAAV concentration by 20 times, reducing the infection efficiency of rcAAV. In contrast, the preferred inoculum for the second and subsequent rounds of cell infection in this invention is a concentrated solution of all cell culture supernatant (total 1 mL), theoretically eliminating any rcAAV loss. This invention adds this 1 mL of concentrated solution to approximately 4 mL of fresh cell culture medium, resulting in a 5-fold dilution of the rcAAV concentration. This fundamentally solves the problem of rcAAV loss in multiple rounds of cell infection in existing technologies, improves the detection sensitivity of rcAAV, and can be infinitely increased by increasing the number of infection rounds.
[0062] In one embodiment, the present invention performed four rounds of infection, achieving a detection limit of 2 rcAAV9 / 1E+07vg rAAV9 samples, comparable to reported cellular methods for detecting rcAAV2 and rcAAV8. Theoretically, further increasing the number of amplification rounds could further improve the detection limit. Furthermore, increasing the number of initial T25 vials could further reduce the detectable rcAAV content, thereby improving detection sensitivity.
[0063] Thirdly, this invention designs qPCR primers and probes using the rep2 gene as a template, which are suitable for determining the rcAAV content in rAAV vector products with all different shell serotypes but all of which are rep2.
[0064] Fourth, the detection method of this invention uses multiple rounds of cell infection to amplify rcAAV, and then uses qPCR to detect rcAAV. Compared with the method using qPCR alone, it can detect rcAAV with replication capability, which is of greater significance for the safety evaluation of clinical rAAV vector drugs.
[0065] Fifth, the method of the present invention, after replacing the standard rcAAV with the standard rcAAV of the corresponding serotype, is also applicable to the detection of residual rcAAV content in other AAV serotypes. Detailed Implementation
[0066] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. Furthermore, the materials, methods, and examples described herein are illustrative only and are not intended to be limiting. Other features, objects, and advantages of the invention will become apparent from this specification and the appended claims.
[0067] I. Definition
[0068] To explain this specification, the following definitions will be used, and terms used in the singular may also include plural forms, where appropriate. It should be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be restrictive.
[0069] The term “about” when used in conjunction with a numeric value means to encompass a range of numeric values that have a lower limit of 5% less than the specified numeric value and an upper limit of 5% greater than the specified numeric value.
[0070] As used herein, the term “and / or” means any one of the options or two or more of the options.
[0071] In this document, when the terms “comprising” or “including” are used, unless otherwise specified, they also cover situations where the elements, integers, or steps mentioned are constituted.
[0072] The terms “recombinant adeno-associated virus vector,” “adeno-associated virus vector,” “AAV vector,” and “rAAV vector” are used interchangeably herein. They refer to efficient exogenous gene transfer tools used to modify wild-type AAV viruses, based on our understanding of the AAV life cycle and its associated molecular biological mechanisms. A viral vector comprises a vector genome and a protein capsid. The viral capsid can be provided by any AAV serotype known in the field, including currently identified human and non-human AAV serotypes and those yet to be identified (see: Choi VW et al. 2005, Schmidt et al. 2008). The viral capsid can be mixed and matched with other vector components to form a hybrid viral vector; for example, the ITR and capsid of a viral vector can be derived from different AAV serotypes. In one instance, the ITR may be derived from the AAV2 serotype, while the capsid may be derived from, for example, the AAV2 or AAV9 serotype. In addition, those skilled in the art should recognize that the carrier capsid may also be a mosaic capsid (e.g., a capsid composed of a mixture of capsid proteins from different serotypes) or even a chimeric capsid (e.g., a capsid protein containing foreign or unrelated protein sequences for generating markers and / or altering tissue orientation).
[0073] The term "replication-competent adeno-associated virus (rcAAV)" refers to adeno-associated viruses capable of replication in the presence of helper viruses such as adenovirus and herpes simplex virus. During the production of recombinant AAV vector products, AAV ITRs may form rcAAV as impurities through homologous or non-homologous recombination with the rep and cap gene sequences present in the helper components or production cells.
[0074] The term "vector genomes (vg)" refers to the nucleic acid sequences packaged within the rAAV capsid to form an rAAV vector. The rAAV vector genome contains only the ITR sequence of the AAV virus and an expression cassette carrying the foreign gene to be transported. The Rep and Cap proteins required for AAV virus packaging are provided by other exogenous plasmids or helper viruses, thereby reducing the potential harm caused by the packaging of the Rep and Cap genes into the rAAV vector. Furthermore, the AAV virus itself is not pathogenic, making the rAAV vector one of the most recognized safest viral vectors. Deleting the D and trs sequences from one side of the AAV virus's ITR sequence allows the genome carried by the resulting recombinant adeno-associated virus vector to self-complement, forming a double strand, significantly improving the in vivo and in vitro transduction efficiency of the rAAV vector (Wang Z et al.). Gene Ther 2003;10(26):2105-2111; McCarty DM et al., Gene Ther 2003;10(26):2112-2118). The resulting virus is called scAAV (self-complementary AAV), also known as double-stranded AAV. It is different from ssAAV (single-stranded AAV), which has no mutations in either ITR, and is the traditional AAV virus.
[0075] The scAAV viral vector has a smaller packaging capacity, only half that of the ssAAV viral vector, approximately 2.2kb-2.5kb, but it has a higher transduction efficiency after infecting cells.
[0076] As used herein, the term "ITR" or "inverted terminal repeat sequence" refers to a nucleic acid sequence present in AAV and / or rAAV that can form a T-shaped palindromic structure, which is usually necessary for the completion of AAV cleavage and latency life cycle.
[0077] As used herein, the terms "rep gene product" and "Rep protein" are used interchangeably. The AAV rep gene region encodes four Rep proteins: Rep78, Rep68, Rep52, and Rep40. Rep proteins play important roles in AAV viral replication, integration, rescue, and packaging. Among them, Rep78 and Rep68 specifically bind to the terminal unwinding sites trs and GAGY repeat motifs in the ITR, initiating the replication process of the AAV genome from single-stranded to double-stranded. The trs and GAGC repeat motifs and / or GAGY repeat motifs in the ITR are central to AAV genome replication; therefore, although the ITR sequence varies among different serotypes of AAV, they all form hairpin structures and contain Rep binding sites.
[0078] As used herein, the terms "cap gene product" and "Cap protein" are used interchangeably. The AAV cap gene encodes the AAV viral capsid proteins VP1, VP2, and VP3. VP3 has the smallest molecular weight but is the most abundant; in mature AAV particles, the ratio of VP1, VP2, and VP3 is approximately 1:1:10. VP1 is essential for the formation of infectious AAV; VP2 assists VP3 in entering the cell nucleus; VP3 is the major protein constituting the AAV particle.
[0079] The term "Multiplicity of Infection (MOI)" originated from studies of bacteriophage infection of bacteria, initially referring to the average number of phages per bacterium. MOI was determined by dividing the number of added phages by the number of added bacteria. MOI gives the average number of phages per bacterium, which can be 0.1, 1, 2, 10, etc., depending on the experimental design. Now, MOI is more broadly defined as the ratio of the number of viruses to the number of cells at the time of infection. For example, adding 10 million viruses to 1 million cells results in an MOI of 10.
[0080] The term "plaque forming unit (PFU)," also known as plaque-forming unit, is a unit for measuring viruses (or bacteriophages), but it is only used for viruses capable of producing plaques. The principle is as follows: when a small amount of virus capable of destroying host cells is used to infect a population of host cells that has formed a dense monolayer, after a certain incubation period, the cells surrounding each infected cell gradually break down, forming visible plaques (which can be observed directly with bacteriophages, but require live staining with viruses). Theoretically, one virus can form one plaque. The method of measuring viruses using PFU is called the PFU method. The number of plaque forming units or infection centers usually refers to the PFU value.
[0081] Viral titer, also known as viral potency, virulence, or toxicity, is the concentration of a viral suspension. The unit for viral titer is generally expressed as PFU / ml.
[0082] In some implementations, the MOI value is calculated as: viral titer (PFU / mL) × viral volume (mL) / number of cells.
[0083] The cycle threshold (Ct) is defined as the number of amplification cycles required for the fluorescence signal of the amplified product to reach a predetermined fluorescence threshold during qPCR amplification. Genes in qPCR are exponentially amplified and accumulated after a certain number of cycles. The Ct value ranges from 15 to 35. A Ct value less than 15 indicates that the amplification is within the baseline range and has not reached the fluorescence threshold. Ideally, the Ct value has a linear relationship with the logarithm of the initial template copy number, which is the standard curve. The higher the initial template concentration, the smaller the Ct value; the lower the initial template concentration, the larger the Ct value. Using the standard curve, when the amplification efficiency is 100%, the Ct value for quantifying the single copy number of the gene is around 35. If it is greater than 35, theoretically, the initial template copy number is less than 1, which can be considered meaningless.
[0084] II. Method for determining rcAAV content in recombinant adeno-associated virus vector products of the present invention
[0085] Recombinant adeno-associated virus (rAAV)-based vectors expressing therapeutic gene products show great promise for human gene therapy. A major challenge in translating this promising research into clinical development is establishing appropriate quality control (QC) testing methods to characterize clinical-grade rAAV vectors. The method of this invention is used for quality control testing of rAAV vector products, facilitating the assessment of rAAV vector safety.
[0086] During the production of recombinant AAV vectors, these vectors may form replicative adeno-associated virus (rcAAV) through homologous or non-homologous recombination between AAV ITRs and the rep and cap gene sequences present in helper components or production cells. Recent animal studies have shown that expression of the cap gene in rcAAV in vivo can trigger a severe immune response, and rcAAV packaged with other DNA impurities also poses a potential risk of tumorigenicity or the introduction of antibiotic resistance. Therefore, strict control of rcAAV contamination in rAAV vector products is necessary.
[0087] For rAAV2-type vector products, the infectious center assay can be used to detect replicative rcAAV remnants. Developing an rcAAV assay for non-rAAV2 serotypes is challenging because most non-rAAV2 serotype vector products have been observed to have low infection efficiency in in vitro cultured cells.
[0088] This invention provides a method for detecting rcAAV in non-rAAV2 serotypes. Even for rcAAV9, which has the lowest infection efficiency in cultured cells, the method of this invention can achieve a detection sensitivity of 2 rcAAV / 1E+07vg rAAV9 sample.
[0089] In one embodiment, the present invention provides a method for the relative quantitative detection of rcAAV9 content in rAAV9 products, comprising the following steps:
[0090] (1) HEK293 cells in logarithmic growth phase were seeded at 1.2E+6 cells / flask in T25 cell culture flasks and cultured overnight at 37°C with 5% CO2 in 4 mL of DMEM medium containing 10% fetal bovine serum. On the second day, when the cell density reached 90% confluence, the culture supernatant was discarded and replaced with 4 mL of fresh DMEM medium containing 10% fetal bovine serum.
[0091] (2) Add the following groups of inoculum to their respective T25 culture flasks for the first round of cell infection:
[0092] i) Negative control group 1 (NC1): AdV-EGFP (MOI=2.5), without rcAAV9;
[0093] ii) Negative control group 2 (NC2): No AdV-EGFP, rcAAV9 1E+5vg;
[0094] iii) Positive control group (PC): AdV-EGFP (MOI=2.5), rcAAV9 1E+5vg;
[0095] iv) Spike control group: AdV-EGFP (MOI=2.5), rcAAV9 1E+5vg, rAAV9 sample 1E+11vg; v) Test sample: AdV-EGFP (MOI=2.5), rAAV9 sample 1E+11vg.
[0096] After adding the above inoculum groups, the cells were cultured at 5% CO2 and 37°C for 48 hours.
[0097] (3) After the first round of infection, the T25 culture flasks were sealed with sealing film, and after three freeze-thaw cycles, all cells and supernatant were lysed and transferred to separate centrifuge tubes. Cells were inactivated at 56°C for 1 hour, centrifuged at 4000g for 10 min, and the supernatant was centrifuged at 4000g for approximately 30 min through a 5mL 100KD ultrafiltration tube to concentrate to 1mL. 500μL of the concentrate was stored at ≤-70°C for qPCR detection. Another 500μL of the concentrate was used as the inoculum for the next round of infection.
[0098] (4) Second round of infection: HEK293 cells in logarithmic growth phase were seeded at 1.2E+6 cells / flask in T25 cell culture flasks and cultured overnight at 37°C with 5% CO2 in 4 mL of DMEM medium containing 10% fetal bovine serum. The cell density reached 90% on the second day.
[0099] Add 500 μL of the concentrated solution obtained after the first round of infection to 4 mL of fresh DMEM medium containing 10% fetal bovine serum. Add the solution to HEK293 cells with a cell density of 90%, and incubate at 37°C with 5% CO2 for 48 hours for the second round of cell infection. Similar to step (3), 1 mL of ultrafiltration concentrate is obtained from each culture flask and used entirely for the next round of infection;
[0100] (5) The third and fourth rounds of infection were performed in the same manner as the second round of infection; after the fourth round of infection, 1 mL of ultrafiltration concentrate was obtained from each culture flask and used for qPCR detection.
[0101] (6) After completing four rounds of infection, DNA was extracted from the ultrafiltration concentrate harvested from the first and fourth rounds of infection and used as a DNA template for qPCR. Specific primers and Taqman probes were designed using the Rep gene as a template for qPCR detection.
[0102] (7) Results analysis and judgment:
[0103] a) Negative control group 1 (NC1): Ct values were negative in both the first and fourth rounds of testing;
[0104] b) Negative control group 2 (NC2): mean Ct value in the first round < mean Ct value in the fourth round;
[0105] c) Positive control group (PC): Mean Ct value in the first round > Mean Ct value in the fourth round;
[0106] d) Spike control group 1: Mean Ct value in the first round > Mean Ct value in the fourth round;
[0107] If a)-d) are satisfied simultaneously, and the mean Ct value of the first round of the Test group is < the mean Ct value of the fourth round, then the rcAAV content in the tested sample is: <1 rcAAV / 1E+6vg rAAV sample;
[0108] If conditions a)-d) are met simultaneously, and the mean Ct value of the first round of the Test group is greater than the mean Ct value of the fourth round, then the rAAV sample needs to be further diluted and retested until the mean Ct value of the first round of the Test group is less than the mean Ct value of the fourth round. Then the rcAAV content in the tested sample is: 1E+5 rcAAV / amount of diluted rAAV sample added (vg).
[0109] In another embodiment, the present invention provides a method for the relative quantitative detection of rcAAV9 content in rAAV9 products, comprising the following steps:
[0110] (1) HEK293 cells in logarithmic growth phase were seeded at 1.2E+6 cells / flask in T25 cell culture flasks and cultured overnight at 37°C with 5% CO2 in 4 mL of DMEM medium containing 10% fetal bovine serum. On the second day, when the cell density reached 90% confluence, the culture supernatant was discarded and replaced with 4 mL of fresh DMEM medium containing 10% fetal bovine serum.
[0111] (2) Add the following groups of inoculum to two T25 culture flasks each to perform the first round of cell infection:
[0112] i) Negative control group 1 (NC1): AdV-EGFP (MOI=2.5), without rcAAV9
[0113] ii) Negative control group 2 (NC2): No AdV-EGFP, rcAAV9 2E+4vg
[0114] iii) Positive control group (PC): AdV-EGFP (MOI=2.5), rcAAV9 2E+4vg
[0115] iv) Spiked control group (Spike): AdV-EGFP (MOI=2.5), rcAAV9 2E+4vg, rAAV9 sample 1E+11vg
[0116] v) Test sample: AdV-EGFP (MOI=2.5), rAAV9 sample 1E+11vg
[0117] After adding the above inoculum groups, the cells were cultured at 5% CO2 and 37°C for 48 hours.
[0118] (3) After the first round of infection, the two T25 culture flasks from each group were sealed with sealing film, and after three freeze-thaw cycles, all cells and supernatant were lysed and transferred to separate centrifuge tubes. The cells were inactivated at 56°C for 1 hour, centrifuged at 4000g for 10 min, and the supernatant was centrifuged at 4000g for about 30 min through a 5mL 100KD ultrafiltration tube to concentrate to 1mL. The concentrate from one T25 culture flask was stored at ≤-70°C for qPCR detection; the concentrate from the other T25 culture flask was used as the inoculum for the next round of infection.
[0119] (4) Second round of infection: HEK293 cells in logarithmic growth phase were seeded at 1.2E+6 cells / flask in T25 cell culture flasks and cultured overnight at 37°C with 5% CO2 in 4 mL of DMEM medium containing 10% fetal bovine serum. The cell density reached 90% on the second day.
[0120] Approximately 1 mL of the concentrated solution obtained after the first round of infection was added to 4 mL of fresh DMEM medium containing 10% fetal bovine serum. This was then added to HEK293 cells at a cell density of 90%, and cultured at 37°C with 5% CO2 for 48 hours for the second round of cell infection. Similar to step (3), 1 mL of ultrafiltration concentrate was obtained from each culture flask and used entirely for the next round of infection.
[0121] (5) The third and fourth rounds of infection were performed in the same manner as the second round of infection; after the fourth round of infection, 1 mL of ultrafiltration concentrate was obtained from each culture flask and used for qPCR detection.
[0122] (6) After completing four rounds of infection, DNA was extracted from the ultrafiltration concentrate harvested from the first and fourth rounds of infection and used as a DNA template for qPCR. Specific primers and Taqman probes were designed using the Rep gene as a template for qPCR detection.
[0123] (7) Results analysis and judgment:
[0124] a) Negative control group 1 (NC1): Ct values were negative in both the first and fourth rounds of testing.
[0125] b) Negative control group 2 (NC2): Mean Ct value in the first round < Mean Ct value in the fourth round
[0126] c) Positive control group (PC): Mean Ct value in the first round > Mean Ct value in the fourth round
[0127] d) Spike control group 1: Mean Ct value in the first round > Mean Ct value in the fourth round
[0128] If a)-d) are satisfied simultaneously, and the mean Ct value of the first round of the Test group is < the mean Ct value of the fourth round, then the rcAAV content in the tested sample is: <2 rcAAV / 1E+07vg rAAV sample;
[0129] If a)-d) are satisfied simultaneously, and the mean Ct value of the first round of the Test group is greater than the mean Ct value of the fourth round, then the rAAV sample needs to be further diluted and retested until the mean Ct value of the first round of the Test group is less than the mean Ct value of the fourth round. Then the rcAAV content in the tested sample is: 2E+4 rcAAV / amount of diluted rAAV sample added (vg).
[0130] In some embodiments, the method for detecting rcAAV9 content in rAAV9 products can also be used to detect the corresponding rcAAV content in rAAV viral vector samples of other serotypes. Other serotypes of rAAV viral vector samples include, but are not limited to, for example, rAAV1, rAAV2, rAAV5, rAAV8, rAAV9, and rAAVDJ viral vector samples.
[0131] III. The reagent kit of the present invention
[0132] The present invention also provides a kit for detecting the rcAAV content in recombinant adeno-associated virus vector samples, comprising:
[0133] (1) Helper viruses, such as AdV-EGFP;
[0134] (2) rcAAV standard;
[0135] (3) The rep2 gene-specific primers shown in SEQ ID NO: 1 and 2 and the Taqman probe shown in SEQ ID NO: 3.
[0136] In one embodiment, the kit of the present invention for detecting rcAAV content in a recombinant adeno-associated virus vector sample further comprises:
[0137] (4) rAAV vector-sensitive cells, such as BHK-21 cells, HEK-293, Hela, Vero, and A549 cells.
[0138] The kit enables the implementation of the method of the present invention for detecting rcAAV content in recombinant adeno-associated virus vector samples.
[0139] Example
[0140] Materials and methods
[0141] Virus: rAAV9 vector sample (also referred to as "rAAV9 sample"): As described in CN111088284, rAAV9 was produced by co-infecting Sf9 cells with two baculoviruses. One baculovirus carried the rep2 and cap9 gene expression cassettes of AAV, while the other carried the ITR sequence of the rAAV vector and the expression cassette of the exogenous target gene. The Bac-to-AAV system is a patent of Virovek, Inc., USA. Approximately 72 hours after co-infection of Sf9 cells with the two baculoviruses, the supernatant was collected by centrifugation. Sf9 cells were lysed with cell lysis buffer, and after centrifugation to remove the cell pellet, the lysate was combined with the supernatant and subjected to two rounds of CsCl density gradient ultracentrifugation. The rAAV9 vector band was then extracted, and tangential flow ultrafiltration was performed for concentration and medium exchange to obtain the rAAV9 vector product.
[0142] rAAV5 vector sample (also referred to as "rAAV5"): Preparation is similar to that of the rAAV9 vector sample. Sf9 cells are co-infected with two baculoviruses to package and produce rAAV5. One baculovirus carries the rep2 and cap5 gene expression cassettes of AAV, while the other carries the ITR sequence of the rAAV vector and the exogenous target gene expression cassette. The Bac-to-AAV system is patented by Virovek, Inc. Approximately 72 hours after co-infection with the two baculoviruses, the supernatant is collected by centrifugation. Sf9 cells are lysed with cell lysis buffer, and after centrifugation to remove the cell pellet, the lysate is combined with the supernatant and subjected to two rounds of CsCl density gradient ultracentrifugation. The rAAV5 vector band is then extracted, followed by tangential flow ultrafiltration for concentration and medium exchange to obtain the rAAV5 vector product.
[0143] rAAV2-EGFP, rAAV5-EGFP, rAAV8-EGFP, and rAAV9-EGFP vector samples: The recombinant AAV virus vector samples were prepared using the three-plasmid method. Specifically, the AAV vector plasmid (pAAV2neo-EGFP), the helper plasmid (pHelper) (AAV Helper Free System, Agilent Technologies), and the corresponding Rep and Cap protein expression plasmids (pAAV-RC) for AAV2, AAV5, AAV8, and AAV9 serotypes were mixed at a molar ratio of 1:1:1 and transfected into suspended HEK293T cells using the PEI method. After approximately 48 hours of transfection, the cells and culture supernatant were harvested and purified according to the rAAV vector purification method reported by Wu Xiaobing et al. (Wu, X. et al., A novel method for purification of recombinant adenoassociated virus vectors on a large scale. Chinese Science Bulletin, 2001. 46(6): p. 485-488) to obtain recombinant AAV viral vector samples rAAV2-EGFP, rAAV5-EGFP, rAAV8-EGFP, and rAAV9-EGFP.
[0144] The rcAAV9 virus standard (also referred to as "rcAAV9") was prepared by co-transfection of HEK-293T cells with two plasmids. The Rep2 and Cap9 gene sequences of AAV were inserted into pAAV-MCS (AAV Helper Free Systeme Agilent Technologies) to obtain the AAV vector plasmid pAAV-rep2-cap9. pAAV-rep2-cap9 was then co-transfected with the helper plasmid pHelper (AAV Helper Free Systeme Agilent Technologies) into suspended HEK-293T cells. After 48 hours of transfection, the cells and culture supernatant were harvested, and the rcAAV9 virus was purified by PEG / NaCl precipitation and chloroform extraction.
[0145] The rcAAV2 virus standard (also referred to as "rcAAV2") was prepared by co-transfection of HEK-293T cells with two plasmids. The Rep2 and Cap2 gene sequences of AAV were inserted into pAAV-MCS (AAV Helper Free Systeme Agilent Technologies) to obtain the AAV vector plasmid pAAV-rep2-cap2. pAAV-rep2-cap2 was then co-transfected with the helper plasmid pHelper (AAV Helper Free Systeme Agilent Technologies) into suspended HEK-293T cells. Approximately 48 hours after transfection, the cells and culture supernatant were harvested, and the rcAAV2 virus was purified by PEG / NaCl precipitation and chloroform extraction.
[0146] AdV5-EGFP helper virus: Prepared using the AdMAX adenovirus system (Microbix Biosystems Inc., Canada, containing pBHGlox(delta)E13Cre and pDC316 plasmids). First, the EGFP gene (EGFP: enhanced green fluorescent protein) was inserted into the shuttle plasmid pDC316 to obtain pDC316-EGFP. Then, HEK293 cells were co-infected with the adenovirus genomic backbone plasmid pBHGlox(delta)E13Cre and the shuttle plasmid pDC316-EGFP to obtain the AdV5-EGFP adenovirus seed. The seed was amplified in suspended HEK293 cells to obtain the AdV5-EGFP virus.
[0147] Herpes simplex virus type (HSV)-EGFP helper virus: Vero cells in logarithmic growth phase grow at 2.5 × 10⁻⁶. 6 Cells / ml were seeded into T25 culture flasks. After culturing in DMEM medium containing 10% fetal bovine serum for approximately 24 h, Vero cells were infected with the HSV-EGFP virus at MOI=1. Cells and culture supernatant were harvested after 48-72 h of further culture, followed by three freeze-thaw cycles, centrifugation, and collection of the supernatant. The supernatant was crudely purified and concentrated by anion exchange chromatography, then further purified using molecular sieves and aliquoted, and stored at -80°C. The HSV-EGFP virus was donated by Professor Wu Xiaobing of the Beijing Institute of Acanthopanax senticosus and Molecular Medicine.
[0148] Cells: Vero cells, HEK-293 cells, HeLa cells, and BHK-21 cells were all obtained from the ATCC cell bank in the United States.
[0149] Reagent: Fetal bovine serum: purchased from Excell Bio (Catalog No.: FCS500).
[0150] Cell lysis buffer: 1 mL of 0.05% Tween 20, 2 mL of proteinase K buffer, 400 μL of 10 mg / mL proteinase K, and 125 μL of bile salt were added to 5.675 mL of pure water.
[0151] DNA extraction kit: DNeasy Blood & Tissue Kit, purchased from QIAGEN, Cat. 69504.
[0152] TaqMan® Universal Master Mix II, with UNG, 2×: purchased from Thermo Fisher Scientific.
[0153] DNAase I: Purchased from TaKaRa, catalog number: 2270.
[0154] Upstream and downstream primers and probes: GQP-6-F: GTTTACGCACCCGTAGAAG (SEQ ID NO: 1); GQP-6-R: AACTACCGGGAAGACCAAC (SEQ ID NO: 2); GQP-6-P: TGCCGGAGGCCATAGCCCACA (SEQ ID NO: 3).
[0155] Example 1: Preliminary optimized method for detecting rcAAV5 impurity content in rAAV5 samples
[0156] Since AAV2 and AAV5 have comparable sensitivity to infecting HEK293 cells, this embodiment uses a preliminarily optimized method to detect the residual amount of rcAAV5 impurities in rAAV5 samples, with the group containing "rcAAV2 standard and AdV5-EGFP" as a positive control.
[0157] As described in "Materials and Methods", AdV5-EGFP (AD001) batch number: A2012031301B, with a genomic titer of 1E+12 vg / mL and 5E+9 PFU / mL was prepared; rcAAV2 standard (MH119) batch number: A2019122801, with a titer of 2.76E+11 vg / mL was prepared; and AAV5 sample batch number: 2021032202, with a titer of 4E+13 vg / mL was prepared.
[0158] HEK293 cells in logarithmic growth phase were seeded at 1.2E+ 6 cells / flask in 5 T25 cell culture flasks and cultured overnight in approximately 4 mL of DMEM medium containing 10% fetal bovine serum. On the second day, when the cell density reached 90% confluence, the cell culture supernatant was discarded, and the medium was replaced with approximately 4 mL of fresh DMEM medium containing 10% fetal bovine serum. Approximately 1 mL of each inoculum was added according to the following groups:
[0159] i) Negative control group 1 (NC1): only AdV5-EGFP (MOI=2.5), no rcAAV2;
[0160] ii) Negative control group 2 (NC2): No AdV5-EGFP, only rcAAV2 1E+3vg;
[0161] iii) Positive control group (PC): AdV5-EGFP (MOI=2.5), rcAAV2 1E+3vg;
[0162] vi) Spike group: AdV5-EGFP (MOI=2.5), rcAAV2 1E+3vg, rAAV5 sample 1E+11vg;
[0163] v) Test sample group: AdV5-EGFP (MOI=2.5), rAAV5 sample 1E+11vg.
[0164] Five T25 cell culture flasks were cultured at 37°C in a 5% CO2 incubator for 48 hours after the samples were added. After the culture was completed, the T25 culture flasks were sealed with sealing film, and after three freeze-thaw cycles, all cells and supernatant were transferred to separate centrifuge tubes and centrifuged at 3000g for 10 minutes.
[0165] Take about 2 mL of supernatant and store it at ≤-70℃ for later use. After inactivating the helper virus by incubating the remaining about 2 mL of supernatant at 56℃ for 1.5 h, take 1 mL as the inoculum for the second round of infection and repeat the above process.
[0166] Similarly, after the second round of infection, the cells were cultured at 37°C in a 5% CO2 incubator for 48 hours. 2 mL of the supernatant was collected and stored at ≤-70°C for later use. The remaining 2 mL of supernatant was inactivated with helper virus at 56°C for 1.5 hours, and 1 mL was used as the inoculum for the third round of infection, repeating the above process. After the third round of infection and culture, the supernatants harvested from the three rounds were simultaneously lysed using cell lysis buffer (1 mL of 0.05% Tween 20, 2 mL of proteinase K buffer, 400 μL of 10 mg / mL proteinase K, 125 μL of bile salt added to 5.675 mL of pure water): 50 μL of supernatant was added to 42.5 μL of cell lysis buffer, and incubated at 37°C for 1 hour; 55°C for 2 hours; and 95°C for 30 minutes, then used as a DNA template. qPCR was performed using specific primers GQP-6-F and GQP-6-R designed using the Rep gene as a template, and the Taqman probe GQP-6-P.
[0167] The results of the average Ct values detected by qPCR are shown in Table 1. The results show that when rcAAV detection was performed using optimized culture volume, DNA obtained by using cell lysis buffer, and qPCR primer and probe sequences, the experimental design showed good reproducibility, and the limit of detection for rcAAV5 was 1 rcAAV5 / 1E+08 vg rAAV5 sample.
[0168] Table 1. Detection of rcAAV5 content in 3 repeated experiments
[0169]
[0170] Example 2. Cells used to detect rAAV viral vector infection titers
[0171] Since different cells have varying sensitivities to different serotypes of rAAV viral vectors, using more sensitive cells is advantageous when detecting the infection titer of rAAV vectors to improve the sensitivity of the detection results.
[0172] Recombinant AAV viral vector samples rAAV2-EGFP, rAAV5-EGFP, rAAV8-EGFP, and rAAV9-EGFP carrying the enhanced green fluorescent protein gene, from AAV serotypes 2, 5, 8, and 9 in the "Materials and Methods" section, were selected with an MOI of 2 × 10⁻⁶. 5 Vero, HEK-293, HeLa, and BHK-21 cells were infected with vg / cells, respectively. Green fluorescent protein expression was observed after 72 hours to screen for cells sensitive to each serotype of rAAV viral vector.
[0173] The results are shown in Table 2. All the above serotype rAAV virus vector samples could infect these four cell types. HEK293 cells were selected for further experiments.
[0174] Table 2. Proportion of cells expressing green fluorescent protein after infection with different cell types using viral vectors rAAV2-EGFP, rAAV5-EGFP, rAAV8-EGFP, and rAAV9-EGFP.
[0175]
[0176] Note: The fluorescence count ratios above were obtained by taking pictures and counting under the same parameters.
[0177] Example 3: Testing the minimum amount of rcAAV9 added to aid virus replication
[0178] Using the preliminary optimization method of Example 1, the HEK293 cells selected in Example 2 were tested and the lowest rcAAV9 content of rcAAV9 replication was detected.
[0179] According to the "Materials and Methods" section, AdV5-EGFP (AD001) batch number: A2012031301B, with a genomic titer of 1E+12 vg / mL and 5E+9 PFU / mL, was prepared; rcAAV9 (MH120) batch number: A2019122802, with a titer of 9.71E+12 vg / mL, was prepared.
[0180] HEK293 cells in logarithmic growth phase were seeded at 1.2E+ 6 cells / flask in 5 T25 cell culture flasks and cultured overnight in approximately 4 mL of DMEM medium containing 10% fetal bovine serum. On the second day, when the cell density reached 90% confluence, the culture supernatant was discarded, and the medium was replaced with approximately 4 mL of fresh DMEM medium containing 10% fetal bovine serum. Approximately 1 mL of each inoculum was added according to the following groups:
[0181] i) Negative control group 1 (NC1): AdV5-EGFP (MOI=2.5), without rcAAV9;
[0182] ii) Negative control group 2 (NC2): No AdV5-EGFP, only rcAAV9 4E+6vg;
[0183] iii) Positive control group 1 (PC1): AdV5-EGFP (MOI=2.5), rcAAV9 4E+4vg;
[0184] iv) Positive control group 2 (PC2): AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg;
[0185] v) Positive control group 3 (PC3): AdV5-EGFP (MOI=2.5), rcAAV9 4E+6vg.
[0186] Five T25 cell culture flasks were cultured at 37°C in a 5% CO2 incubator for approximately 48 hours after the samples were added. After the culture was completed, the T25 culture flasks were sealed with sealing film, and after three freeze-thaw cycles, all cells and supernatant were transferred to separate centrifuge tubes and centrifuged at 3000g for 10 minutes.
[0187] Take about 2 mL of the supernatant and store it at ≤-70℃ for later use. After inactivating the helper virus by incubating the remaining about 2 mL of supernatant at 56℃ for 1.5 h, take 1 mL as the inoculum for the second round of infection and repeat the above process.
[0188] Similarly, 2 mL of supernatant was stored at ≤-70℃ for later use. The remaining 2 mL of supernatant was inactivated at 56℃ for 1.5 h, and 1 mL was used as inoculum for the third round of infection, repeating the above process. After the third round of infection, the supernatants harvested from the three rounds were simultaneously lysed using cell lysis buffer (1 mL of 0.05% Tween 20, 2 mL of proteinase K buffer, 400 μL of 10 mg / mL proteinase K, 125 μL of bile salt added to 5.675 mL of pure water): 50 μL of supernatant was added to 42.5 μL of cell lysis buffer, incubated at 37℃ for 1 h; 55℃ for 2 h; and 95℃ for 30 min, and then used as a DNA template. qPCR was performed using specific primers GQP-6-F and GQP-6-R designed with the Rep gene as a template, and the Taqman probe GQP-6-P.
[0189] The results are shown in Table 3. When the minimum amount of rcAAV9 added was 4E+5vg / vial, the Ct value showed a decreasing trend after three rounds of infection, indicating that rcAAV9 replication was detected during this process. Therefore, under these conditions, the minimum amount of rcAAV9 added for the positive control was 4E+5vg.
[0190] Table 3. Average Ct values of qPCR after three rounds of infection with different rcAAV9 addition levels.
[0191]
[0192] Example 4: Test for the highest concentration of rAAV9 in the tested sample
[0193] Since the sample to be tested is an rAAV9 product, when detecting the rcAAV9 impurity content in the sample, the large amount of rAAV9 in the sample is also infectious to the host cells and may competitively inhibit rcAAV9 replication. This embodiment optimizes the maximum amount of rAAV9 present in the sample in the detection method.
[0194] As described in "Materials and Methods", AdV5-EGFP (AD001) batch number: A2012031301B, with a genomic titer of 1E+12 vg / mL and 5E+9 PFU / mL was prepared; rcAAV9 (MH120) batch number: A2019122802, with a genomic titer of 9.71E+12 vg / mL was prepared; and rAAV9 sample, batch number A202005001, with a genomic titer of 2E+14 vg / mL was prepared.
[0195] HEK293 cells in logarithmic growth phase were seeded at 1.2E+ 6 cells / flask in 5 T25 cell culture flasks and cultured overnight in approximately 4 mL of DMEM medium containing 10% fetal bovine serum. On the second day, when the cell density reached 90% confluence, the culture supernatant was discarded, and the medium was replaced with approximately 4 mL of fresh DMEM medium containing 10% fetal bovine serum. Approximately 1 mL of each inoculum was added according to the following groups:
[0196] i) Negative control group 1 (NC1): Only AdV5-EGFP (MOI=2.5), no rcAAV9;
[0197] ii) Negative control group 2 (NC2): No AdV5-EGFP, only rcAAV9 1E+6vg;
[0198] iii) Positive control group (PC): AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg;
[0199] iv) Spike 1: AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg, rAAV9 sample 1E+11vg;
[0200] v) Spike 2: AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg, rAAV9 sample 1E+9vg;
[0201] vi) Spike 3: AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg, rAAV9 sample 1E+8vg.
[0202] Three rounds of infection were performed in the same manner as in Example 3. The results are shown in Table 4. The Ct value of the positive control group (PC) showed a decreasing trend in the three rounds of infection. The Ct value of the spiked groups (Spike1~3) with rAAV9 sample addition of 1E+11vg, 1E+9vg, and 1E+8vg were all detected to show a decreasing trend.
[0203] Table 4. Average Ct values of qPCR detection after three rounds of infection for different amounts of rAAV9 sample added.
[0204]
[0205] Further increase the amount of rAAV9 sample added according to the following groupings:
[0206] i) Negative control group 1 (NC1): Only AdV5-EGFP (MOI=2.5), no rcAAV9;
[0207] ii) Negative control group 2 (NC2): No AdV5-EGFP, no rcAAV9;
[0208] iii) Positive control group (PC): AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg; iv) Spike group 1 (Spike 1): AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg, rAAV9 sample 1E+13vg; v) Spike group 2 (Spike2): AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg, rAAV9 sample 1E+12vg;
[0209] vi) Spike 3: AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg, rAAV9 sample 1E+11vg.
[0210] After the first three rounds of infection, as in Example 3, 2 mL of supernatant was stored at ≤-70℃ for later use. The remaining 2 mL of supernatant was inactivated with AdV5-EGFP helper virus at 56℃ for 1.5 h, and 1 mL was used as inoculum for the fourth round of infection, repeating the above process. After the fourth round of infection, the supernatants harvested from the four rounds were simultaneously lysed using cell lysis buffer (1 mL of 0.05% Tween 20, 2 mL of proteinase K buffer, 400 μL of 10 mg / mL proteinase K, 125 μL of bile salt added to 5.675 mL of pure water): 50 μL was added to 42.5 μL of cell lysis buffer, and incubated at 37℃ for 1 h; 55℃ for 2 h; and 95℃ for 30 min, then used as a DNA template. qPCR was performed using specific primers GQP-6-F and GQP-6-R designed with the Rep gene as a template, and the Taqman probe GQP-6-P.
[0211] The results are shown in Table 5. When the amount of rAAV9 sample added was 1E+11vg / T25 bottles, the Ct values of the four rounds of infection detection showed a decreasing trend. However, when the amount of rAAV9 added was increased to 1E+12vg and 1E+13vg, the Ct values of the four rounds of infection detection showed an increasing trend. This indicates that the amount of rAAV9 added may be too high at this time, which competitively inhibits the replication process of rcAAV9 infecting host cells. Therefore, the highest amount of rAAV9 sample under this condition was 1E+11vg.
[0212] Table 5. Average Ct values of qPCR detection after four rounds of infection with different rAAV9 sample addition amounts.
[0213]
[0214] The results of Examples 3 and 4 show that, using AdV-EGFP (MOI=2.5) as the helper virus and HEK293 as the host cell, after three to four rounds of infection, the Ct value of each round of samples was detected by qPCR using Rep-specific primers and probes. The detection limit was 1 rcAAV9 / 2.5E+5vg rAAV9 sample. This is nearly 10 times lower than the detection limit for rcAAV9 in rAAV8 products reported in the literature. This is related to the low sensitivity of rAAV9 to in vitro cultured cells; therefore, a more sensitive method is needed to detect rcAAV9 in rAAV9 products.
[0215] Example 5: One of the optimizations to the sensitivity of the detection method
[0216] In the three-round infection process, the inoculum for the latter two rounds was 1 mL of the 4 mL culture medium from the previous round, resulting in a 3 / 4 loss. This could lead to undetectable rcAAV9 levels when the concentration is low. On the other hand, directly increasing the inoculum volume could negatively impact cell proliferation and state due to the presence of substances from the used culture medium. Therefore, this embodiment further optimizes the method to improve the sensitivity of rcAAV9 detection.
[0217] As described in "Materials and Methods", AdV5-EGFP (AD001) batch number: A2012031301B, with a genomic titer of 1E+12 vg / mL and 5E+9 PFU / mL was prepared; rcAAV9 (MH120) batch number: A2019122802, with a genomic titer of 9.71E+12 vg / mL was prepared; and rAAV9 sample, batch number GP202007001, with a genomic titer of 2E+14 vg / mL was prepared.
[0218] HEK293 cells in logarithmic growth phase were seeded at 1.2E+ 6 cells / flask in 12 T25 cell culture flasks and cultured overnight in approximately 4 mL of DMEM medium containing 10% fetal bovine serum. On the second day, when the cell density reached 90% confluence, the culture supernatant was discarded, and the medium was replaced with approximately 4 mL of fresh DMEM medium containing 10% fetal bovine serum. Approximately 1 mL of each inoculum was added according to the following groups:
[0219] A. Method 1
[0220] i) Positive control group 1 (PC1): AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg;
[0221] ii) Spike group: AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg, rAAV9 sample 1E+11vg.
[0222] B. Method Two
[0223] iii) Positive control group 1 (PC1): AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg;
[0224] iv) Positive control group 2 (PC2): AdV5-EGFP (MOI=2.5), rcAAV9 1E+5vg;
[0225] v) Positive control group 3 (PC3): AdV5-EGFP (MOI=2.5), rcAAV9 1E+4vg;
[0226] vi) Spike group: AdV5-EGFP (MOI=2.5), rcAAV9 4E+5vg, rAAV9 sample 1E+11vg.
[0227] Method 1, consisting of 2 groups, as described in Examples 3 and 4: after the first round of infection, all cells and supernatant were transferred to separate centrifuge tubes after three freeze-thaw cycles. After centrifugation at 3000g for 10 min, 1 mL of the supernatant was stored at ≤-70℃ for qPCR detection. The remaining 3 mL of supernatant was inactivated with helper virus at 56℃ for 1.5 h, and 1 mL was used as inoculum for the second round of infection. The above process was repeated for a total of four rounds of infection.
[0228] Method 2, with a total of 4 groups: After the first round of infection, T25 culture flasks were sealed with sealing film, subjected to 3 freeze-thaw cycles, and all cells and supernatant were transferred to separate centrifuge tubes. Cells were inactivated at 56°C for 1 hour, centrifuged at 4000g for 10 min, and the supernatant was centrifuged at 4000g for approximately 30 min in a 5mL 100KD ultrafiltration tube (PALL, Cat. MCP100C46) to concentrate to 1mL. 500μL was used for qPCR detection, and the remaining 500μL was used as inoculum for the next round of infection. The second and third rounds of infection were repeated, with the supernatant concentrated to 1mL and used entirely for the next round of infection; no qPCR sample retention was required. After the fourth round of infection, 3 freeze-thaw cycles were performed, and all cells and supernatant were transferred to separate centrifuge tubes. Cells were inactivated at 56°C for 1 hour, centrifuged at 4000g for 10 min, and the supernatant was centrifuged at 4000g for approximately 30 min in an ultrafiltration tube to concentrate to 1mL. 1mL was used entirely for qPCR detection. qPCR samples were extracted using the DNeasy Blood & Tissue Kit (QIAGEN, Cat. 69504). The DNA obtained was eluted with 100 μL of elution buffer and used as a DNA template for qPCR detection. qPCR reactions were performed using specific primers GQP-6-F and GQP-6-R designed with the Rep gene as a template, as well as the Taqman probe GQP-6-P.
[0229] The results are shown in Tables 6 and 7. Compared with Method 1, Method 2 significantly reduced the amount of rcAAV9 added in the positive control, down to as low as 1E+5 vg / vial. Therefore, the detection limit of this method is 1 rcAAV9 / 1E+6 vg rAAV9, which improves the sensitivity compared with Method 1.
[0230] Table 6. Average Ct values from qPCR after four rounds of infection (Method 1)
[0231]
[0232] Table 7. Average Ct values from qPCR after four rounds of infection (Method 2)
[0233]
[0234] Example 6: Sensitivity Optimization of the Detection Method (Part 2)
[0235] This embodiment further optimizes the experimental protocol by increasing the number of T25 bottles infected in the first round to two T25 bottles per group. One T25 bottle is harvested after infection for qPCR detection, and the remaining cells and supernatant are harvested for the next round of infection. In one method, a different helper virus than the AdvV is used.
[0236] HEK293 cells in logarithmic growth phase were seeded at 1.2E+6 cells / flask in 26 T25 cell culture flasks and cultured overnight in approximately 4 mL of DMEM medium containing 10% fetal bovine serum. On the second day, when the cell density reached 90% confluence, the culture supernatant was discarded, and the medium was replaced with approximately 4 mL of fresh DMEM medium containing 10% fetal bovine serum. The inoculum was then added to two T25 flasks in each group according to the following groups:
[0237] A. Method 1
[0238] i) Positive control group 1 (PC1): AdV-EGFP (MOI=2.5), rcAAV9 1E+5vg;
[0239] ii) Positive control group 2 (PC2): AdV-EGFP (MOI=2.5), rcAAV9 2E+4vg;
[0240] iii) Spike 1: AdV-EGFP (MOI=2.5), rcAAV9 1E+5vg, rAAV9 sample 1E+11vg.
[0241] B. Method Two
[0242] iv) Positive control group 1 (PC1): HSV-EGFP (MOI=5), rcAAV9 1E+5vg;
[0243] v) Positive control group 2 (PC2): HSV-EGFP (MOI=5), rcAAV9 2E+4vg;
[0244] vi) Positive control group 3 (PC3): HSV-EGFP (MOI=5), rcAAV9 4E+3vg;
[0245] vii) Positive control group 4 (PC4): HSV-EGFP (MOI=5), rcAAV9 2E+3vg;
[0246] viii) Spike 1: HSV-EGFP (MOI=5), rcAAV9 1E+5vg, rAAV9 sample 1E+11vg;
[0247] ix) Spike 2: HSV-EGFP (MOI=5), rcAAV9 2E+4vg, rAAV9 sample 1E+11vg;
[0248] x) Spike 3: HSV-EGFP (MOI=5), rcAAV9 4E+3vg, rAAV9 sample 1E+11vg;
[0249] xi) Spike 4: HSV-EGFP (MOI=5), rcAAV9 2E+3vg, rAAV9 sample 1E+11vg;
[0250] xii) Negative group 1 (NC1): HSV-EGFP (MOI=5), without rcAAV9;
[0251] xiii) Negative group 2 (NC2): No HSV-EGFP, rcAAV9 1E+5vg;
[0252] Among them, the AdV-EGFP (AD001) batch number: A2012031301B, genomic titer was 1E+12 vg / mL, 5E+9 PFU / mL; the rcAAV9 (MH120) batch number: A2019122802, 9.71E+12 vg / mL; the rAAV9 sample, batch number GP202007001, genomic titer was 2E+14 vg / mL. HSV-EGFP: titer: 2.11×10 7 PFU / mL.
[0253] After the first round of infection, the T25 culture flasks were sealed with sealing film and subjected to three freeze-thaw cycles. All cells and supernatant were then transferred to separate centrifuge tubes, inactivated at 56°C for 1 hour, and centrifuged at 4000g for 10 minutes. The supernatant was then centrifuged at 4000g for approximately 30 minutes using a 5mL 100KD ultrafiltration tube (PALL, Cat. MCP100C46) to concentrate the virus to 1mL. One mL of the virus concentrate collected from each of the two T25 flasks was stored at ≤-70°C for qPCR detection; the other 1mL was used as inoculum for the next round of infection. This process was repeated for all three rounds of infection, with the supernatant concentrated to 1mL and used entirely for the next round of infection; no qPCR sample retention was required. After the fourth round of infection, the cells were subjected to three freeze-thaw cycles. All cells and supernatant were then transferred to separate centrifuge tubes, inactivated at 56°C for 1 hour, centrifuged at 4000g for 10 minutes, and the supernatant was ultrafiltered and centrifuged at 4000g for approximately 30 minutes to concentrate to approximately 1 mL. This 1 mL was used entirely for qPCR detection. qPCR samples were retrieved using a DNeasy Blood & Tissue Kit (QIAGEN, Cat. 69504). DNA was obtained and eluted with 100 μL of elution buffer, serving as the DNA template for qPCR detection. Specific primers GQP-6-F and GQP-6-R, designed using the Rep gene as a template, and the Taqman probe GQP-6-P were used for qPCR reactions. The detection results are shown in Table 8. Compared to Example 5, by increasing the number of initial culture flasks, the sensitivity of the method was significantly improved to 2 rcAAV / 1E+07vg rAAV9 samples when using AdV5 as the helper virus.
[0254] Table 8. Average Ct values from qPCR detection after four rounds of infection.
[0255]
[0256] The number of T25 bottles infected in the first round was increased from one to two per group. In the second round of infection, the total amount of supernatant infected was increased, thereby further improving the sensitivity of the detection method.
[0257] Other optimization methods that can further increase sensitivity include increasing the number of infection rounds. The method of this invention does not suffer from inoculum loss during infection; therefore, theoretically, increasing the number of infection rounds can increase the number of rcAAV amplification generations.
[0258] The foregoing describes exemplary embodiments of the present invention. Those skilled in the art should understand that these disclosures are merely exemplary, and various other substitutions, adaptations, and modifications can be made within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments listed herein.
Claims
1. A method for detecting the content of rcAAV9 in a sample of recombinant adeno-associated virus 9 vector, comprising the following steps: (1) Inoculate logarithmic growth phase HEK293 cells at 1.2E+6 cells / flask into a T25 cell culture flask, and culture overnight in 4 mL of DMEM medium containing 10% fetal bovine serum; (2) Add the following inocula to each of 2 cell culture flasks to perform the first round of infection of HEK-293 cells: i) Positive control: is a helper virus and rcAAV9 standard, wherein, The helper virus is used for replication of the rcAAV9 standard, and the rcAAV9 standard is 2E+4 vg to 1E+5 vg rcAAV9, and the helper virus is an adenovirus; ii) The spiked group: the helper virus and the rcAAV9 standard, and the sample to be tested, wherein the helper virus is used for replication of the rcAAV9 standard, and the rcAAV9 standard is 2E+4 vg to 1E+5 vg rcAAV9; the sample to be tested is 1E+11 vg rAAV9, and the helper virus is an adenovirus; iii) The sample to be tested group: the helper virus and the sample to be tested, wherein the sample to be tested is 1E+11 vg rAAV9, and the helper virus is an adenovirus; (3) After the first round of infection, freeze-thaw the cells and supernatant in each of the 2 flasks of each group, and transfer all the cells and supernatant in each flask to a separate centrifuge tube, inactivate at 56°C, and then concentrate each flask of cells and supernatant to 1 mL by ultrafiltration; store the concentrated liquid from one of the flasks at ≤-70°C for qPCR detection; use the concentrated liquid from the other flask as the inoculum for the next round of infection; (4) Add 1 mL of the concentrated liquid obtained after the first round of infection to 4 mL of fresh culture medium, and perform the second round of infection of the cells in 1 flask of 4 to 5 mL capacity for each group, and as in step (3), obtain 1 mL of ultrafiltration concentrated liquid from each flask, all of which is used for the next round of infection; (5) The third round of infection, the fourth round of infection, and the fourth round of infection or more are the same as the second round of infection; after the fourth round of infection or more, 1 mL of ultrafiltration concentrated liquid is obtained from each flask and is used for qPCR detection; (6) After completing the fourth round of infection or more, extract DNA from the ultrafiltration concentrated liquid harvested from the first and last rounds of infection as the DNA template for qPCR, design specific primers and Taqman probes using the Rep gene as the template, and perform qPCR detection; (7) Result analysis and determination: If the positive control group: the first round Ct mean value > the last round Ct mean value; The spiked group: the first round Ct mean value > the last round Ct mean value; And the sample to be tested group: the first round Ct mean value < the last round Ct mean value, then the content of rcAAV9 in the sample to be tested is: < the amount of rcAAV9 standard added / the amount of rAAV9 sample added; If the positive control group: the first round Ct mean value > the last round Ct mean value; The spiked group: the first round Ct mean value > the last round Ct mean value; And the sample to be tested group: the first round Ct mean value < the last round Ct mean value, then the content of rcAAV9 in the sample to be tested is: < the amount of rcAAV9 standard added / the amount of rAAV9 sample added; and the test sample group: the first round Ct mean value > the last round Ct mean value, the test sample needs to be further diluted and the detection of steps (1) to (6) is implemented until the test sample group: the first round Ct mean value < the last round Ct mean value, the content of rcAAV9 in the test sample is: the added amount of rcAAV9 standard in vg / the added amount of diluted rAAV9 sample in vg, Wherein, the cell culture bottle is a T25 cell culture bottle, the culture medium is a DMEM culture medium containing 10% fetal bovine serum, and the cells are infected with a helper virus at an MOI = 2.5, and the helper virus is an adenovirus.
2. The method of claim 1, wherein, The cells are infected for more than four rounds.
3. The method of claim 2, wherein, The cells are infected for five rounds, six rounds, seven rounds, or eight rounds.
4. The method according to any one of claims 1 to 3, wherein, The specific primers are shown as SEQ ID NO: 1 and 2; and the Taqman probe is shown as SEQ ID NO:
3.
5. The method of any one of claims 1-3, wherein, The helper virus is an adenovirus AdV5-EGFP.
Citation Information
Patent Citations
Plasmid system
EP3722434A1