A DNA polymerase mutant, preparation method and application thereof

By genetically modifying Tli DNA polymerase, a DNA polymerase mutant Tli@ with 3'-5' exonuclease activity was obtained, which solved the problem of insufficient fidelity of existing DNA polymerases in PCR amplification and achieved efficient and rapid nucleic acid amplification.

CN116083390BActive Publication Date: 2026-03-31GENEWIZ INC SZ
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310068602.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-06
Publication Date
2026-03-31
Estimated Expiration
2043-02-06

AI Technical Summary

Technical Problem

Existing commercial DNA polymerases, such as Taq polymerase, lack 3'-5' exonuclease activity in PCR amplification, resulting in insufficient fidelity and making it difficult to meet the growing demand for gene amplification and synthesis.

Method used

The Tli DNA polymerase derived from Thermococcus litoralis was genetically modified to obtain a DNA polymerase mutant Tli@ with 3'-5' exonuclease activity. Its amino acid sequence was optimized using molecular evolution techniques to improve enzyme activity and fidelity.

Benefits of technology

Tli@ enzymes exhibit high fidelity when amplifying templates with high GC content and complex structural fragments. They can effectively amplify 1000bp and 2000bp templates in a short time, shortening PCR time, and maintaining high amplification efficiency at different extension rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116083390B_ABST
    Figure CN116083390B_ABST
Patent Text Reader

Abstract

The application discloses a DNA polymerase mutant and a preparation method and application thereof. The amino acid sequence of the DNA polymerase mutant comprises a sequence shown in SEQ ID NO. 1. In the application, a Tli DNA polymerase derived from Thermococcus litoralis is genetically reformed by using a molecular evolution technology, enzyme activity is improved, the DNA polymerase is more suitable for amplification of a difficult sequence, and high fidelity is achieved. When ITR structure is amplified, a band is single, and a sequence amplified almost has no deletion or mutation. When a high-GC or complex-structure fragment is amplified, a band is single, and a recovery concentration is high. When PCR amplification is performed, extension time is short, extension speed can reach 1 sec / kb, and the amplification efficiency of a long fragment is high, so the DNA polymerase has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and relates to a DNA polymerase mutant, its preparation method, and its application. Background Technology

[0002] DNA polymerase, also known as DNA-dependent DNA polymerase (DNApol), is a class of enzymes that catalyze the polymerization of substrate dNTP molecules to form daughter DNA using parental DNA as a template. This enzyme was first discovered in Escherichia coli in 1957 by American scientist Arthur Komberg and was named DNA polymerase I (pol I for short). Subsequently, various DNA polymerases were found in other prokaryotes and eukaryotes. These DNA polymerases share the following characteristics: (1) they possess 5'→3' polymerase activity, which determines that DNA can only be synthesized along the 5'→3' direction; (2) they require primers. DNA polymerases cannot catalyze the de novo synthesis of new DNA strands; they can only catalyze the addition of dNTPs to the 3'-OH end of the nucleotide chain. Therefore, at the beginning of replication, a DNA primer's 3'-OH end is needed as a starting point to synthesize a new strand in the 5'→3' direction.

[0003] Currently, commonly used commercial DNA polymerases include Taq polymerase. Taq polymerase is a thermostable DNA polymerase isolated from the aquatic thermophilic bacterium *Thermus aquaticus* (Taq). It lacks 3'-5' proofreading activity. Although Taq polymerase has a high structural similarity to *E. coli* polymerase I (including the 3'-5' exonuclease domain), its lack of 3'-5' exonuclease activity reduces its fidelity in PCR amplification. To address the ever-increasing demands for gene amplification, synthesis, and sequencing, improving existing polymerases and developing novel DNA polymerases has been a key focus.

[0004] For example, CN114958799A discloses a Taq DNA polymerase variant and its application in genome editing. This Taq DNA polymerase variant is a mutation of the wild-type Taq DNA polymerase shown in SEQ ID NO.1, and the specific mutated amino acid of the Taq DNA polymerase variant is L441M. Its specificity is improved through semi-rational directed molecular evolution of the wild-type full-length Taq DNA polymerase. Experiments have demonstrated that the highly specific Taq DNA polymerase variant obtained using the method of this invention exhibits significant advantages in CRISPR / Cas9 editing efficiency assessment and single-cell clone genotyping.

[0005] In conclusion, the development of improved DNA polymerases is of great significance to the field of molecular biology. Summary of the Invention

[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a DNA polymerase mutant, its preparation method, and its application. This invention genetically modifies the Tli DNA polymerase derived from Thermococcus litoralis to obtain a DNA polymerase mutant with significantly improved performance.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a DNA polymerase mutant, wherein the amino acid sequence of the DNA polymerase mutant includes the sequence shown in SEQ ID NO.1.

[0009] In this invention, the Tli DNA polymerase derived from Thermococcus litoralis is genetically modified using molecular evolution technology. This improves enzyme activity, making it more suitable for amplifying difficult sequences with high fidelity. For example, when amplifying ITR structures, the bands are single and the amplified sequences have almost no deletions or mutations. When amplifying fragments with high GC or complex structures, the bands are single and the recovery concentration is high. During PCR amplification, the extension time is short, with an extension rate of up to 1 sec / kb. It has high amplification efficiency for long fragments and has broad application prospects.

[0010] SEQ ID NO.1:

[0011] .

[0012] It is understood that DNA polymerases with similar performance obtained by conventional base substitution, deletion or insertion based on the amino acid sequence of the DNA polymerase mutant of the present invention are all within the scope of protection of the present invention.

[0013] In a second aspect, the present invention provides a nucleic acid molecule containing the coding sequence of the DNA polymerase mutant described in the first aspect.

[0014] Thirdly, the present invention provides a recombinant vector containing the nucleic acid molecules described in the second aspect.

[0015] Fourthly, the present invention provides a recombinant cell containing the nucleic acid molecules described in the second aspect and / or the recombinant vector described in the third aspect.

[0016] Fifthly, the present invention provides a method for preparing the DNA polymerase mutant described in the first aspect, the method comprising the following steps:

[0017] (1) Insert the coding sequence of the DNA polymerase mutant described in the first aspect into a vector to obtain a recombinant vector;

[0018] (2) The recombinant vector obtained in step (1) is transformed into host cells, cultured and purified to obtain the DNA polymerase mutant.

[0019] Preferably, the carrier comprises the pET-Sso7d carrier.

[0020] Preferably, the host cell comprises E. coli ER2566.

[0021] In a sixth aspect, the present invention provides the application of the DNA polymerase mutant described in the first aspect in the preparation of nucleic acid amplification products.

[0022] In a seventh aspect, the present invention provides a kit comprising the DNA polymerase mutant described in the first aspect.

[0023] Eighthly, the present invention provides the application of the DNA polymerase mutant described in the first aspect in the amplification of nucleic acids.

[0024] Ninthly, the present invention provides a method for amplifying nucleic acids, the method comprising:

[0025] The DNA polymerase mutant described in the first aspect is used to catalyze nucleic acid amplification reactions.

[0026] Preferably, the buffer for the amplification reaction includes a 10× buffer and a 5× buffer.

[0027] Preferably, the 10×Buffer contains: 10-25% glycerol, 0.2-1M Tris-Acetate, 0.5-1M KAC, 10-20 mM MgAC, and 1-10% Triton X-100.

[0028] Preferably, the 5×Buffer contains 0.05-0.1M ammonium sulfate, 0.1-0.2M tris(hydroxymethyl)aminomethane, 0.05-0.1M potassium chloride, 10-20mM magnesium sulfate, 5-10mg / L bovine serum albumin, and 1-0.5% triaton.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] This invention genetically modifies the Tli DNA polymerase derived from Thermococcus litoralis to obtain the DNA polymerase mutant Tli. @ Enzyme, Tli @ The enzyme possesses 3'-5' exonuclease activity and exhibits high fidelity. It can effectively amplify 1000bp and 2000bp templates at different extension rates (1-60 sec / kb), with brighter bands even at 1 sec / kb, significantly shortening PCR time. It can effectively and specifically amplify templates with high GC content (G+C≥60%), which is of great significance in the field of nucleic acid amplification. Attached Figure Description

[0031] Figure 1 Electrophoresis images of amplification products with different buffs in Example 2;

[0032] Figure 2 For different Tli in Example 2 @ Electrophoresis diagram of the amplified products after enzyme dosage;

[0033] Figure 3 This is an electrophoresis image of the amplification product of the 1000bp template in Example 3;

[0034] Figure 4 This is an electrophoresis image of the amplification product of the 2000bp template in Example 3;

[0035] Figure 5 This is an electrophoresis diagram of the amplification product of the ITR structural template in Example 4;

[0036] Figure 6 This is an electrophoresis diagram of the amplification product of the common structural template in Example 4;

[0037] Figure 7 This is an electrophoresis diagram of the amplification product of the complex structure template in Example 4;

[0038] Figure 8 Electrophoresis diagrams of amplification products from templates of different lengths in Example 5;

[0039] Figure 9 Electrophoresis images of amplification products with different template concentrations in Example 6;

[0040] Figure 10 This is an electrophoresis image of the amplified products in Example 7;

[0041] Figure 11 This is an electrophoresis diagram of the ligation product in Example 7. Detailed Implementation

[0042] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0043] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0044] Example 1

[0045] This embodiment constructs and prepares the DNA polymerase mutant Tli. @ Enzymes.

[0046] I. Construction of Recombination Carrier

[0047] The Tli enzyme derived from Thermococcus litoralis was genetically modified, and the modified nucleic acid sequence is shown in SEQ ID NO.2. It was then inserted into the pET-Sso7d vector to obtain the recombinant vector.

[0048] SEQ ID NO.2:

[0049]

[0050] II. Tli @ Enzyme expression

[0051] 1. Transform the recombinant vector into E. coli ER2566 strain and inoculate it onto a solid plate for culture.

[0052] 2. The next day, collect the flat plate, select single clones to single tubes, and oscillate overnight.

[0053] 3. Inoculate 2 mL of bacterial culture into 70 mL of EM medium (containing 1 g / L glucose, 40 μM IPTG, and 100 mg / mL antibiotic A) and shake at 30 °C for 24 h.

[0054] 4. Collect the bacteria into a 50mL centrifuge tube and add 1mL of bacterial suspension expressing Benzonase.

[0055] 5. Add 12 mL of ultrapure water and 0.5 mL of 2 M Tris-Cl pH = 7.5. Vortex will disperse most of the bacteria.

[0056] 6. Add PMSF to 0.5mM.

[0057] 7. Turn on the ultrasonic instrument and soundproof box, add ice water to the beaker, insert the centrifuge tube into the ice water, ensure that the sample liquid level is below the ice water level, and immerse the probe in the sample.

[0058] 8. Amplitude bar 6mm, 25% power, 30s on 30s off, ultrasound for 30 minutes.

[0059] 9. Add Triton X-100 to 0.1%, sodium chloride to 0.25M, and magnesium chloride to 5mM, and incubate at 37°C for 1 hour.

[0060] 10. Centrifuge at 8000 rpm and 4℃ for 10 minutes, then transfer the supernatant to a new 50 mL centrifuge tube for the next step of purification.

[0061] III. Tli @ Enzyme purification

[0062] 1. Add imidazole to 5mM, mix thoroughly, and collect the liquid at the bottom of the tube.

[0063] 2. Pack a 4mL NTA-Ni column (Beyotime's nickel column for resisting denaturation), and add a sieve plate to prevent the packing from being washed away.

[0064] 3. Rinse and equilibrate the nickel column with 5 column volumes of Washing Buffer.

[0065] 4. Load the solution from step 1 onto the column and use gravity to allow the sample to pass through the column, thus retaining the target protein on the column.

[0066] 5. Rinse the column with 15 column volumes of Washing Buffer to remove contaminating proteins.

[0067] 6. Elute with 5 column volumes of Elution Buffer and collect the eluent.

[0068] 7. Add 10 column volumes of Elution Buffer to rinse the column, and discard the effluent.

[0069] 8. Add 5 column volumes of ultrapure water to rinse the column, then add 5 column volumes of 20% ethanol to rinse the column. Seal the bottom of the column, add 2 column volumes of 20% ethanol to seal the top, and store the column. It can be used again later.

[0070] 9. The product from step 6 uses Pierce. TM Protein concentration tubes were prepared using PES, 30K MWCO, 4 mL. The sample was added to the upper tube and the waste liquid to the lower tube. The centrifuge was performed at 4000 rpm for 15 min each time, and the residual liquid volume was reduced to less than 2 mL on the last centrifuge.

[0071] 10. Transfer the remaining liquid (sample) to a new 50mL centrifuge tube, rinse three times with the final protein preservation solution, 2mL each time; combine the rinsing solution and the sample, and add more preservation solution to make the total volume 10mL.

[0072] 11. The protein concentration was estimated to be 0.73 mg / mL by SDS PAGE. The dilution ratio was determined by PCR through serial dilution.

[0073] Example 2

[0074] This embodiment utilizes the Tli prepared in the previous embodiment. @ The enzyme was used for PCR testing.

[0075] Using a 725bp DNA sequence as a template, PCR amplification was performed using 10×Buffer and 5×Buffer, respectively. The amplification systems are shown in Tables 1 and 2, and the amplification conditions are shown in Table 3. The amplification products were subjected to agarose gel electrophoresis, and the results are as follows. Figure 1 As shown, all of them can achieve efficient amplification.

[0076] The 10×Buffer contains: 25% glycerol, 0.2M Tris-Acetate, 0.5M KAC, 15mM MgAC, and 1% Triton X-100.

[0077] The 5×Buffer contains: 0.06M ammonium sulfate, 0.12M tris(hydroxymethyl)aminomethane, 0.2M potassium chloride, 10mM magnesium sulfate, 0.5M bovine serum albumin, and 0.5% triaton.

[0078] Table 1

[0079]

[0080]

[0081] Table 2

[0082] 10×buffer 5μL <![CDATA[Tli @ enzymes 0.5μL dNTP 1μL Primer F 2μL Primer R 2μL DNA 2μL water 37.5μL

[0083] Table 3

[0084]

[0085] Adjust the Tli in the above 10×Buffer reaction system @ Enzyme dosage: Tli@ enzyme (concentration 0.73 mg / mL) was diluted 1, 2, 4, 16, 32, 64, 128, and 256 times, respectively. 0.5 μL of each diluted solution was then used for PCR amplification. The amplification products were subjected to agarose gel electrophoresis. The results are as follows: Figure 2 As shown, Tli diluted 1-fold @ The PCR product of the highest concentration is the brightest and has the highest amplification efficiency.

[0086] template:

[0087]

[0088] Example 3

[0089] This embodiment addresses Tli @ The extension rate of the enzyme was tested.

[0090] Using 1119bp and 2133bp DNA fragments as templates, and referring to the 10×Buffer reaction system in Example 2, amplification was performed at extension rates of 1 sec / kb, 5 sec / kb, 10 sec / kb, 15 sec / kb, 30 sec / kb, and 60 sec / kb, respectively. The amplification products were subjected to agarose gel electrophoresis, and the results are as follows: Figure 3 and Figure 4 As shown, the Tli prepared in this invention @ The enzyme can effectively amplify 1000bp and 2000bp templates at different extension rates (1-60 sec / kb), and the amplified band is brighter at 1 sec / kb, indicating that the Tli enzyme of this invention... @ Enzymes possess high activity.

[0091] 1119bp template:

[0092]

[0093] 2133bp template:

[0094]

[0095] Example 4

[0096] This embodiment uses Tli @ Enzymes amplify templates of different structural types.

[0097] Three different types of templates were selected: those containing complex structures, those containing ITR structures, and those without any structures. PCR amplification was performed using templates with lengths of 250bp, 500bp, 1000bp, 1500bp, and 2000bp (as shown in Table 4). Following the 10×Buffer reaction system and amplification conditions described in Example 2, the amplification products were subjected to agarose gel electrophoresis. The results are as follows... Figures 5-7 As shown, the Tli of the present invention @ Even complex enzyme templates can be amplified efficiently, with single bands.

[0098] Table 4

[0099]

[0100]

[0101]

[0102]

[0103]

[0104] Example 5

[0105] This embodiment uses Tli @ Enzyme amplification of templates of different lengths.

[0106] Fragments with lengths of 250bp, 500bp, 1000bp, 1500bp, 2000bp, and 3500bp (as shown in Table 5) were selected for PCR amplification. Following the 10×Buffer reaction system and amplification conditions described in Example 2, the amplification products were subjected to agarose gel electrophoresis. The results are as follows: Figure 8 As shown, the Tli@ enzyme of this invention can effectively amplify templates of different fragment lengths, with clear and single bands.

[0107] Table 5

[0108]

[0109]

[0110]

[0111] Example 6

[0112] This embodiment tests the amount of template required for Tli@ enzyme amplification.

[0113] The template with a concentration of 66 ng / μL was diluted proportionally to obtain templates of 0.1 pg / μL, 1 pg / μL, 10 pg / μL, 100 pg / μL, 1 ng / μL, 10 ng / μL, 50 ng / μL, 0.1 μg / μL, and 0.5 μg / μL. Following the 10×Buffer reaction system and amplification conditions in Example 2, the amplification products were subjected to agarose gel electrophoresis. The results are as follows... Figure 9 As shown, the present invention Tli @ When the enzyme amplifies, the optimal template concentration is 0.5 μg / μL, which produces the brightest band, while the minimum template concentration is 50 ng / μL.

[0114] template:

[0115]

[0116] Example 7

[0117] This embodiment performs Tli @ Enzyme fidelity test.

[0118] Use Tli @ Six fragments were amplified by the enzyme, recovered by gel dispensing, and ligated into the Puc-19 vector. The fragments were then sent for Sanger sequencing, and all six fragments were sequenced. After ligation into the Puc-19 vector, a total of 48 clones were selected, of which 4 clones were empty vectors and the remaining 44 were sequenced by Sanger sequencing. A total of 22,111 bases were sequenced, with 22 mismatched nucleotides and a fidelity of 99% (sequence and sequencing results are shown in Table 6).

[0119] Table 6

[0120] Serial Number Sequence length Number of mismatched bases XW-1 622*7=4354 2 XW-2 438*6=2628 0 XW-3 518*8=4144 13 XW-4 509*8=4072 0 XW-5 535*7=3745 2 XW-6 396*8=3168 5 Summary 22111 22

[0121] XW-1 original sequence:

[0122] ctctcccttatgcgactcctgcgttaacgatttgtgacgtcgatgcgtatgttgcttgcggttatgttaacggtacgcctgttttaaggagataaagatgatcaccggcgaaattaaaagccaggttgacaaagtttggaacactttttggtccggcggcatcagcaatcctctggaagtgatcgaacaaattacctacctgctgttcctgaaacgcctggacgaaaaccacactcgtgctgaagctcaggctaacctgctgggcgagccgattgagaacgctatgtttccggaaggtgttgatccgcagggtcgtccgtactctgacctgcgttggagcaaattcaaagatttcggccagaccgaaatgttcaccgttttccagcagtctatcttcccgttcctgcgcactgaactgaccaaacagtctaacggtgaagattccacttacagccatcacatgaaggatgcgcagttcaagatcccgaacgcgggcgttctgaagcaggtagtagatgtgattgactctatcaacatggaaggccgtgacaccaaaggcgatctgtacgagtatatgctgtccaaactggcctctgcgggcaccaatggtcagttccgtacc。

[0123] Original sequence of XW-2:

[0124] aagcgcgatgaatgtcttactacggagcaagttcccgaggtaatcggagtccggctgatgttgggagtaggtggctacgaactcacgaccgaaaagatcaagagcagcccgcatggatttgacttggtcagggccgagcctacatgtgcgaatgatgcccatacttgagcccgtctcagacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcctgatgcggtattttctccttacgcatctatcccgcccctaactccgcccagttccgcccattctccgcctcatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggacgcttttttggaggccatcccaatggcgcgccgagcttggctcgag。

[0125] Original sequence of XW-3:

[0126] ccaatggtcagttccgtaccccgcgccacatcatcgacctgatggttgcaatgaccgcaccgcagccgctggaagcaatttgtgatccggcagcaggcacctgtggtttcctggttcaggctggcgaatacctgcgcactaacaacgctaacctgctgaccaacgatgaaaccagcaagtttttccaccacgaacagttccacggtttcgatttcgatagcaccatgctgcgtatcggctctatgaacatgctgctgcacggcgttgagaatccggatgtgagctaccgtgattccctggccgacctgcactctattgaagaggaaaagtataacgtgatcctggcaaacccgccgttcgctggttctctggactacgaaaacgtgtctaaggagctgctgaatgttgtgaaaaccaaaaaaactgaactgctgttcctggcgctgttcatcaagctgctgaaaccgggtggtcgtgcggcagttatcgttccggatggcgttctgttcggttccacc。

[0127] Original sequence of XW-4:

[0128] cgtgaattcctgcagcccaactcgacatctatatactatatagtaataccaatactcaagactacgaaactgatacaatctcttatcatgtgggtaatgttctcgatgtcgatagccatatgcccggtagttgcgatatacataaactgatcactaattccaaacccacccgctttttatagtaagtttttcacccataaataataaatacaataattaatttctcgtaaaagtagaaaatatattctaatttattgcacggtaaggaagtagaatcataaagaacagtgacggatcgatcccccaagcttggacacaagacaggcttgcgagatatgtttgagaataccactttatcccgcgtcagggagaggcagtgcgtaaaaagacgcggactcatgtgaaatactggtttttagtgcgccagatctctataatctcgcgcaacctattttcccctcgaacactttttaagccgtatcccaatggcgcgccgagcttggcgtaat。

[0129] Original sequence of XW-5:

[0130] gcaaatgggtcgcggatccatgactgaatctgccgctcaggctccatctactgaggttccgatctggccggctctgatcgttccggtactgcaagccctgtctggtggtcagaccctgcatcgcaaagagctgtttcatcaagctgctgaccaggcaggtctgtctgagggcgctcgtgaggaaaccctgaactccggtggtctgcgctacgaacagcgtatgggttgggttctgtctcacctgacccgtgcgtcctggattgatcgtcctgttaaaggctattattgcatcaccgatgcaggtcgtcaatggctgctggataacccgcagggcatcaactatagccaggcgcacactatctttgcacagtattggccgaaagctgatggtcaggttgctccgacccaggttgcgcaagaaactggcctggcagctactgatgaactggaaccagttgaacagatcgaggacgctattaaccgtatccaggatgaagttggtgcgtccctgctgcgtcgtctgcacgaagaacac。

[0131] Original sequence of XW-6:

[0132] ctgaaatatcagctgaagaacgagaatggctggatgcaccggcgactggtcaggaggaaatctgacatggaaagaggggaaatctggcttgtctcgcttgatcctaccgcaggtcatgagcagcagggaacgcggccggtgctgattgtcacaccggcggcctttaatcgcgtgacccgcctgcctgttgttgtgcccgtaaccagcggaggcaattttgcccgcactgccggctttgcggtgtcgttggatggtgttggcatacgtaccacaggtgttgtacgttgcgatcaaccccggacaattgatatgaaagcacggggcggaaaacgactcgaacgggttccggagactatcatgaacgaagttcttggccgcctgtccactattctgact。

[0133] Example 8

[0134] This embodiment utilizes Tli @ Enzyme amplification and splicing.

[0135] The PCR primers are shown in Table 7.

[0136] Table 7

[0137]

[0138]

[0139] Template #1:

[0140]

[0141] Template #2:

[0142]

[0143] Template #3:

[0144]

[0145] The PCR reaction system is shown in Table 8.

[0146] Table 8

[0147] 10×buffer 5μL <![CDATA[Tli @ enzymes 0.5μL dNTP 1μL Primer F 2μL Primer R 2μL DNA 2μL water 37.5μL

[0148] The PCR procedure is shown in Table 9.

[0149] Table 9

[0150]

[0151] The amplification products were subjected to agarose gel electrophoresis, and the results are as follows: Figure 10 As shown, all three PCR templates amplified with bands. The amplification products of the three PCR templates were respectively loaded into the pUC-57 vector, and the electrophoresis results are as follows. Figure 11 As shown, the splicing was successful, indicating that the present invention Tli... @ The products obtained from enzyme amplification can be effectively spliced.

[0152] In summary, this invention genetically modifies the Tli DNA polymerase derived from Thermococcus litoralis to obtain the DNA polymerase mutant Tli. @ Enzyme, Tli @ The enzyme possesses 3'-5' exonuclease activity and exhibits high fidelity. It can effectively amplify 1000bp and 2000bp templates at different extension rates (1-60 sec / kb), with brighter bands even at 1 sec / kb, significantly shortening PCR time. It can effectively and specifically amplify templates with high GC content (G+C≥60%), which is of great significance in the field of nucleic acid amplification.

[0153] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method of amplifying a nucleic acid, characterized by, The method comprises: catalyzing a nucleic acid amplification reaction by using a DNA polymerase mutant; the sequence of the DNA polymerase mutant is the sequence shown in SEQ ID NO. 1; the Buffer of the amplification reaction comprises 10×Buffer and 5×Buffer; the 10×Buffer contains: glycerol 10-25%, Tris-Acetate 0.2-1 M, KAC 0.5-1 M, MgAC2 10-20 mM, Triton X-100 (Triton 100) 1-10%; the 5×Buffer contains: ammonium sulfate 0.05-0.1 M, tris-hydroxymethyl aminomethane 0.1-0.2 M, potassium chloride 0.05-0.1 M, magnesium sulfate 10-20 mM, bovine serum albumin 5-10 mg / L, and Triton 1-0.5%.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule contains the coding sequence of the DNA polymerase mutant in the method for amplifying nucleic acid according to claim 1.

3. A recombinant vector, characterized in that, The recombinant vector contains the nucleic acid molecule according to claim 2.

4. A recombinant cell, characterized in that, The recombinant cell contains the nucleic acid molecule according to claim 2 and / or the recombinant vector according to claim 3.

5. A method for preparing a DNA polymerase mutant used in the method for preparing the amplified nucleic acid according to claim 1, characterized by, The method comprises the following steps: (1) inserting the coding sequence of the DNA polymerase mutant in the method for amplifying nucleic acid according to claim 1 into a vector to obtain a recombinant vector; (2) transforming the recombinant vector obtained in step (1) into a host cell, culturing and purifying to obtain the DNA polymerase mutant.

6. The method of claim 5, wherein the DNA polymerase mutant is prepared by, The host cell is E. coli ER2566.

7. Use of the DNA polymerase mutant in the method for amplifying nucleic acid according to claim 1 in the preparation of a nucleic acid amplification product.

8. A kit characterized in that, The kit comprises the DNA polymerase mutant in the method for amplifying nucleic acid according to claim 1 and the Buffer of the amplification reaction.

Citation Information

Patent Citations

  • Taq DNA polymerase variant and application thereof in genome editing

    CN114958799A

  • Tth DNA polymerase fusion protein and synthesis method thereof

    CN111892658A

  • Mutation of dna polymerases from archaeobacteria

    US20060057682A1