GSK126 enhances the response of hepatocellular carcinoma cells to all-trans retinoic acid by increasing retinoic acid receptor γ gene expression

Abstract

The present invention discloses that GSK126 enhances the response of liver cancer cells to all-trans retinoic acid by increasing the gene expression of retinoic acid receptor γ. The present invention finds that RARγ is the main receptor that mediates the anti-cancer effect of ATRA, and that the EZH2 inhibitor can promote the expression of RARγ by reducing the modification of H3K27me3, further develops the use strategy of EZH2 inhibitor combined with ATRA, and finds that the EZH2 inhibitor combined with ATRA has the effect of synergistically inhibiting tumor proliferation, improves the sensitivity of tumors to ATRA, can promote tumor cell apoptosis and block cells in the G1 phase, and can inhibit tumor cell migration, providing an experimental basis and theoretical basis for the synergistic anti-tumor effect of the two drugs, which is of great significance to the field of tumor treatment.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and relates to GSK126 enhancing the response of liver cancer cells to all-trans retinoic acid by increasing the expression of retinoic acid receptor γ gene. Background Art

[0002] Primary liver cancer is one of the most common malignant tumors in the world. For patients with liver cancer who have lost the chance of surgery in the middle and late stages, drug therapy is still an important means of treatment. However, due to the high heterogeneity of liver cancer, the sensitivity of liver cancer patients to drug regimens varies greatly.

[0003] All-trans-retinoic acid (ATRA) is a natural metabolite of vitamin A. ATRA has a wide range of physiological and pharmacological activities. As the first generation of retinoids that can be used orally, ATRA has a strong induction of differentiation for promyelocytic leukemia caused by chromosomal translocation RAR / PML rearrangement, forming mature granulocytes. It is the first choice for the treatment of acute promyelocytic leukemia. The complete remission rate of the first treatment can reach 90%. Its mechanism is to activate the transcription factor activity of the retinoic acid receptor and the expression level of downstream target genes by binding to the retinoic acid receptor as a nuclear receptor. Retinoic acid receptors include two steroid receptor families, namely RARs and RXRs, of which RARs and RXRs include three subtypes: RARα, RARβ and RARγ; RXRα, RXRβ and RXRγ. However, there is limited evidence for the clinical utility of ATRA in the treatment of other leukemias and solid tumors. One of the main reasons is that the genetic and pathological mechanisms of solid tumors are not as clear as those of promyelocytic leukemia, and the effect of single-agent application in solid tumors is not ideal. However, ATRA is an ideal drug for drug combination therapy due to its effects on cell proliferation, differentiation and apoptosis and its low toxicity. For example, the combination of ATRA with paclitaxel, kinase inhibitors, natural compounds, retinoids, ER or HER2 inhibitors, chemotherapeutic drugs, proteasome inhibitors and retinoic acid nanoformulations showed synergistic effects in anticancer activity.

[0004] Epigenetic modifications such as histone methylation are pharmacologically reversible. EZH2 is the catalytic subunit of the PRC2 complex. It catalyzes histone H3K27me3 through its C-terminal SET domain to promote chromatin compaction and silence its target genes. Overexpression and mutation of EZH2 have been shown to be highly correlated with tumor progression and is generally considered to be a proliferation marker and a true oncogene. Currently, five EZH2 inhibitors, including tazemetostat (Tazverik, United States); GSK-126 (GlaxoSmithKline, United Kingdom); CPI-1205 (Constellation, United States); SHR2554 (Hengrui Medicine Co., Ltd., China); and PF-06821497 (Pfizer, United States), have entered clinical trials. The combination of EZH2 inhibitors and other therapies shows a more powerful complementary or synergistic anti-tumor effect. For example, CN111420059A discloses a drug combination and its application for overcoming the drug resistance of liver cancer and kidney cancer. The acetylase inhibitor Anacardic Acid (AA) is used in combination with the EZH2 inhibitor GSK-126. This drug combination enhances the tumor sensitivity of EZH2 inhibitors from two aspects: reducing the stability of EZH2 itself and inhibiting the activity of EZH2, with significant results.

[0005] However, in the current clinical drug treatment (such as the treatment of liver cancer), some patients are still not sensitive to the combination therapy involving ATRA or the combination therapy involving EZH2 inhibitors, and the treatment effect is poor. In summary, studying the key molecular mechanisms that affect tumor sensitivity to ATRA is crucial for the personalized treatment of tumors. Summary of the invention

[0006] In view of the deficiencies of the prior art and actual needs, the present invention provides GSK126, which enhances the response of liver cancer cells to all-trans retinoic acid by increasing the expression of retinoic acid receptor γ gene, studies the key molecular mechanisms affecting the sensitivity of tumors to all-trans retinoic acid, and provides a basis for developing effective new drug combination strategies.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides use of an EZH2 inhibitor in increasing the expression level of retinoic acid receptor γ.

[0009] In the present invention, based on clinical work, 10 liver cancer patients with PVTT who were treated with all-trans retinoic acid (ATRA) combined with FOLFOX4 chemotherapy were selected for transcriptomic analysis of liver cancer tissues (5 patients with good results using the combined chemotherapy regimen and 5 patients with poor results). It was found that the main reason for a small number of liver cancer patients to develop resistance to ATRA was the low expression of the RARγ receptor, that is, the anti-cancer effect of ATRA was restricted by the expression of RARG (the encoding gene of the RARγ receptor). CHIP-seq analysis found that: H3K27me3 was enriched upstream of the RARG promoter, and the EZH2 inhibitor could reduce the enrichment of H3K27me3 in the RARG promoter region and activate the expression of RARG, thereby increasing the expression level of the RARγ receptor and thus increasing the sensitivity of tumor cells to ATRA.

[0010] Preferably, the EZH2 inhibitor comprises any one of GSK-126, tazemetostat, CPI-1205, SHR2554 or PF-06821497, or a combination of at least two thereof.

[0011] In a second aspect, the present invention provides a method for increasing the expression level of retinoic acid receptor γ for the purpose of non-disease diagnosis and / or treatment, the method comprising:

[0012] An EZH2 inhibitor is administered to the target subject to increase the expression level of retinoic acid receptor γ.

[0013] In the present invention, the EZH2 inhibitor can be used as a promoter to increase the expression level of retinoic acid receptor γ, and applied to basic research on retinoic acid receptor γ-related behaviors, such as constructing a retinoic acid receptor γ high expression model.

[0014] Preferably, the target object includes in vitro cells, in vitro organs or experimental animals, etc.

[0015] It can be understood that the experimental animals refer to animals used for drug experiments in the art, including rats, mice or rabbits, etc.

[0016] Preferably, the EZH2 inhibitor comprises any one of GSK-126, tazemetostat, CPI-1205, SHR2554 or PF-06821497, or a combination of at least two thereof.

[0017] In a third aspect, the present invention provides use of an EZH2 inhibitor in the preparation of a preparation for increasing the expression level of retinoic acid receptor γ.

[0018] Preferably, the preparation further comprises excipients.

[0019] Preferably, the excipients include any one or a combination of at least two of a pharmaceutically acceptable carrier, a wetting agent, a disintegrant, an emulsifier, a solubilizer, an osmotic pressure regulator, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant, an antibacterial agent or a buffer.

[0020] In a fourth aspect, the present invention provides the use of an EZH2 inhibitor for non-therapeutic purposes in the preparation of a preparation for increasing the expression level of retinoic acid receptor γ.

[0021] In the present invention, it was found that the EZH2 inhibitor can reduce the enrichment of H3K27me3 in the RARG promoter region and activate the expression of RARG, thereby increasing the expression level of the RARγ receptor. It can be used as an RARγ receptor expression promoter in basic research on retinoic acid receptor γ-related behaviors.

[0022] In a fifth aspect, the present invention provides a pharmaceutical composition comprising an EZH2 inhibitor and all-trans retinoic acid.

[0023] The present invention found that RARγ is the main receptor that mediates the anti-cancer effect of ATRA, and that the EZH2 inhibitor can promote the expression of RARγ by reducing the modification of H3K27me3. The strategy of using the EZH2 inhibitor in combination with ATRA was further developed, and it was found that the EZH2 inhibitor combined with ATRA has a synergistic inhibitory effect on tumor proliferation, can promote tumor cell apoptosis and block cells in the G1 phase, and can inhibit tumor cell migration, which is of great significance in the field of tumor treatment.

[0024] It is understood that the EZH2 inhibitor and all-trans retinoic acid in the pharmaceutical composition may exist in independent forms and can be administered to the target subject simultaneously when used.

[0025] Preferably, the administration concentration of the EZH2 inhibitor in the pharmaceutical composition is 5 μM to 10 μM, including but not limited to 6 μM, 7 μM, 8 μM or 9 μM, and the administration concentration of all-trans retinoic acid is 20 μM to 50 μM, including but not limited to 21 μM, 22 μM, 23 μM, 24 μM, 25 μM, 26 μM, 27 μM, 28 μM, 29 μM, 35 μM, 40 μM, 45 μM, 46 μM, 47 μM, 48 μM or 49 μM.

[0026] Preferably, the EZH2 inhibitor comprises any one of GSK-126, tazemetostat, CPI-1205, SHR2554 or PF-06821497, or a combination of at least two thereof.

[0027] In a sixth aspect, the present invention provides use of the pharmaceutical composition described in the fifth aspect in the preparation of a drug for treating tumors.

[0028] Preferably, the tumor comprises liver cancer.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention creatively discovered that RARγ is the main receptor that mediates the anti-cancer effect of ATRA, and that the EZH2 inhibitor can promote the expression of RARγ by reducing the modification of H3K27me3. The strategy of using the EZH2 inhibitor in combination with ATRA was further developed, and it was found that the EZH2 inhibitor combined with ATRA has a synergistic inhibitory effect on tumor proliferation, increases the sensitivity of tumors to ATRA, can promote tumor cell apoptosis and block cells in the G1 phase, and can inhibit tumor cell migration, which provides an experimental and theoretical basis for the synergistic anti-tumor effect of the two drugs, and is of great significance to the field of tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the RNA-seq volcano map of clinical liver cancer patients;

[0032] Figure 2 This is a graph showing the interference efficiency test of siRNA RARα, siRNA RARβ and siRNA RARγ in Hep3B cells;

[0033] Figure 3 This is the MTT proliferation experiment diagram of Hep3B cells after siRNA RARα, siRNA RARβ and siRNA RARγ interference;

[0034] Figure 4A This is the result diagram of the effect of ATRA on cell proliferation after siRNA RARα, siRNA RARβ and siRNA RARγ interference in Hep3B cells;

[0035] Figure 4B The results of the sensitivity of Hep3B cells to ATRA after interference with siRNA RARα, siRNA RARβ and siRNA RARγ;

[0036] Figure 5A This is the gene expression diagram of RARγ promoted by GSK126 treatment in Hep3B;

[0037] Figure 5B GSK126 treatment of Hep3B promoted the protein expression of RARγ;

[0038] Fig. 6A Enrichment analysis of H3K27me3 in the RARG promoter region;

[0039] Figure 6BSchematic diagram of the sites for primer design for ChIP-PCR targeting the RARG promoter region;

[0040] Fig. 7A Agarose gel electrophoresis diagram of ChIP experiment to verify the RARG chromatin enrichment of H3K27me3 after GSK126 action;

[0041] Figure 7B The statistical diagram of RARG chromatin enrichment of H3K27me3 after the action of GSK126 was verified by ChIP experiment;

[0042] Fig. 8A This is the MTT test of the synergistic effect of ATRA and GSK126 combined in Hep3B cells;

[0043] Figure 8B This is the MTT test of the synergistic effect of ATRA and GSK126 combined in HepG2 cells;

[0044] Figure 8C This is a diagram of the synergistic effect of ATRA and GSK126 combined in SMMC-7721 cells tested by MTT;

[0045] Fig.9A To test the synergistic effect of ATRA and GSK126 combination in Hep3B cells for clone formation experiments;

[0046] Fig. 9B To test the synergistic effect of ATRA and GSK126 combination in HepG2 cells for clone formation experiment;

[0047] Fig. 9C To test the synergistic effect of ATRA and GSK126 combination in SMMC-7721 cells for clone formation experiments;

[0048] Fig. 10A It is the expression level of mRNA level of RARG in Hep3B, HepG2 and SMMC-7721 cell lines;

[0049] Fig. 10B It is the expression level of RARγ protein in Hep3B, HepG2, and SMMC-7721 cell lines;

[0050] Fig.11A To test the apoptosis-promoting effect of ATRA and GSK126 combined in Hep3B cells by flow cytometry experiment;

[0051] Fig. 11B This is the result of flow cytometry experiment to test the effect of ATRA and GSK126 combined with other drugs on promoting apoptosis in HepG2 cells;

[0052] Fig. 11C This is a flow cytometry experiment to test the effect of ATRA and GSK126 combined with other drugs on promoting apoptosis in SMMC-7721 cells;

[0053] Fig. 12A Cell cycle experiment to test the synergistic effect of ATRA and GSK126 combination in Hep3B cells;

[0054] Fig. 12B Diagram for the cell cycle experiment to test the synergistic effect of ATRA and GSK126 combination in HepG2 cells;

[0055] Fig. 12C The cell cycle experiment examined the synergistic effect of ATRA and GSK126 combination in SMMC-7721 cells;

[0056] Fig.13 Western Blotting was used to detect the protein expression of apoptosis and cell cycle molecular markers in Hep3B, HepG2 and SMMC-7721 cells after combined use of ATRA and GSK126;

[0057] Fig.14A The scratch assay was used to test the inhibitory effect of ATRA and GSK126 combined with other drugs on HepG2 cell migration.

[0058] Fig. 14B The diagram for the scratch assay to test the inhibitory effect of ATRA and GSK126 combined with Hep3B cell migration;

[0059] Fig. 14C This is a scratch experiment to test the inhibitory effect of ATRA and GSK126 combined with SMMC-7721 cell migration. DETAILED DESCRIPTION

[0060] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0061] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0062] Example 1

[0063] This example analyzes the relationship between the low expression of retinoic acid receptor γ (RARγ) in liver cancer cells and the sensitivity of liver cancer patients to ATRA.

[0064] In order to study the molecular mechanism leading to the difference in sensitivity of liver cancer patients to ATRA, in this example, liver cancer tissues of 10 patients with advanced liver cancer were collected and divided into two groups according to the efficacy of ATRA combined with FOLFOX4 chemotherapy in liver cancer patients, one group was liver cancer patients with good efficacy (partial response, PR) (5 cases), and the other group was liver cancer patients with poor efficacy (stable disesase, SD) (5 cases). Transcriptome sequencing was performed on the liver cancer tissue specimens of the above two groups of patients, quality control was performed according to the Q30 standard, and differential analysis was performed using DESEQ. The results are as follows: Figure 1 As shown in the figure, the expression of RARγ in the SD group was significantly lower than that in the PR group.

[0065] To clarify whether RARγ is the main receptor mediating the anti-cancer effect of ATRA, we detected the effects of retinoic acid receptors (RARα, RARβ and RARγ) on cell proliferation. We used RARα siRNA (nucleic acid sequence: Forward: CCCUCAGUUAGAAGAGCUAUTT; Reverse: AUGAGCUCUUCUAACUGAGGGTT) and RARβ siRNA (nucleic acid sequence: Forward: GCTAGCGCCACCATGAAGCTGAGTAGAAT; Reverse: GGATCCTTATTG CACGAGTGGTGACTGAC), RARγ siRNA (nucleic acid sequence: Forward: UUCUCCGAACGUGUCACGUTT; Reverse: ACGUGACACGUUCGGAGAATT) were used to perform RNA interference (RNAi) experiments in three liver cancer cell lines (Hep3B, HepG2, SMMC-7721), and the interference efficiency was detected by qPCR. The specific experimental process included: Hep3B liver cancer cell lines were inoculated in 6-well plates at 500,000 / well (grouping: NC group (negative control group, i.e., no RNA interference), siRNA RARα group, siRNA RARβ group and siRNA RARγ group), and the culture medium was discarded after the cells adhered to the wall and replaced with fresh culture medium. Lipofectamine TM RNAiMAX transfection reagent (13778150, Invitrogen, Carlsbad, CA) and siRNA 50 nM (Sangon, Shanghai, China) were incubated in opti-MEM to form a complex, which was added to a 6-well plate replaced with fresh culture medium for interference for 48 h. After interference, cells in each group were collected for qPCR testing.

[0066] qPCR test results Figure 2As shown, the expression levels of RARα, RARβ and RARγ were reduced by 50%, 60% and 70%, respectively. At the same time, the effect of retinoic acid receptors (RARα, RARβ and RARγ) on the proliferation of liver cancer cell lines was determined by MTT experiment. The specific experimental process includes: the interference process is the same as above, and the cells of each group are collected after interference, and the cells are counted and re-plated into 96-well plates at 2000 / well. After 24h, 48h, and 72h, the cells were incubated with MTT solution (ST316, Biyuntian, Nanjing, China) at 37℃ for 60min, and the supernatant was discarded. 100μL of DMSO was added to dissolve the formazan, and the light absorption value at 490nm was measured by microplate reader, that is, OD 490 value.

[0067] The results are as follows Figure 3 As shown: compared with the NC group, the 3-day proliferation rate of the RARγ siRNA group was (83.6±18)%, and the 3-day proliferation rate of the NC group was (37.5±10)%, and there was a statistical difference (p<0.0001); the 3-day proliferation rate of the RARα siRNA group was (25.7±5.9)%, and the 3-day proliferation rate of the RARβ siRNA group was (56±20)%; this shows that reducing the expression of RARγ and RARβ increased the cell proliferation rate, and reducing the expression of RARα decreased the cell proliferation rate, indicating that RARγ and RARβ can inhibit cell proliferation, while RARα promotes cell proliferation, among which RARγ has the strongest anti-cancer effect.

[0068] In order to verify that RARγ is the main receptor mediating the anti-cancer effect of ATRA, we treated the cells after interference with RARα, RARβ, and RARγ with DMSO and ATRA (25μmol / L (μM), >98% purity, 2207091, Zeye Biotechnology, Shanghai, China), detected cell proliferation and compared the effects of the three groups on the half-inhibition rate (IC50) of ATRA. The specific experimental process includes: the interference process and grouping are the same as above, and the cells of each group are collected after interference, and the cells are counted and re-plated into 96-well plates at 2000 / well. After the cells adhere to the wall, the supernatant is discarded and fresh culture medium containing 25μM ATRA is added. After 24h, 48h, 72h, and 96h of drug addition, the cells are incubated with MTT solution (ST316, Biyuntian, Nanjing, China) at 37℃ for 60min, the supernatant is discarded, 100μL of DMSO is added to dissolve formazan, and its light absorption value at 490nm, i.e. OD, is measured by an enzyme marker. 490 Re-plate into 96-well plates at 10,000 / well, with one 96-well plate for each group.

[0069] ATRA IC 50Method for determination of OD value: After cells adhere to the wall, discard the supernatant and add medium containing ATRA (ATRA concentration gradient: 20μM, 40μM, 80μM, 160μM, 320μM). After incubation with drugs for 48 hours, remove the drugs. Add medium containing MTT solution (ST316, Biyuntian, Nanjing, China) and incubate at 37℃ for 60 minutes, discard the supernatant, add 100μL DMSO to dissolve formazan, and use a microplate reader to measure its light absorption value at 490nm, i.e. OD 490 IC values ​​were calculated using Graphpad Prism 7.0 software. 50 The logarithm of drug concentration is taken as the horizontal axis, the cell survival rate is taken as the vertical axis, and the drug concentration corresponding to the cell survival rate of 50% is IC 50 value.

[0070] The results are as follows Figure 4A As shown, under the action of ATRA, the OD of RARγ siRNA group was 490nm The proliferation rate was 269%, while the three-day proliferation rate of the NC group was 236%, and the RARγ siRNA group was significantly faster than the NC group, and there was a statistical difference (P<0.0001); the three-day proliferation rate of the RARα siRNA group was 264%, and the RARγ siRNA group was significantly faster than the RARα siRNA group, and there was a statistical difference (P=0.0055); the three-day proliferation rate of the RARβ siRNA group was 254%, and the RARγ siRNA group was significantly faster than the RARβ siRNA group, and there was a statistical difference (P<0.0001). The above results indicate that RARα, RARβ and RARγ synergistically increase the inhibitory effect of ATRA on liver cancer, among which RARγ synergizes with ATRA to inhibit cell proliferation with a stronger ability.

[0071] Effects of RARα siRNA group, RARβ siRNA group and RARγ siRNA group on ATRA IC 50 The test results are as follows Figure 4B As shown in the figure, we found that after RARγ was disrupted, the IC of ATRA in liver cancer cells was 50 The IC of ATRA in liver cancer cells after RARα was disrupted was 68.55±5.50μM. 50 The IC of liver cancer cells was 50.73±4.71μM (P=0.037). 50 The sensitivity of liver cancer cells in the RARγ siRNA group to ATRA was 49.59±6.70 μM (P=0.0038). This result shows that compared with RARα and RARβ, RARγ is the main receptor that mediates ATRA to inhibit the proliferation of liver cancer cells.

[0072] Example 2

[0073] This example verifies that EZH2 inhibitors (GSK-126 for example) promote the expression of RARγ by reducing the modification of H3K27me3.

[0074] According to the analysis in Example 1, how to increase the expression of RARγ is the key to solving the ATRA resistance of liver cancer. EZH2 catalyzes the formation of the transcriptional inhibitory epigenetic modification H3K27me3. As shown in Figure 5-A, H3K27me3 CHIP-seq analysis found that H3K27me3 was enriched upstream of the promoter of the RARγ coding gene RARG. Therefore, we speculate that the inhibitor of EZH2 (GSK-126) will reduce the level of the entire H327me3 in the cell, and then the level of H3K27me3 in the RARγ promoter region will also decrease, thereby promoting the transcription of the RARγ coding gene RARG.

[0075] In order to detect the effect of GSK-126 on RARγ expression, Hep3B, HepG2, and SMMC-7721 cells were treated with GSK-126 (>98% purity, C22M11L113783, Yuanye Bio, Shanghai, China) and DMSO, respectively. Specifically, Hep3B cells were seeded in 6-well plates at 500,000 / well. After the cells adhered to the wall, fresh medium containing GSK126 was replaced and grouped into normal group, DMSO group, and GSK126 5μM group. After 48h of drug treatment, cells were collected, and total cell RNA was extracted using TRIzol (Ederland, Beijing, China) reagent. The obtained mRNA was reverse transcribed into cDNA using RNA reverse transcription kit (Perfect Real Time, Takara, Japan). The reverse transcription procedure was: reverse transcription at 37℃ for 15min; reverse transcriptase inactivation at 85℃ for 5s; storage at 4℃. Then, real time PCR was performed using SYBR Premix Ex Taq II (Takara). The PCR program was 95°C denaturation for 5s, 60°C annealing and extension for 30s, for a total of 40 cycles, with 95°C pre-denaturation for 30s before the first cycle. The 2-ΔΔCt method was used to compare β-actin expression for data analysis. The primers used in this study were purchased from Shanghai Bioengineering Company, and the primer sequences are shown in Table 1.

[0076] Table 1

[0077] Gene Sequence (5'-3') hRARγ:Forward GCTAGCGCCACCATGGTGTACACGTGTC hRARγ:Reverse GGATCCTCAGGCTGGGGACTTCAGGCCC hRARβ:Forward GCTAGCGCCACCATGAAGCTGAGTAGAAT hRARβ:Reverse GGATCCTTATTGCACGAGTGGTGACTGAC hRARα:Forward GCTAGCGCCACCATGGCCAGCAACAGCA hRARα:Reverse GGATCCTCACGGGGAGTGGGTGGCC β-actin:Forward TTGTGATGGACTCCGGAGAC β-actin:Reverse TGATGTCACGCACGATTTCC (Chip)RARγ:Forward GCGATACAGCGGGGTAGAG (Chip)RARγ:Reverse ATCCACTACTGTGTTGGCTCC

[0078] The Western Blotting experiment process was to collect cells after 48 hours of drug treatment and add 60 μL RIPA to extract total protein. The total protein concentration was determined by BCA protein assay kit (P0012, Beyotime, Nanjing, China). The boiled sample protein (20 μg) was separated by SDS-PAGE and transferred to a PVDF membrane. The PVDF membrane was then blocked with 5% skim milk for 1 hour and washed 3 times with 1×TBST, each time for 5 minutes. Next, the PVDF membrane was incubated with primary antibodies at 4°C overnight, including β-Actin Rabbit Monoclonal Antibody (AF5003, Beyotime, Nanjing, China) and RARγ Mouse Polyclonal Antibody (sc-7387, Santa Cruz Biotechnology, USA). The primary antibody was recovered the next day, and after washing the membrane, it was incubated with horseradish peroxidase-labeled goat anti-mouse secondary antibody (1:1000) (A0286, Beyotime, Nanjing, China) for 2 hours. The bands were obtained after washing the membrane and developing. β-actin was used as an internal reference, and grayscale value quantification was performed using ImageJ.

[0079] The experimental operation was performed according to the instructions of ChIP Assay Kit (P2078, Biyuntian, Nanjing, China). The experimental group was divided into 3 groups: control group (control): no treatment, DMSO treatment group: DMSO final concentration 5μm / L, GSK126 treatment group: GSK126 total concentration 0.1μm / L. 1×10 7 Cells were inoculated in a 10 cm culture dish, fixed with 1% formaldehyde after drug treatment for 72 h, collected with cell collection solution (100 mmol / L Tris-Cl, pH 9.4, 10 mmol / L DTT), washed 3 times with ice-cold PBS, and then lysed with cell lysis solution containing 1 mM PMSF. Ultrasonication was performed with an ultrasonic disruptor at 30% power for 10 s, paused for 10 s, and cycled 10 times to obtain 300-1000 bp chromatin fragments. The supernatant was collected and chromatin immunoprecipitation was performed with H3K27me3 Mouse Monoclonal Antibody or IgG (negative control) antibody. The precipitated DNA was used as a substrate, and qPCR amplification was performed using RARγ promoter-specific primers. The qPCR products were separated by 3% agarose gel electrophoresis to confirm the content of the DNA sequence in the promoter region of the RARG gene in the DNA precipitated by the anti-H3K27me3 antibody. The primer sequences are shown in Table 1.

[0080] Then, the expression level of RARγ was detected by RT-PCR and Western Blotting. Figure 5A and Figure 5B ), qPCR results showed that compared with the DMSO group, the relative expression of RARG mRNA in the GSK-126 group in Hep3B was 2.3±0.3 times (P=0.096), and Western blot results showed that GSK126 reduced the level of H3K27me3 and significantly increased the expression of RARγ protein. The above results indicate that GSK-126 can promote the expression level of RARγ in Hep3B cells.

[0081] In order to clarify whether GSK-126 affects the enrichment of H3K27me3 in the RARG promoter region, we designed primers in the RARG promoter region (Figure 6) and used CHIP-PCR to detect the enrichment of H3K27me3 in the upstream promoter region of RARG. Fig. 7A and Figure 7B As shown in the figure, the input is the genomic DNA after the break, the H3K27me3 group is the group using H3K27me3 antibody for chromatin immunoprecipitation, and the negative control group is the negative control group, that is, no antibody is used for chromatin immunoprecipitation, but the experimental operation is the same as the antibody chromatin immunoprecipitation. We calculated the enrichment of H3K27me3 in the promoter region of RARG in the three groups of cells by calculating the amount of PCR products. The results showed that compared with the DMSO group, the relative amount of the PCR product of anti-H3K27me3 IP was 0.32. This result shows that GSK-126 can increase the expression level of RARγ by reducing the enrichment of H3K27me3 in the promoter region of RARG.

[0082] Example 3

[0083] This example verifies that GSK-126 combined with ATRA has a synergistic effect of inhibiting tumor proliferation.

[0084] RARγ is the main receptor that mediates ATRA to inhibit the proliferation of liver cancer cells, and GSK126 has the effect of promoting the expression of RARγ. It can be inferred that the combined use of ATRA and GSK-126 can increase the response rate of liver cancer patients to ATRA and thus have a better anti-cancer effect. For this reason, this example uses Hep3B, HepG2 and SMMC-7721 as models, and treats them by using ATRA alone, GSK-126 alone, and the combination of the two. The effect of the combined use of ATRA and GSK-126 on the proliferation of liver cancer cells is explored by MTT experiments and clone formation experiments, respectively. The specific experimental process includes: Hep3B, HepG2, SMMC-7721 three liver cancer cell lines are inoculated in 96-well plates at 10,000 / well, respectively, and treated with drugs after adherence. The experiment was divided into 5 groups: normal group; DMSO group: the final concentration of DMSO was 5μm / L; ATRA group: the concentration gradient of ATRA was 20μM, 40μM, 80μM, 160μM and 320μM; GSK-126 group: the concentration gradient of GSK126 was 4μM, 8μM, 16μM, 32μM, 64μM; combined drug group: ATRA and GSK-126 were mixed in a ratio of 5:1 according to the above concentration gradient. After adding drugs, each group was incubated for 48h, incubated with MTT solution (ST316, Biyuntian, Nanjing, China) at 37℃ for 60min, and then the supernatant was discarded. 100μL of DMSO was added to dissolve formazan, and its light absorption value at 490nm, i.e. OD 490 value, was measured by microplate reader. IC was calculated using Graphpad Prism 7.0 software 50 The logarithm of drug concentration is taken as the horizontal axis, the cell survival rate is taken as the vertical axis, and the drug concentration corresponding to the cell survival rate of 50% is IC 50 CompuSyn software was used to calculate the synergistic index (CI) of different concentrations of ATRA and GSK-126 in a fixed ratio and draw the Fa-CI diagram. If CI < 1, the two drugs are considered to have a synergistic effect, CI = 1 is an additive effect, and CI > 1 is an antagonistic effect. The Fa-CI diagram can be used to visually judge the relationship between the dose and effect of the combined drugs and the changing trend according to the position of the measurement point of the comparison reagent falling into the area of ​​the diagram. Hep3B, HepG2, and SMMC-7721 three liver cancer cell lines were inoculated in 12-well plates at 1000 / well, and according to the above grouping, they were treated with drugs after adhesion. The culture medium containing drugs was replaced every 3 days. After 7 days of treatment, they were fixed with 4% paraformaldehyde for 20 minutes, eluted with PBS buffer 3 times, stained with 0.1% crystal violet (C8470, Solarbio, Nanjing, China) for 30 minutes, eluted with PBS buffer 3 times, and photographed.

[0085] MTT results are as follows Figure 8A-8CAs shown in the results, GSK-126 and ATRA, as well as the combination of the two drugs at a fixed ratio, had a significant inhibitory effect on the proliferation of liver cancer cells Hep3B, HepG2, and SMMC-7721. In SMMC-7721 cells, the inhibition rate of the combination of the two drugs (49.47±0.81%) was significantly higher than that of the ATRA group (14±1.09%) and the GSK126 group (6±0.70%) alone (P<0.0001). In HepG2 cells, the inhibition rate of the combination of the two drugs (49.47±0.81%) was significantly higher than that of the ATRA group (14±1.09%) and the GSK126 group (6±0.70%) alone (P<0.0001). The inhibition rate of the combined use of the two (42.47±2.46%) was significantly higher than that of ATRA (24.14±2.70%) and GSK126 (11.88±0.91%) alone (P<0.0001). In the Hep3B cell line, the inhibition rate of the combined use of the two (27.33±2.99%) was significantly higher than that of ATRA (7.62±1.21%) and GSK126 (2.10±0.46%) alone (P<0.0001).

[0086] The results of the clone formation experiment are shown in Figure 9. The combined use of different concentrations of drugs is better than single drug in inhibiting the clone formation of HepG2, SMMC-7721 and Hep3B cells. 50 The synergistic effect of the two drugs combined was most significant in Hep3B.

[0087] Table 2

[0088] Hep3B HepG2 SMMC-7721 <![CDATA[ATRA IC 50 (uM)]]> 48.37±13.74 60.993±1.35 65.88±10.49 <![CDATA[GSK126IC 50 (uM)]]> 16.88±2.16 15.313±1.01 15.47±0.53 <![CDATA[Combined drug IC 50 (uM)]]> 13.58±7.10 23.0823±2.56 27.65±2.70 CI 0.39±0.18 0.522 0.65±0.025

[0089] In order to explore the mechanism of the difference in sensitivity of Hep3B, HepG2 and SMMC-7721 cells to ATRA, qPCR and Western blot were used to detect the expression of RARγ in Hep3B, HepG2 and SMMC-7721 cells. The results showed that among the three cell lines Hep3B, HepG2 and SMMC-7721, the mRNA expression of RARγ in Hep3B ( Fig. 10A ) and protein expression (e.g. Fig. 10B ) were the lowest, and there was a significant difference. Therefore, the best synergistic effect of ATRA and GSK-126 in Hep3B cells may be related to the lowest expression of RARγ in Hep3B cells.

[0090] GSK126 combined with ATRA promoted cell apoptosis and arrested liver cancer cells in the G1 phase.

[0091] To this end, this example uses Hep3B, HepG2 and SMMC-7721 as models, and treats them with ATRA alone, GSK-126 alone, and the combination of the two. The effects of the combined use of ATRA and GSK-126 on the proliferation of liver cancer cells are investigated by flow cytometry and cell cycle experiments. The specific experimental process is as follows: Hep3B, HepG2, and SMMC-7721 liver cancer cell lines are treated with 5×10 5 / well inoculated in a 6-well plate. The experiment was divided into 5 groups: Control group: normal group, DMSO group: DMSO final concentration of 5μM / L, ATRA group: ATRA final concentration of 25μM / L, GSK-126 group: GSK-126 final concentration of 5μM / L, combined drug group: 25μM / L ATRA and 5μM / L GSK-126 were added. After 24h of drug treatment, the cells were collected and stained with Annexin V-FITC apoptosis detection kit (C1062M, Beyotime Biotechnology, Nanjing, China) and cell cycle detection kit (C1052, Beyotime Biotechnology, Nanjing, China) according to the instructions, and the apoptosis rate and cell cycle of the cells were detected by flow cytometry. FlowJo 7.6 software was used for data analysis, and the apoptosis rate = (the number of early apoptotic cells + the number of late apoptotic cells) / total number of cells × 100%. Cell cycle analysis was performed to determine the proportion of each cell cycle (G1, S, G2 / M) of liver cancer cells Hep3B, HepG2, and SMMC-7721. The experiment was repeated three times.

[0092] We examined the apoptosis and cell cycle of SMMC-7721, Hep3B, and HepG2 cells. Fig.11A As shown, in Hep3B cell line, the apoptosis rate of the combination group (67.9±0.95)% was higher than that of the ATRA group (37.7±0.72)% and the GSK-126 group (12±0.36)% (P<0.0001). Fig. 11B ), the apoptosis rate of the combination group (51.3±2.1)% was higher than that of the GSK-126 group (13.8±0.07)% and the ATRA group (32.35±2.59)% (P<0.0001). Fig. 11C ), the apoptosis rate of the combined group (69.2±1.0)% was higher than that of the GSK126 group (13.1±0.3)% and the ATRA group (15.2±0.4%) (P<0.0001). These results indicate that the combined use of ATRA and GSK-126 can induce cell apoptosis more effectively than either of them alone.

[0093] The cell cycle results showed that in Hep3B cells (such as Fig. 12A ), the proportion of S phase cells in the ATRA and GSK-126 combination group (11.97±4.61%) was significantly lower than that in the ATRA alone group (35.23±1.01)% and the GSK-126 alone group (34.41±0.47%) (P<0.0001). Fig. 12C ), the proportion of S phase cells in the combination group (0%) was significantly lower than that in the ATRA group alone (29.48±1.09%) and the GSK-126 group alone (32.05±5.63%) (P<0.0001). Fig. 12B ), the proportion of S phase cells in the combination group (0%) was significantly lower than that in the ATRA group alone (28.38±1.29%) and the GSK-126 group alone (29.27±1.38%) (P<0.0001). About 50% of the cells in the three liver cancer cell lines were accumulated in the G1 phase, indicating that the liver cancer cell cycle was arrested in the G1 phase. This suggests that GSK-126 can significantly enhance the effect of ATRA in inducing cell apoptosis, which may be the main mechanism of ATRA combined with GSK126 in the anti-HCC effect.

[0094] We further tested the effects of combined use of ATRA and GSK-126 on cell cycle-related proteins and apoptosis-related proteins by Western blot. Fig.13 ), the expression of cell cycle-related proteins CDK4, CDK6, and CyclinD1 in the G1 phase of HepG2, SMMC-7721, and Hep3B cells in the combination group was lower than that in the ATRA group and the GSK-126 group, indicating that the liver cancer cell cycle was blocked in the G1 phase. In addition, the expression of apoptosis-related proteins Caspase3 and p53 in HepG2, SMMC-7721, and Hep3B cells in the combination group was higher than that in the ATRA group and the GSK-126 group, indicating that ATRA combined with GSK-126 promoted cell apoptosis.

[0095] Verify that GSK-126 combined with ATRA inhibits liver cancer cell migration.

[0096] The scratch test was performed on five groups of cells, namely, the normal group, the DMSO group, the GSK-126 group, the ATRA group, and the ATRA+GSK126 combined group. The specific process included: the liver cancer cell lines Hep3B, HepG2, and SMMC-7721 were treated with 5×10 5 / well inoculated in a 12-well plate. The experiment was divided into 5 groups: the grouping method was the same as 2.7. After the cells adhered to the wall and the cell confluence reached 90%, they were scratched with a 200μL sterile pipette tip and treated with drugs. After 0h and 24h of drug addition, they were observed and photographed under an inverted microscope. The scratch distance was analyzed using Image J software, and the cell migration rate was calculated using Graphpad Prism 7.0 software. Cell migration rate = (0h scratch spacing - 24h scratch spacing) / 0h scratch spacing × 100%. The experiment was repeated 3 times.

[0097] The results show (such as Figure 14A-Figure 14C ), at 0 hours, the scratch widths of the five groups were basically the same, and no cell migration was observed at the scratches. After 24 hours of treatment, the scratch width decreased, and cells migrated to the scratch area. The migration rate of SMMC-7721 cells in the combined group (19.6±4.6%) was significantly lower than that in the control group (37.4±3.8%), DMSO group (37.9±5%), GSK-126 group (36.8±2.8%), and ATRA group (34.7±2.6%) (P<;0.0001). The migration rate of Hep3B cells treated with ATRA and GSK126 (11.8±3.5%) was significantly lower than that in the control group (31.9±4)%, DMSO group (34.6±4%), GSK-126 group (28.6±3%), and ATRA group (15±3.7%) (P=0.0003). The migration rate of HepG2 cells in the ATRA+GSK126 group (26.5±4.8%) was significantly lower than that in the control group (51.0±2.6%), DMSO group (59.2±5.7%), GSK-126 group (41.1±3.3%), and ATRA group (39.5±3.9%) (P=0.0004). Therefore, the combination of ATRA and GSK-126 can effectively inhibit the migration of liver cancer cells.

[0098] In summary, the present invention creatively discovered that RARγ is the main receptor that mediates the anti-cancer effect of ATRA, and that EZH2 inhibitors can promote the expression of RARγ by reducing the modification of H3K27me3. The strategy of using EZH2 inhibitors in combination with ATRA was further developed, and it was found that EZH2 inhibitors combined with ATRA have a synergistic inhibitory effect on tumor proliferation, can promote tumor cell apoptosis and block cells in the G1 phase, and can inhibit tumor cell migration, which is of great significance in the field of tumor treatment.

[0099] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. Application of GSK-126 in the preparation of a preparation for enhancing the anti-liver cancer effect of all-trans retinoic acid.

2. The use according to claim 1, characterized in that: The preparation also includes auxiliary materials.

3. The use according to claim 2, characterized in that: The excipients include any one or a combination of at least two of pharmaceutically acceptable wetting agents, disintegrants, emulsifiers, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, antibacterial agents or buffers.

4. A method for enhancing the response of liver cancer cells to all-trans retinoic acid for the purpose of non-disease diagnosis and / or treatment, characterized in that: The method comprises: GSK-126 is administered to the subject to enhance the response of the liver cancer cells to all-trans retinoic acid.

5. The method for enhancing the response of liver cancer cells to all-trans retinoic acid for the purpose of non-disease diagnosis and / or treatment according to claim 4, characterized in that: The target objects include in vitro cells, in vitro organs or experimental animals.

6. Use of a pharmaceutical composition comprising GSK-126 and all-trans retinoic acid in the preparation of a drug for treating liver cancer.

Images