A method for preparing a non-human mammal or offspring thereof and uses thereof

By gene editing to knock out the CH1 domain of the IgM and part of the IgG heavy chain constant region in non-human mammals, non-human mammals suitable for heavy chain antibody production were prepared. This solved the problem of large subclass differences of heavy chain antibodies among different mammals and enabled the efficient production of heavy chain antibodies with high specificity and affinity.

CN116194586BActive Publication Date: 2026-03-20RENGENE BIOTECHNOLOGY CO LTD +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202180054115.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-09-04
Filing Date
2021-09-02
Publication Date
2026-03-20
Estimated Expiration
2041-09-02

AI Technical Summary

Technical Problem

Existing technologies are not effective in preparing heavy chain antibodies from non-human mammals or their offspring, and the subclasses of heavy chain antibodies vary greatly among different mammals, affecting the specificity and affinity of the antibodies.

Method used

By using gene editing technology, the CH1 domain of the IgM heavy chain constant region and part or all of the CH1 domain of the IgG heavy chain constant region in the genome of non-human mammals are knocked out to ensure the expression of heavy chain antibodies. Gene knockout is performed using the CRISPR/Cas9 method, while preserving the expression of κ light chain and/or λ light chain.

Benefits of technology

The prepared non-human mammals or their progeny can efficiently produce heavy chain antibodies with high specificity and affinity, and normal immune response, making them suitable for the production of heavy chain antibodies, especially IgG2c antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116194586B_ABST
    Figure CN116194586B_ABST
Patent Text Reader

Abstract

The present application relates to a method for preparing a non-human mammal or its offspring and its use, the method comprising the following steps: a step of making the non-human mammal not express or not correctly express the CH1 domain of the IgM heavy chain constant region; and a step of making the non-human mammal not express or not correctly express the CH1 domain when expressing one, two, three, four or more than four genes encoding the IgG heavy chain constant region. The resulting non-human mammal or its offspring can be used to produce heavy chain antibodies. The non-human mammal obtained by the method of the present application does not introduce any exogenous genes encoding antibody heavy chain variable and constant regions, and can directly utilize all VDJ genes encoding antibody heavy chain variable regions in its own genome, thereby producing heavy chain antibodies with better diversity through heavy chain variable region rearrangement.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-referencing

[0002] This application claims priority to patent application No. 202010924095.1, filed on September 4, 2020, entitled "A method for preparing a non-human mammal or its offspring and its application thereof", the entire contents of which are incorporated herein by reference. Technical Field

[0003] This application relates to the field of biotechnology, specifically to a method for preparing a non-human mammal or its offspring and its application, wherein the non-human mammal or its offspring can be used to produce heavy chain antibodies. Background Technology

[0004] An antibody is a four-peptide chain structure consisting of two identical heavy chains (H chains) and two identical light chains (L chains) linked by non-covalent or disulfide bonds. The antibody heavy chain includes the heavy chain constant region (C...). H ) and heavy chain variable region (V H ); where: the heavy chain constant region of IgD, IgG, and IgA includes 4 domains: CH1, hinge region, CH2, CH3; IgM and IgE include 4 domains: CH1, CH2, CH3, CH4 (Janeway's Immunobiology, 9 th Edition); the CH1 domain of the heavy chain constant region is connected to the light chain constant region via disulfide bonds; the heavy chain variable region includes a highly variable region of complementarity-determining regions (CDRs) and a relatively conservative region called the framework region (FRs). The heavy chain variable region includes 3 CDRs and 4 FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0005] Based on the differences in antigen specificity within the constant region of the antibody heavy chain, antibodies are classified into five classes: IgM, IgD, IgG, IgE, and IgA. Even within the same class, antibodies can be further subdivided into several subclasses due to variations in antigen specificity within their heavy chain constant regions. For example, human IgG includes IgG1, IgG2, IgG3, and IgG4; human IgA includes IgA1 and IgA2; and the subclasses of antibodies may differ between different mammals (such as humans, alpacas, and mice) and between different strains of mice (such as C57BL / 6 mice and BALB / c mice).

[0006] Genes associated with antibody heavy chains include five gene segments: L, V, D, J, and C. The variable region of the heavy chain is encoded by gene segments V, D, and J, while the constant region is encoded by gene segment C. Human antibody heavy chain genes include approximately 40 functional V genes, 23 D genes, 6 J genes, and 9 C genes (Source: Janeway's Immunobiology, 9). th (Edition, Page 177). The gene encoding the IgM heavy chain constant region is the Ighm gene (Immunoglobulin heavy constant mu), the gene encoding the IgD heavy chain constant region is the Ighd gene (Immunoglobulin heavy constant delta), the gene encoding the IgG heavy chain constant region is the Ighg gene (Immunoglobulin heavy constant gamma), and the gene encoding the IgA heavy chain constant region is the Igha gene (Immunoglobulin heavy constant alpha), etc. Correspondingly, the gene encoding the IgG1 heavy chain constant region is the Ighg1 gene (Immunoglobulin heavy constant gamma 1), the gene encoding the IgG3 heavy chain constant region is the Ighg3 gene (Immunoglobulin heavy constant gamma 3), and the gene encoding the IgG2b heavy chain constant region is the Ighg2b gene (Immunoglobulin heavy constant gamma 2b). Antibodies with diverse characteristics are generated through rearrangement of the heavy chain variable regions. After mature B cells are stimulated by antigens, they produce secretory antibodies IgM. Upon repeated antigen stimulation, a second rearrangement occurs, and the types of immunoglobulins expressed and secreted on the membrane will change from IgM with low affinity to other classes or subclasses of immunoglobulins such as IgG, IgA, and IgE with high affinity. This phenomenon is called class switch or isotype switch.

[0007] Heavy chain antibodies, also known as heavy chain only antibodies, are immunoglobulin antibodies that consist of only two heavy chains. Naturally occurring heavy chain antibodies exist in nature in camelids and sharks. The heavy chain loci in camelid germlines contain gene segments that encode heavy chain constant regions, and during maturation, the rearranged VDJ joining region is spliced to the 5' end of a gene segment that encodes an IgG hinge region, resulting in IgG2 and IgG3 heavy chain antibodies that lack a CH1 region that mediates binding to light chains and thus cannot bind to light chains. Heavy chain antibodies can also be generated using methods that genetically modify animals, and the classification of the generated heavy chain antibodies is based on the differences in antigen specificity of the heavy chain constant regions of the antibodies.

[0008] Compared with the molecular weight of conventional antibodies (150-160 kDa), heavy chain antibodies are much smaller, and an IgG2c heavy chain antibody has a heavy chain of about 40 kDa, and the heavy chain variable region that determines antigen recognition specificity is only about 15 kDa. Heavy chain antibodies are characterized by small molecular weight and the ability to bind some hidden antigen epitopes, and are particularly suitable for target sites that are difficult to obtain antibodies.

[0009] The information disclosed in this section is only intended to increase the understanding of the general background of the present application and should not be considered as admitting or implying in any form that the information constitutes prior art known to those of ordinary skill in the art. SUMMARY

[0010] Invention objectives

[0011] The purpose of the present application is to provide a method for preparing a non-human mammal or its offspring and its application.

[0012] Solution

[0013] To achieve the purpose of the present application, the present application provides the following technical solutions:

[0014] In a first aspect of the present application, a method for preparing a non-human mammal or its offspring is provided, which comprises the following steps:

[0015] a step of causing the non-human mammal to not express or not correctly express the CH1 domain of the IgM heavy chain constant region in the body of the non-human mammal;

[0016] and a step of causing one, two, three, four or more than four genes encoding the IgG heavy chain constant region in the body of the non-human mammal to not express or not correctly express the CH1 domain when expressed.

[0017] The above method of making, in one possible implementation, comprises a step of causing the non-human mammal to not express or to not correctly express the CH1 domain of the IgM heavy chain constant region:

[0018] The above method of making, in one possible implementation, comprises a step of causing the non-human mammal to not express or to not correctly express the CH1 domain of the IgM heavy chain constant region;

[0019] The above method of making, in one possible implementation, comprises a step of causing the non-human mammal to not express or to not correctly express the CH1 domain of the IgM heavy chain constant region and the CH1 domain of the IgD heavy chain constant region.

[0020] The above method of making, in one possible implementation, comprises a step of causing one, two, three, four or more genes encoding an IgG heavy chain constant region in the non-human mammal to not express or to not correctly express the CH1 domain when expressed:

[0021] The above method of making, in one possible implementation, comprises a step of causing a first gene encoding an IgG heavy chain constant region in the non-human mammal to not express or to not correctly express the CH1 domain when expressed;

[0022] The above method of making, in one possible implementation, comprises a step of causing a first gene encoding an IgG heavy chain constant region in the non-human mammal to not express or to not correctly express the CH1 domain when expressed;

[0023] The above method of making, in one possible implementation, comprises a step of causing a first gene encoding an IgG heavy chain constant region in the non-human mammal to not express or to not correctly express the CH1 domain when expressed;

[0024] The above method of making, in one possible implementation, comprises a step of causing a first gene encoding an IgG heavy chain constant region in the non-human mammal to not express or to not correctly express the CH1 domain when expressed;

[0025] The above method of making, in one possible implementation, comprises a step of causing a first gene encoding an IgG heavy chain constant region in the non-human mammal to not express or to not correctly express the CH1 domain when expressed;

[0026] or, a step that causes the first and second genes encoding IgG heavy chain constant regions in the non-human mammal to express the IgG heavy chain constant regions they encode when expressed, and that causes one or both of the third or fourth genes encoding IgG heavy chain constant regions in the non-human mammal to not express or to not correctly express a CHI domain when expressed;

[0027] or, a step that causes the first and second and third genes encoding IgG heavy chain constant regions in the non-human mammal to express the IgG heavy chain constant regions they encode when expressed, and that causes the fourth gene encoding IgG heavy chain constant regions in the non-human mammal to not express or to not correctly express a CHI domain when expressed. The application also provides a non-human mammal that does not express or does not correctly express a CHI domain of an IgM heavy chain constant region, and that does not express or does not correctly express a CHI domain of one, two, three, four, or more genes encoding IgG heavy chain constant regions.

[0028] In one possible implementation of the above non-human mammal that does not express or does not correctly express a CHI domain of an IgM heavy chain constant region is:

[0029] only a CHI domain of an IgM heavy chain constant region is not expressed or is not correctly expressed;

[0030] or, a CHI domain of an IgM heavy chain constant region and a CHI domain of an IgD heavy chain constant region are not expressed or are not correctly expressed.

[0031] In one possible implementation of the above non-human mammal that does not express or does not correctly express a CHI domain of one, two, three, four, or more genes encoding IgG heavy chain constant regions is:

[0032] a first gene encoding an IgG heavy chain constant region does not express or does not correctly express a CHI domain;

[0033] or, a first gene encoding an IgG heavy chain constant region does not express or does not correctly express the IgG heavy chain constant region it encodes, and one, two, or three of a second or third or fourth gene encoding an IgG heavy chain constant region does not express or does not correctly express a CHI domain;

[0034] or, a first and second gene encoding an IgG heavy chain constant region does not express or does not correctly express the IgG heavy chain constant region it encodes, and one or both of a third or fourth gene encoding an IgG heavy chain constant region does not express or does not correctly express a CHI domain;

[0035] Alternatively, the first, second, and third genes encoding the IgG heavy chain constant region do not express or incorrectly express the IgG heavy chain constant region they encode, and the fourth gene encoding the IgG heavy chain constant region does not express or incorrectly expresses the CH1 domain;

[0036] Alternatively, the first gene encoding the IgG heavy chain constant region correctly expresses the IgG heavy chain constant region it encodes, and one, two, or three of the second, third, or fourth genes encoding the IgG heavy chain constant region do not express or incorrectly express the CH1 domain;

[0037] Alternatively, the first and second genes encoding the IgG heavy chain constant region correctly express the IgG heavy chain constant region they encode, and one or both of the third or fourth genes encoding the IgG heavy chain constant region do not express or incorrectly express the CH1 domain;

[0038] Alternatively, the first, second, and third genes encoding the IgG heavy chain constant region correctly express the IgG heavy chain constant region they encode, and the fourth gene encoding the IgG heavy chain constant region does not express or incorrectly expresses the CH1 domain.

[0039] A second aspect of this application provides a method for preparing a non-human mammal or its offspring, comprising the following steps:

[0040] The steps to knock out nucleotide sequences in the genomes of non-human mammals that include the CH1 domain encoding the IgM heavy chain constant region;

[0041] In addition, the step of knocking out the following target genes, which include: nucleotide sequences encoding the CH1 domain on one, two, three, four or more genes encoding the constant region of the IgG heavy chain.

[0042] This application also provides a non-human mammal whose genome includes a nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region and a target gene that has been knocked out, the target gene comprising:

[0043] Nucleotide sequences encoding the CH1 domain on one, two, three, four or more genes encoding the constant region of the IgG heavy chain.

[0044] In the above preparation method or a possible implementation in non-human mammals, the nucleotide sequence knocked out in the non-human mammal genome, including the CH1 domain encoding the IgM heavy chain constant region, is as follows:

[0045] Knock out only the nucleotide sequence encoding the CH1 domain of the IgM heavy chain constant region in the genome of non-human mammals;

[0046] or, knocking out the nucleotide sequence encoding the CH1 domain on the first gene encoding the IgG heavy chain constant region.

[0047] In one possible implementation of the above preparation method or the non-human mammal, the target gene is:

[0048] the nucleotide sequence encoding the CH1 domain on the first gene encoding the IgG heavy chain constant region;

[0049] the entire nucleotide sequence from the beginning of the first gene encoding the IgG heavy chain constant region to the nucleotide sequence encoding the CH1 domain on the second gene encoding the IgG heavy chain constant region;

[0050] the entire nucleotide sequence from the beginning of the first gene encoding the IgG heavy chain constant region to the nucleotide sequence encoding the CH1 domain on the third gene encoding the IgG heavy chain constant region;

[0051] the entire nucleotide sequence from the beginning of the first gene encoding the IgG heavy chain constant region to the nucleotide sequence encoding the CH1 domain on the fourth gene encoding the IgG heavy chain constant region;

[0052] the entire nucleotide sequence from the beginning of the first gene encoding the IgG heavy chain constant region to the nucleotide sequence encoding the CH1 domain on the last gene encoding the IgG heavy chain constant region;

[0053] the nucleotide sequence encoding the CH1 domain on the second gene encoding the IgG heavy chain constant region;

[0054] the entire nucleotide sequence from the beginning of the second gene encoding the IgG heavy chain constant region to the nucleotide sequence encoding the CH1 domain on the third gene encoding the IgG heavy chain constant region;

[0055] the entire nucleotide sequence from the beginning of the second gene encoding the IgG heavy chain constant region to the nucleotide sequence encoding the CH1 domain on the fourth gene encoding the IgG heavy chain constant region;

[0056] the nucleotide sequence encoding the CH1 domain on the third gene encoding the IgG heavy chain constant region;

[0057] the entire nucleotide sequence from the beginning of the third gene encoding the IgG heavy chain constant region to the nucleotide sequence encoding the CH1 domain on the fourth gene encoding the IgG heavy chain constant region;

[0058] the nucleotide sequence encoding the CH1 domain on the fourth gene encoding the IgG heavy chain constant region.

[0059] The preparation method in the above description, in a possible implementation, the following steps are completed in the same operation step or in different operation steps:

[0060] The step of knocking out the nucleotide sequence on the non-human mammal genome, which comprises the coding sequence of the IgM heavy chain constant region CH1 domain;

[0061] The step of knocking out the target gene.

[0062] The preparation method in the above description or the non-human mammal, in a possible implementation, the non-human mammal is a rodent; optionally, the rodent is a rat or a mouse; further optionally, the rodent is a mouse; further, the mouse is a C57BL / 6 mouse or a BALB / c mouse.

[0063] The preparation method in the above description or the non-human mammal, in a possible implementation, the first gene coding the IgG heavy chain constant region is Ighg3.

[0064] The preparation method in the above description or the non-human mammal, in a possible implementation, when the non-human mammal is a C57BL / 6 mouse, the first gene coding the IgG heavy chain constant region is Ighg3, the second gene coding the IgG heavy chain constant region is Ighg1, the third gene coding the IgG heavy chain constant region is Ighg2b, and the fourth gene coding the IgG heavy chain constant region is Ighg2c.

[0065] When the non-human mammal is a BALB / c mouse, the first gene coding the IgG heavy chain constant region is Ighg3, the second gene coding the IgG heavy chain constant region is Ighg1, the third gene coding the IgG heavy chain constant region is Ighg2b, and the fourth gene coding the IgG heavy chain constant region is Ighg2a.

[0066] The preparation method in the above description or the non-human mammal, in a possible implementation, the non-human mammal genome comprises a complete gene coding the κ light chain and / or the λ light chain; optionally, the non-human mammal can normally express the κ light chain and / or the λ light chain.

[0067] The preparation method in the above description or the non-human mammal, in a possible implementation, the gene knockout method comprises one or more of the following: gene targeting technology, CRISPR / Cas9 method, zinc finger nuclease method, transcription activator-like effector nuclease method.

[0068] The preparation method in the above description or the non-human mammal, in a possible implementation, the non-human mammal or its offspring is used for producing heavy chain antibodies.

[0069] A third aspect of this application provides a method for preparing C57BL / 6 mice or their progeny, comprising the following steps:

[0070] Steps for knocking out genes encoding the antibody IgM heavy chain constant region and IgD heavy chain constant region in the genome of C57BL / 6 mice;

[0071] And, the steps of knocking out the nucleotide sequence encoding the CH1 domain in the genome of C57BL / 6 mice, starting from the gene encoding the IgG3 heavy chain constant region to the gene encoding the IgG2c heavy chain constant region.

[0072] This application also provides a C57BL / 6 mouse in which the nucleotide sequences encoding the heavy chain constant regions of antibodies IgM, IgD, IgG1, IgG2b, and IgG3 in the genome, and the nucleotide sequence encoding the CH1 domain on the gene encoding the heavy chain constant region of antibody IgG2c in the genome, are knocked out.

[0073] In one possible implementation of the above preparation method or C57BL / 6 mouse, the C57BL / 6 mouse genome includes complete genes encoding the κ light chain and / or the λ light chain; optionally, the C57BL / 6 mouse can normally express the κ light chain and / or the λ light chain.

[0074] In one possible implementation of the above preparation method or C57BL / 6 mouse, the gene knockout method includes one or more of the following: gene targeting technology, CRISPR / Cas9 method, zinc finger nuclease method, transcription activator-like effector nuclease method.

[0075] In one possible implementation of the above preparation method or C57BL / 6 mice, the entire nucleotide sequence from exon 1 of the gene encoding the IgM heavy chain constant region to exon 1 of the gene encoding the IgG2c heavy chain constant region was knocked out.

[0076] In one possible implementation of the above preparation method or C57BL / 6 mice, the gene knockout step uses sgRNA targeting the upstream of exon 1 of the gene encoding the IgM heavy chain constant region and sgRNA targeting the downstream of exon 1 of the gene encoding the IgG2c heavy chain constant region.

[0077] In a possible implementation of the above preparation method or the C57BL / 6 mouse, the sgRNA targeting a sequence upstream of the first exon of a gene encoding an IgM heavy chain constant region of the mouse comprises SEQ ID NO. 1 and SEQ ID NO. 2; and / or, the sgRNA targeting a sequence downstream of the first exon of a gene encoding an IgG2c heavy chain constant region of the mouse comprises SEQ ID NO. 3 and SEQ ID NO. 4.

[0078] In a possible implementation of the above preparation method or the C57BL / 6 mouse, the sgRNA targeting a sequence upstream of the first exon of a gene encoding an IgM heavy chain constant region of the mouse comprises SEQ ID NO. 1 and SEQ ID NO. 2; and / or, the sgRNA targeting a sequence downstream of the first exon of a gene encoding an IgG2c heavy chain constant region of the mouse comprises SEQ ID NO. 3 and SEQ ID NO. 4.

[0079] In a possible implementation of the above preparation method or the C57BL / 6 mouse, the C57BL / 6 mouse or offspring thereof is used to produce a heavy chain IgG2c antibody.

[0080] In a fourth aspect, the present application provides a preparation method of a C57BL / 6 mouse or offspring thereof, comprising the following steps:

[0081] knocking out a nucleotide sequence encoding a CH1 domain on a gene encoding an IgM heavy chain constant region in the genome of the C57BL / 6 mouse;

[0082] knocking out a nucleotide sequence encoding a CH1 domain on a gene encoding an IgG3 heavy chain constant region in the genome of the C57BL / 6 mouse.

[0083] The present application also provides a C57BL / 6 mouse, wherein a nucleotide sequence encoding a CH1 domain on a gene encoding an IgM heavy chain constant region in the genome of the C57BL / 6 mouse, and a nucleotide sequence encoding a CH1 domain on a gene encoding an IgG3 heavy chain constant region in the genome of the C57BL / 6 mouse are knocked out.

[0084] In a possible implementation of the above preparation method or the C57BL / 6 mouse, the genome of the C57BL / 6 mouse comprises a complete gene encoding a kappa light chain and / or a lambda light chain; optionally, the C57BL / 6 mouse can normally express a kappa light chain and / or a lambda light chain.

[0085] In a possible implementation manner of the preparation method or the C57BL / 6 mouse, the gene knockout method comprises one or more of the following: a gene targeting technology, a CRISPR / Cas9 method, a zinc finger nuclease method, and a transcription activator-like effector nuclease method.

[0086] In a possible implementation manner of the preparation method or the C57BL / 6 mouse, in the step of knocking out the mouse gene encoding the IgM heavy chain constant region, the first exon of the mouse gene encoding the IgG3 heavy chain constant region is also knocked out.

[0087] In a possible implementation manner of the preparation method or the C57BL / 6 mouse, in the step of knocking out the gene, sgRNAs targeting upstream and downstream of the first exon of the mouse gene encoding the IgM heavy chain constant region are used, and sgRNAs targeting upstream of the first exon of the mouse gene encoding the IgG3 heavy chain constant region and downstream of the first exon of the mouse gene encoding the IgG2c are also used.

[0088] In a possible implementation manner of the preparation method or the C57BL / 6 mouse, the sgRNA targets a sequence upstream of the first exon of the mouse gene encoding the IgM heavy chain constant region, and the sequence comprises SEQ ID NO. 1 and SEQ ID NO. 2.

[0089] And / or, the sgRNA targets a sequence downstream of the first exon of the mouse gene encoding the IgM heavy chain constant region, and the sequence comprises SEQ ID NO. 5 and SEQ ID NO. 6.

[0090] And / or, the sgRNA targets a sequence upstream of the first exon of the mouse gene encoding the IgG3 heavy chain constant region, and the sequence comprises SEQ ID NO. 7 and SEQ ID NO. 8.

[0091] And / or, the sgRNA targets a sequence downstream of the first exon of the mouse gene encoding the IgG2c heavy chain constant region, and the sequence comprises SEQ ID NO. 3 and SEQ ID NO. 4.

[0092] In a possible implementation manner of the preparation method or the C57BL / 6 mouse, the sgRNA targeting upstream of the first exon of the mouse gene encoding the IgM heavy chain constant region is SEQ ID NO. 9 and SEQ ID NO. 10.

[0093] And / or, the sgRNA targeting downstream of the first exon of the mouse gene encoding the IgM heavy chain constant region is SEQ ID NO. 13 and SEQ ID NO. 14.

[0094] and / or the sgRNA targeting upstream of exon 1 of the gene encoding the IgG3 heavy chain constant region of the mouse is SEQ ID NO. 15 and SEQ ID NO. 16;

[0095] and / or the sgRNA targeting downstream of exon 1 of the gene encoding the IgG2c heavy chain constant region of the mouse is SEQ ID NO. 11 and SEQ ID NO. 12.

[0096] In a possible implementation of the above method or the C57BL / 6 mouse, the C57BL / 6 mouse or its offspring is used to produce the heavy chain IgG2c antibody.

[0097] In a fifth aspect, the present application provides a method for preparing a non-human mammal or its offspring, comprising the step of knocking out a nucleotide sequence encoding a CH1 domain of an IgM heavy chain constant region on a genome of the non-human mammal.

[0098] The present application also provides a non-human mammal, wherein a nucleotide sequence encoding a CH1 domain of an IgM heavy chain constant region on a genome of the non-human mammal is knocked out.

[0099] In a possible implementation of the above method or the non-human mammal, the non-human mammal is a rodent; optionally, the rodent is a rat or a mouse; further optionally, the rodent is a mouse; further, the mouse is a C57BL / 6 mouse or a BALB / c mouse.

[0100] In a possible implementation of the above method or the non-human mammal, the non-human mammal or its offspring is used to construct the above non-human mammal or its offspring.

[0101] In a sixth aspect, the present application provides an application of the non-human mammal or its offspring constructed by the above method, the C57BL / 6 mouse or its offspring constructed by the above method, the above non-human mammal, or the above C57BL / 6 mouse in screening a target heavy chain antibody.

[0102] In a possible implementation of the above application, the method of phage display is used in screening the target heavy chain antibody.

[0103] In a possible implementation of the above application, the target heavy chain antibody is an IgG2c heavy chain antibody specific to a C-reactive protein, a coronavirus S protein, or a coronavirus N protein antigen.

[0104] In a seventh aspect of the present application, a method for screening a heavy chain antibody of interest is provided, which comprises using the non-human mammal or its offspring constructed by the preparation method of the first aspect, the non-human mammal or its offspring constructed by the preparation method of the second aspect, the C57BL / 6 mouse or its offspring constructed by the preparation method of the third aspect, or the C57BL / 6 mouse or its offspring constructed by the preparation method of the fourth aspect as an immunized animal for screening.

[0105] In a possible implementation of the above method, the phage display method is used for screening the heavy chain antibody of interest.

[0106] In a possible implementation of the above method, the heavy chain antibody of interest is screened for IgG2c heavy chain antibody specific to C-reactive protein, coronavirus S protein or coronavirus N protein antigen.

[0107] In an eighth aspect of the present application, a non-human mammal cell or cell line or primary cell culture is provided, which is derived from the non-human mammal or its offspring constructed by the preparation method or from the C57BL / 6 mouse or its offspring constructed by the preparation method.

[0108] In a ninth aspect of the present application, an ex vivo tissue or ex vivo organ or culture thereof is provided, which is derived from the non-human mammal or its offspring constructed by the preparation method or from the C57BL / 6 mouse or its offspring constructed by the preparation method.

[0109] In a tenth aspect of the present application, an sgRNA composition is provided, which comprises: an sgRNA targeting upstream of the first exon of a gene encoding an IgM heavy chain constant region in mice and an sgRNA targeting downstream of the first exon of a gene encoding an IgG2c heavy chain constant region in mice;

[0110] or, sgRNAs targeting upstream and downstream of the first exon of a gene encoding an IgM heavy chain constant region in mice;

[0111] or, an sgRNA targeting upstream of the first exon of a gene encoding an IgG3 heavy chain constant region in mice and an sgRNA targeting downstream of the first exon of a gene encoding an IgG2c in mice.

[0112] In a possible implementation of the above sgRNA composition, the target sequence upstream of the first exon of a gene encoding an IgM heavy chain constant region in mice targeted by the sgRNA comprises SEQ ID NO. 1 and SEQ ID NO. 2;

[0113] and / or, the targeting sequence of the sgRNA targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse comprises SEQ ID NO. 3 and SEQ ID NO. 4;

[0114] and / or, the targeting sequence of the sgRNA targeting downstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse comprises SEQ ID NO. 5 and SEQ ID NO. 6;

[0115] and / or, the targeting sequence of the sgRNA targeting upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of the mouse comprises SEQ ID NO. 7 and SEQ ID NO. 8.

[0116] In one possible implementation of the sgRNA composition described above, the sgRNA targeting upstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse is SEQ ID NO. 9 and SEQ ID NO. 10;

[0117] and / or, the sgRNA targeting downstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse is SEQ ID NO. 13 and SEQ ID NO. 14;

[0118] and / or, the sgRNA targeting upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of the mouse is SEQ ID NO. 15 and SEQ ID NO. 16;

[0119] and / or, the sgRNA targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse is SEQ ID NO. 11 and SEQ ID NO. 12.

[0120] In an eleventh aspect of the present application, a knockout vector is provided, comprising: one or more DNA sequences encoding sgRNAs, the targeting sequence of the sgRNA being selected from one of the following:

[0121] targeting upstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse;

[0122] or, targeting downstream of the first exon of the gene encoding the IgG2c heavy chain constant region of the mouse;

[0123] or, targeting downstream of the first exon of the gene encoding the IgM heavy chain constant region of the mouse;

[0124] or, targeting upstream of the first exon of the gene encoding the IgG3 heavy chain constant region of the mouse.

[0125] In one possible implementation of the knockout vector described above, the backbone of the knockout vector is an sgRNA expression vector.

[0126] In a twelfth aspect of the present application, a cell comprising the knockout vector described above is provided.

[0127] Incorrect expression: in contrast to correct expression, incorrect expression actually has the meaning commonly understood in the art. For example, incorrect expression of CH1 domain refers to incorrect expression of CH1 domain of heavy chain constant region caused by mutation or deletion in the range of 10 nucleotides upstream and downstream of the exon encoding CH1 domain of heavy chain constant region, thereby resulting in loss of the ability of CH1 domain to bind to light chain. For another example, incorrect expression of IgG heavy chain constant region encoded by a gene encoding IgG heavy chain constant region refers to that the immunoglobulin antibody obtained by expression of the gene does not have antibody efficacy; in contrast, correct expression of IgG heavy chain constant region encoded by a gene encoding IgG heavy chain constant region refers to that the immunoglobulin antibody obtained by expression of the gene has antibody efficacy.

[0128] The first gene encoding IgG heavy chain constant region, the second gene encoding IgG heavy chain constant region, the third gene encoding IgG heavy chain constant region, and the fourth gene encoding IgG heavy chain constant region refer to the order of arrangement of the genes encoding IgG heavy chain constant region from upstream to downstream at the locus encoding IgG heavy chain constant region.

[0129] Beneficial effects

[0130] The present application prepares a non-human mammal or its offspring by the steps of making the non-human mammal not express or not correctly express CH1 domain of IgM heavy chain constant region and making one or more genes encoding IgG heavy chain constant region not express or not correctly express CH1 domain upon expression, and the obtained non-human mammal or its offspring can be used to produce heavy chain antibodies. The non-human mammal obtained by the preparation method of the present application does not introduce any exogenous gene encoding antibody heavy chain variable region and constant region, and can directly utilize all VDJ genes encoding antibody heavy chain variable region in its own genome, thereby producing heavy chain antibodies with better diversity through heavy chain variable region rearrangement.

[0131] It is generally believed in immunology that IgM is extremely important for the development of B cells, and the development of B cells is extremely important for the production of antibodies. The present application verifies through experiments that even if the gene encoding the CH1 domain of the IgM heavy chain constant region is not expressed, or the gene encoding the IgM heavy chain constant region and the gene encoding the IgD heavy chain constant region are deleted, it does not significantly affect the immune maturation of non-human mammals, all mice survive normally, and can still produce high-titer immune responses, and the inventors have also screened specific and high-affinity heavy chain antibodies therefrom.

[0132] By selecting a genetically engineered gene encoding an IgG heavy chain constant region, a specific subclass of heavy chain IgG antibodies can be obtained. BRIEF DESCRIPTION OF DRAWINGS

[0133] One or more embodiments are illustrated by way of example in the figures that form a part of this patent document. This illustration, together with the specification, not to be used to construe the embodiments to convey to those skilled in the art any specific sales, purchasing, leasing or licensing of any of the embodiments. The word "exemplary" is used herein to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.

[0134] Figure 1 is a schematic diagram of the gene sites of the mouse antibody heavy chain variable region and constant region involved in Example 1 of the present application.

[0135] Figure 2 is a schematic diagram of the sgRNA targeting strategy for preparing Ighm-d-g mice in Example 1 of the present application. The boxes in the second row represent exons, the white boxes represent the knockout gene fragments, and the numbers are the exon numbers. The five-pointed star represents the target position of the sgRNA. The arrow indicates the position to which the primer for genotyping is directed.

[0136] Figure 3 is a schematic diagram of the PCR gel for genotyping Ighm-d-g mice in Example 1 of the present application, wt: wild type; + / -: heterozygote; - / -: knockout homozygote.

[0137] Figure 4 is a schematic diagram of the serum titer detection results after immunizing Ighm-d-g homozygous mice with CRP (human C-reactive protein) as an antigen protein in Example 2 of the present application. The serum titers after immunization and before immunization are both very low, and the two lines coincide.

[0138] Figure 5 A is the colony PCR map of the IgG2c antibody heavy chain gene VH segment of Ighm-d-g homozygous mice in Example 5 of the present application; Figure 5 B is a comparison diagram of the heavy chain amino acid sequences of the IgG2c antibody expressed by Ighm-d-g homozygous mice in Example 5 of the present application.

[0139] Figure 6 is the sequence alignment of the positive clone screened from the heavy chain antibody phage library in Example 6 of the present application.

[0140] Figure 7 is the ELISA result of the specific recognition of the antigen CRP by the purified D4-12 in Example 7 of the present application.

[0141] Figure 8 is the ELISA result of the specific recognition of the antigen CRP by the purified 5S-12 in Example 8 of the present application, in which the OD450 values of the two lines of OVA-D5S-12 and BSA-D5S-12 are very low, and the two lines are coincident.

[0142] Figure 9 is the affinity determination result of the D5S-12 heavy chain antibody in Example 8 of the present application.

[0143] Figure 10 is the sgRNA targeting strategy schematic diagram for preparing IghM mice in Example 9 of the present application. The black square represents an exon, and the number therein is the exon number. The five-star symbol represents the target position of the sgRNA. The arrow represents the primer for genotype identification.

[0144] Figure 11 is an example of PCR identification of the genotype of IghM mice in Example 9 of the present application. The Ighm wild type gene produces a band of about 600 bp, and the Ighm knockout gene produces a band of about 300 bp. The number represents the mouse sample number, +: wild type control, -: blank control.

[0145] Figure 12 is the IgM antibody heavy chain amino acid sequence diagram expressed by the IghM homozygous mouse in Example 10 of the present application.

[0146] Figure 13 is the sgRNA targeting strategy schematic diagram for preparing IghM-3G3 mice in Example 11 of the present application. The black square represents an exon, and the number therein is the exon number. The five-star symbol represents the target position of the sgRNA. The arrow represents the primer for genotype identification.

[0147] Figure 14 is the PCR gel map schematic diagram for genotype identification of IghM-3G3 mice in Example 11 of the present application, wt: wild type; + / -: heterozygote; - / -: knockout homozygote.

[0148] Figure 15 is the serum titer detection result schematic diagram after immunizing the IghM-3G3 homozygous mouse with CRP (human C-reactive protein) as the antigen protein in Example 12 of the present application. The serum titers after the first immunization and the second immunization are very low, and the two lines are coincident.

[0149] Figure 16 A is the colony PCR map of IgG2c antibody heavy chain gene of IghM-3G3 homozygous mice in Example 13 of the present application; Figure 16 B is the heavy chain amino acid sequence alignment map of IgG2c antibody expressed by IghM-3G3 homozygous mice in Example 13 of the present application.

[0150] Figure 17 is the result map of detecting the serum titer by ELISA after blood sampling at non-immunization, one week after the second immunization, one week after the third immunization and one week after the fourth immunization, and then diluting the serum with PBS, in the case of immunizing IghM-3G3 homozygous mice with coronavirus S protein antigen, which is mentioned in Example 15 of the present application.

[0151] Figure 18 A is the colony PCR identification map of IgG2c antibody heavy chain gene of IghM-3G3 homozygous mice immunized with coronavirus S protein antigen, which is mentioned in Example 16 of the present application; Figure 18 B is the CDR region amino acid sequence alignment map of positive clones obtained after phage display library construction and antibody panning of IgG2c antibody heavy chain gene of IghM-3G3 homozygous mice immunized with coronavirus S protein antigen, which is mentioned in Example 17 of the present application.

[0152] Figure 19 is the result map of detecting whether antibodies S-9, S-19, S-27 and S-47 can specifically recognize and bind to antigen coronavirus S protein by ELISA method, which is mentioned in Example 17 of the present application.

[0153] Figure 20 A is the result map of detecting the serum titer by ELISA after blood sampling at non-immunization, one week after the second immunization, one week after the third immunization and one week after the fourth immunization, and then diluting the serum with PBS, in the case of immunizing IghM-DG1 homozygous mice with coronavirus S protein antigen, which is mentioned in Example 18 of the present application; Figure 20 B is the CDR region amino acid sequence alignment map of positive clones obtained after phage display library construction and antibody panning of IgG2c antibody heavy chain gene of IghM-DG1 homozygous mice immunized with coronavirus S protein antigen, which is mentioned in Example 18 of the present application.

[0154] Figure 21 is the result map of detecting whether antibodies S-1, S-7, S-12, S-17, S19, S-25, S-51 and S-65 can specifically recognize and bind to antigen coronavirus S protein by ELISA method, which is mentioned in Example 18 of the present application.

[0155] Figure 22A is the result figure of the ELISA detection of the serum titer of the blood collected from the IghM-DG1 homozygous mice immunized with the coronavirus N protein antigen, respectively, after no immunization, one week after the second immunization, one week after the third immunization and one week after the fourth immunization, and the serum is diluted with PBS; Figure 22 B is the CDR region amino acid sequence alignment figure of the positive clones obtained by phage display library construction and antibody panning for the IghM-DG1 homozygous mice immunized with the coronavirus N protein antigen.

[0156] Figure 23 is the result figure of the ELISA method for detecting whether antibodies N-1, N-2, N-3, N-5 and N-23 can specifically recognize and bind to the antigen coronavirus S protein.

[0157] Figure 24 is the relative expression amount comparison of each immunoglobulin gene in the bone marrow of MDG1 mice and wild type mice mentioned in the application embodiment 20. Figures A-D are the relative expression amounts of μ gene, γ2c gene, γ2c gene compared with μ gene and α gene in the bone marrow of two genotypes of mice. MDG1 is a homozygous knockout mouse, WT is a wild type mouse, BM is bone marrow, Gapdh gene is used as an internal reference, n=4, data analysis is performed by using 2 -ΔΔCt of the calculation method, and statistical analysis is performed by using two-tailed T test, and *** represents p<0.01.

[0158] Figure 25 The relative expression amount comparison of each immunoglobulin gene in the spleen of MDG1 mice and wild type mice mentioned in the application embodiment 20. Figures A-D are the relative expression amounts of μ gene, γ2c gene, γ2c gene compared with μ gene and α gene in the spleen of two genotypes of mice. MDG1 is a homozygous knockout mouse, WT is a wild type mouse, Gapdh gene is used as an internal reference, n=4, data analysis is performed by using 2 -ΔΔCt of the calculation method, and statistical analysis is performed by using two-tailed T test, and ** represents p<0.01.

[0159] Figure 26 The relative expression amount comparison of each immunoglobulin gene in the small intestine of MDG1 mice and wild type mice mentioned in the application embodiment 20. Figures A-D are the relative expression amounts of μ gene, γ2c gene, γ2c gene compared with μ gene and α gene in the small intestine of two genotypes of mice. MDG1 is a homozygous knockout mouse, WT is a wild type mouse, SI is small intestine, Gapdh gene is used as an internal reference, n=4, data analysis is performed by using 2 -ΔΔCt of the calculation method, and statistical analysis is performed by using two-tailed T test.

[0160] Figure 27 Figure 22 is mentioned in the present application embodiment 22, the expression of each immunoglobulin in the serum of MDG1 mice and wild type mice in resting state. A-F are the expression of IgM, IgG2c, IgM of wild type mice and IgG2c of MDG1 mice, total IgG, IgA, IgE in the serum of two genotypes of mice, respectively. n = 20, statistical analysis was performed by two-tailed T test, * represents p < 0.05, **** represents p < 0.01.

[0161] Figure 28 Figure 22 is mentioned in the present application embodiment 22, the expression of each immunoglobulin in the serum of MDG1 mice and wild type mice in resting state. A-F are the expression of IgM, IgG2c, IgM of wild type mice and IgG2c of MDG1 mice, total IgG, IgA, IgE in the serum of two genotypes of mice, respectively. n = 20, statistical analysis was performed by two-tailed T test, * represents p < 0.05, **** represents p < 0.01.

[0162] Figure 29 Figure 22 is mentioned in the present application embodiment 22, the expression of each immunoglobulin in the serum of MDG1 mice and wild type mice in resting state. A-F are the expression of IgM, IgG2c, IgM of wild type mice and IgG2c of MDG1 mice, total IgG, IgA, IgE in the serum of two genotypes of mice, respectively. n = 20, statistical analysis was performed by two-tailed T test, * represents p < 0.05, **** represents p < 0.01.

[0163] Figure 30 Figure 22 is mentioned in the present application embodiment 22, the expression of each immunoglobulin in the serum of MDG1 mice and wild type mice in resting state. A-F are the expression of IgM, IgG2c, IgM of wild type mice and IgG2c of MDG1 mice, total IgG, IgA, IgE in the serum of two genotypes of mice, respectively. n = 20, statistical analysis was performed by two-tailed T test, * represents p < 0.05, **** represents p < 0.01.

[0164] Figure 31Figure 23 is mentioned in Example 23 of the present application, and shows the development of B cells in the peritoneal cavity of MDG1 mice. Panel A and panel B show the fraction of peritoneal B cells, B1a / B1b / B2 cells, respectively, and panel C shows the proportion of peritoneal B cells, B1a cells, B1b cells and B2 cells, respectively. WT refers to wild-type mice, and MDG1 refers to homozygous knockout mice. n = 7, and statistical analysis was performed using a two-tailed T test, with * representing p < 0.05 and ** representing p < 0.01.

[0165] Figure 32 Figure 25 is mentioned in Example 25 of the present application, and shows the change in the relative expression of antigen-specific antibodies in the serum of wild-type mice and MDG1 mice after chloramphenicol immunization. Panels A-E show the relative expression of IgM, IgG2c, IgG, IgA and IgE specific to chloramphenicol, respectively, with the horizontal axis representing the number of immunizations. LMS refers to chloramphenicol, MDG1 refers to homozygous knockout mice, and WT refers to wild-type mice. n = 7.

[0166] Figure 33 Figure 25 is mentioned in Example 25 of the present application, and shows the change in the relative expression of antigen-specific antibodies in the serum of wild-type mice and MDG1 mice after chloramphenicol immunization. Panels A-E show the relative expression of IgM, IgG2c, IgG, IgA and IgE specific to chloramphenicol, respectively, with the horizontal axis representing the number of immunizations. LMS refers to chloramphenicol, MDG1 refers to homozygous knockout mice, and WT refers to wild-type mice. n = 7.

[0167] Figure 34 Figure 26 is mentioned in Example 26 of the present application, and shows the development of germinal center B cells and plasma cells in the spleen of wild-type mice and MDG1 mice after antigen immunization. Panels A-E show the development of B cells, germinal center B cells, IgG2c+ germinal center B cells, plasma cells and IgG2c+ plasma cells in the spleen after immunization, respectively, and panels F-J show the proportion and number of B cells, germinal center B cells, IgG2c+ germinal center B cells, plasma cells and IgG2c+ plasma cells in the spleen after immunization, respectively. WT refers to wild-type mice, and MDG1 refers to homozygous knockout mice. n = 6, and statistical analysis was performed using a two-tailed T test, with * representing p < 0.05 and ** representing p < 0.01. DETAILED DESCRIPTION

[0168] In order to make the objectives, technical solutions, and advantages of the present application clearer, the technical solutions in the embodiments of the present application will be described below in a clear and complete manner. Obviously, the described embodiments are only some, but not all of the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of the present application.

[0169] In addition, for a better understanding of the present application, numerous specific details are given in the following detailed description. It will be understood by those skilled in the art that the present application can be practiced without some of the specific details. In some embodiments, well-known ingredients, elements, methods, procedures and the like are not described in detail in order to highlight the present application.

[0170] Unless otherwise clearly indicated, throughout the description, unless otherwise indicated, the word "comprise", and variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

[0171] The experimental materials used in the following examples and their sources are as follows:

[0172] px330 plasmid vector, purchased from Addgene, plasmid number #58778;

[0173] pEASY-T5 Zero Cloning vector, purchased from Quansky Biological Technology Co., Ltd., item number: CT501-01;

[0174] TOP10 competent cells, purchased from Tiangen Bioscience Co., Ltd., item number: CB104;

[0175] PET28 vector, purchased from Wuhan Moli Biological Technology Co., Ltd., item number: P31003;

[0176] HiPure Total RNA Plus Mini Kit from Meibime, item number R4121;

[0177] HiPure Gel Pure Micro Kit from Meibime, item number D2110;

[0178] HiPure Tissue DNA Mini Kit from Meibime, item number D3121;

[0179] 2xM5 Hiper plus Taq HiFi PCR mix from Polymer, item number MF002-plus;

[0180] Reverse transcription reagent 5X All-In-One RT MasterMix from abmgood, item number 490;

[0181] DNA marker from Dongsheng, item number M1061 / M1062);

[0182] Protein marker from Thermo, item number 26617;

[0183] Hieff qPCR SYBR Green Master Mix from Yeasen, Cat. No. 11201ES08;

[0184] APC / Cy7 anti-mouse CD38 Antibody from Biolegend, Cat. No. 102727;

[0185] APC / Cy7 anti-mouse IgM Antibody from Biolegend, Cat. No. 406515;

[0186] CD45R (B220) Monoclonal Antibody (RA3-6B2), APC from eBioscience, Cat. No. 85-17-0452-82;

[0187] anti-CD23 antibody (Allophycocyanin) from Abeam, Cat. No. ab25457;

[0188] CD45R (B220) Monoclonal Antibody (RA3-6B2), eFluor 450 from eBioscience, Cat. No. 85-48-0452-82;

[0189] BV421 Rat Anti-Mouse CD138 from BD Horizon, Cat. No. 562610;

[0190] CD19 Monoclonal Antibody (eBio 1D3 (1D3)), eFluor 506 from eBioscience, Cat. No. 85-69-0193-80;

[0191] CD43 Monoclonal Antibody (eBio R2 / 60), PE from eBioscience, Cat. No. 85-12-0431-81;

[0192] CD23 Monoclonal Antibody (B3B4), PE from eBioscience, Cat. No. 85-12-0232-82;

[0193] Anti-CD5 antibody [53-7.3] (Phycoerythrin) from Abeam, Cat. No. ab114078;

[0194] CD21 / CD35 Monoclonal Antibody (eBio8D9 (8D9)), PE-Cyanine7, source eBioscience, ref 85-25-0211-80;

[0195] PE-Cy TM 7 Hamster Anti-Mouse CD95, source BD Pharmingen, ref 553653;

[0196] CD19 Monoclonal Antibody PE-Cyanine7, source eBioscience, ref 25-0193-82;

[0197] IgM Monoclonal Antibody (eB121-15F9), PE-Cyanine7, source eBioscience, ref 85-25-5890-82;

[0198] CD43 Monoclonal Antibody (eBioR2 / 60), FITC, source eBioscience, ref 85-11-0431-85;

[0199] Mouse IgG2c Antibody-FITC Conjugated, source Aviva system biology, ref OASA06628;

[0200] 7-AAD Viability Staining Solution, source eBioscience, ref 85-00-6993-50;

[0201] Goat Anti-Mouse IgG2c heavy chain (HRP), source Abeam, ref ab97255;

[0202] ECL Prime Western Blot Dtection reagent, source GE, ref RPN2236

[0203] Mouse IgM ELISA Quantitation Set, source Bethyl, ref E90-101;

[0204] Mouse IgG2c ELISA Quantitation Set, source Bethyl, ref E90-136;

[0205] Mouse IgG ELISA Quantitation Set from Bethyl, Cat. No. E90-131 ;

[0206] Mouse IgA ELISA Quantitation Set from Bethyl, Cat. No. E90-103;

[0207] Mouse IgE ELISA Quantitation Set from Bethyl, Cat. No. E90-115;

[0208] TMB Substrate Set from Biolegend, Cat. No. 421101;

[0209] Freund's Adjuvant complete from sigma, Cat. No. F5881;

[0210] Freund's Adjuvant incomplete from sigma, Cat. No. F5506.

[0211] First part, Ighm-d-g homozygous mice and their immunization results

[0212] Example 1, Preparation of Ighm-d-g homozygous mice (herein also referred to as MDG1 mice)

[0213] Ighm-d-g mice refer to C57BL / 6 mice in which the Ighm gene, the Ighd gene, the Ighg3 gene, the Ighg1 gene, the Ighg2b gene and the first exon of the Ighg2c gene, which is responsible for encoding the CH1 domain of the IgG2c heavy chain, have been knocked out. Ighm-d-g homozygous mice are prepared by the following steps.

[0214] (1) Obtaining of nucleic acid molecules:

[0215] The schematic diagram of the genetic locus of the antibody heavy chain variable and constant regions of C57BL / 6 mice is shown in Figure 1 , and the design is shown in Figure 2The targeting strategy shown is to knock out the nucleotide sequence encoding the CH1 domain in mouse Ighm, Ighd, Ighg3, Ighg1, Ighg2b and Ighg2c genes. The inventors selected the target sequence of sgRNA upstream of the first exon of mouse Ighm gene (SEQ ID NO: 1, SEQ ID NO: 2), downstream of the first exon of mouse Ighg2c (SEQ ID NO: 3, SEQ ID NO: 4), and designed the sgRNA sequence according to the target sequence, as shown in Table 1.

[0216] Table 1

[0217]

[0218] (2) Construct the nucleic acid molecule into the backbone plasmid and transcribe in vitro to obtain sgRNA:

[0219] The synthesized forward and reverse DNA oligos encoding sgRNA sequences were annealed to form complementary double-stranded, and were ligated to the sgRNA expression vector (px330) using T4 ligase. After ligation, the plasmid was verified by professional sequencing company. The results showed that the target plasmid was obtained, and further sgRNA was obtained by in vitro transcription.

[0220] (3) Introduce the sgRNA and Cas9 protein into the host animal zygote:

[0221] The mouse is induced to ovulate, in vitro fertilized and cultured to obtain zygotes. Then the sgRNA and Cas9 protein are mixed, and the mouse zygote is electroporated or the Cas9 protein (or Cas9 mRNA, commercially available) and sgRNA are injected into the mouse zygote by microinjection.

[0222] (4) Implant the cells containing the above sgRNA and Cas9 protein into the host animal:

[0223] The above zygote cells are implanted into surrogate mother mice to produce F0 chimeric mice. The genomic DNA of the mouse tail is extracted and detected by PCR to detect the individuals with knockout in the F0 generation of mice. The gene knockout mice are sequenced to confirm the deletion of the target sequence. The F0 chimeric mice with correct gene knockout are selected for subsequent breeding and identification.

[0224] The PCR primers Ighm-d-g-1F and Ighm-d-g-1R can detect the knockout gene (such as Figure 2 indicated by the arrow), and the primers Ighd-2F and Ighd-2R can detect the wild type gene (such as Figure 2The sequences of the primers are shown in Table 2, and the PCR results for detecting the knockout individuals in Ighm-d-g mice are shown in the schematic diagram of Figure 3 The knockout gene of Ighm-d-g homozygote is amplified by primers Ighm-d-g-1F and Ighm-d-g-1R to obtain a band of about 700 bp (as shown in the left panel), and no band is amplified by primers Ighd-2F and Ighd-2R (as shown in the right panel); the wild-type gene of Ighm-d-g cannot be amplified by primers Ighm-d-g-1F and Ighm-d-g-1R (as shown in the left panel), and a band of about 600 bp is amplified by primers Ighd-2F and Ighd-2R (as shown in the right panel).

[0225] Table 2

[0226]

[0227] (5) Breeding of heterozygous and homozygous gene knockout mice:

[0228] The F0 generation mice with the target gene knockout are mated with wild-type mice to obtain F1 generation mice, and the genome of the mouse tail is extracted and detected by PCR to select the gene knockout positive F1 generation heterozygous mice which can be stably inherited. The F1 generation heterozygous mice are mated with each other to obtain the gene knockout positive F2 generation homozygous mice, i.e. Ighm-d-g homozygous mice. The genotype of the obtained F1 generation heterozygous or F2 generation homozygous mice is detected by the same method and steps as in (4).

[0229] Example 2, antigen immune response and titer detection

[0230] The Ighm-d-g homozygous mice are immunized with human C-reactive protein (CRP).

[0231] The immunization method is as follows: 6-8 week old male mice are selected, and the antigen human C-reactive protein (CRP, A-5172, BBI Life Science) is emulsified with an equal volume of Freund's complete adjuvant (F5881, Sigma) to a state of not dripping, i.e. for subcutaneous multiple injection of the mice for the first immunization, the injection dose is 100 μg per mouse, and after the first immunization, subsequent subcutaneous immunization is performed every 2 weeks, the CRP antigen is emulsified with an equal volume of Freund's incomplete adjuvant (F5506, Sigma), and then the mice are injected subcutaneously in multiple points, and the injection dose is 100 μg per mouse each time.

[0232] The serum titer detection method is as follows: the CRP antigen is diluted to 2 μg / mL, 100 μl is taken and added to a polystyrene enzyme-linked detection plate, and the HRP-goat anti-mouse IgG-Fc (Jackson 115-035-071) is used to detect the specific IgG2c antibody heavy chain specifically combined with the CRP antigen in the serum.

[0233] like Figure 4 As shown, blood was collected one week after the first immunization, one week after the second immunization, and one week after the third immunization. The serum was diluted with PBS, starting with a serial dilution of 1:500. ELISA detection of serum titers showed that no specific antibodies binding to the antigen CRP appeared in the unimmunized and first-immunized mice. After the second immunization, IgG2c antibodies specifically binding to the antigen appeared in the mice. The titer did not increase further after the third immunization, and the serum titer was around 1:8000, which can be used for the next antibody gene retrieval experiment.

[0234] Example 3: Examination of spleen, thymus, lymph nodes, and organs in unimmunized Ighm-dg homozygous mice and Ighm-dg homozygous mice immunized with CRP antigen.

[0235] Following Example 2 above, the mice were euthanized by carbon dioxide asphyxiation. Dissection revealed the size and morphology of the thymus, spleen, mesenteric lymph nodes, submandibular lymph nodes, and multiple organs including the heart, liver, lungs, and kidneys. Dissection showed no significant abnormalities in the thymus, mesenteric lymph nodes, submandibular lymph nodes, or major organs in both unimmunized Ighm-dg homozygous mice and Ighm-dg homozygous mice immunized with the antigen.

[0236] Example 4: Antigen immunization produces specific IgG2c heavy chain antibodies

[0237] Following Example 2 above, Western blot was performed on CRP antigen-immunized mouse serum: 2 μL of immunized mouse serum was added to 100 μL of PBS, and reacted with 10 μL of CRP antigen-Sepharose packing material at room temperature for 60 minutes. The mixture was then centrifuged at 6000 rpm for 30 seconds, and the supernatant was discarded. The packing material was washed three times with PBS, resuspended in 10 μL of PBS, boiled, and subjected to 12% SDS-PAGE electrophoresis. After transfer to a PVDF membrane, the membrane was reacted with HRP-goat anti-mouse IgG-Fc (Jackson 115-035-071, used for heavy chain detection) antibody and HRP-goat anti-mouse Ig light chain (Jackson, 115-035-174) antibody, respectively, and further developed.

[0238] According to the design of the present application, since the genes of mouse IgM, IgD, IgG1, IgG2b and IgG3 are knocked out, immunizing Ighm-d-g homozygous mice with antigen protein can only produce IgG2c subclass antibodies, and since the CH1 gene of IgG2c heavy chain is knocked out, immunizing Ighm-d-g homozygous mice with antigen protein can produce IgG2c heavy chain antibodies (without CH1 domain), and the molecular weight of IgG2c single heavy chain is about 40KD. After immunization with antigen protein, the antibodies produced by Ighm-d-g homozygous mice are separated, electrophoresed, colored and the like, and a specific band that binds to antigen CRP appears around 80KD size band, which is consistent with the molecular weight of the theoretical IgG2c heavy chain dimer, and includes a dimer that does not bind to HRP-goat anti-mouse Ig light chain (Jackson, 115-035-174) antibody.

[0239] Example 5, IgG2c heavy chain antibody gene retrieval

[0240] After the above Example 2, the Ighm-d-g homozygous mice were immunized with CRP antigen and detected by serum titer, the mice were euthanized and the spleen cells were taken, the total RNA was extracted and the cDNA was obtained by reverse transcription, and the heavy chain variable region and the heavy chain constant region connected thereto were amplified by PCR using the following IgG2c subtype antibody specific primers.

[0241] MHV1: ATGAAATGCAGCTGGGGCATSTTCTTC (SEQ ID NO: 21);

[0242] MHV2: ATGGGATGGAGCTRTATCATSYTCTT (SEQ ID NO: 22);

[0243] MHV3: ATGAAGWTGTGGTTAAACTGGGTTTTT (SEQ ID NO: 23);

[0244] MHV4: ATGRACTTTGGGYTCAGCTTGRTTT (SEQ ID NO: 24);

[0245] MHV5: ATGGGACTCCAGGCTTCAATTTAGTTTTCCTT (SEQ ID NO: 25);

[0246] MHV6: ATGGCTTGTCYTTRGSGCTRCTCTTCTGC (SEQ ID NO: 26);

[0247] MHV7: ATGGRATGGAGCKGGRGTCTTTMTCTT (SEQ ID NO: 27);

[0248] MHV8: ATGAGAGTGCTGATTCTTTTGTG (SEQ ID NO: 28);

[0249] MHV9: ATGGMTTGGGTGTGGAMCTTGCTTATTCCTG (SEQ ID NO: 29);

[0250] MHV10: ATGGGCAGACTTACCATTCTCATTCCTG (SEQ ID NO: 30);

[0251] MHV11: ATGGATTTTGGGCTGATTTTTTTTATTG (SEQ ID NO: 31);

[0252] MHV12: ATGATGGTGTTAAGTCCTTCTGTACC (SEQ ID NO: 32);

[0253] B6_IgG2c_CH2R1: 5'-TGGTCCACCCAAGAGGTCTG-3' (SEQ ID NO: 33);

[0254] The PCR reaction system is shown in Table 3:

[0255] Table 3

[0256]

[0257] PCR reaction program: 98℃, 2min - 30 cycles (98℃, 10s - 50℃, 20s - 72℃, 40s) - 72℃, 5min - 16℃.

[0258] The obtained PCR amplification product was ligated with pEASY-T5 Zero Cloning Vector, TOP10 competent cells were transformed and plated on LB plates, 11 clones were randomly picked, and the colony PCR was identified as positive clones for sequencing (as shown in Figure 5 A, the 650bp size band is a positive band).

[0259] The sequencing results of the positive clones showed (as shown in Figure 5B, the FR4 region of the IgG2c antibody heavy chain variable region produced in Ighm-d-g pure-bred mice is directly connected to the Hinge region (antibody hinge region), which indicates that the IgG2c CH1 exon knockout is successful. Figure 5 B, the FR4 region of the IgG2c antibody heavy chain variable region produced in Ighm-d-g pure-bred mice is directly connected to the Hinge region (antibody hinge region), which indicates that the IgG2c CH1 exon knockout is successful.

[0260] Example 6, Construction and panning of CRP antigen-specific IgG2c heavy chain antibody variable region phage display library

[0261] I. Construction of phage display library

[0262] After the above Example 2, total RNA was extracted from the spleen of Ighm-d-g pure-bred mice immunized with CRP, and cDNA was prepared using oligo (Dt) (TAKAR 6110A cDNA synthesis kit), and the heavy chain antibody gene was amplified by two rounds of PCR using nested PCR.

[0263] The first round of PCR process is exactly the same as the PCR process mentioned in Example 5;

[0264] The primers, reaction system, and reaction program used in the second round of PCR are as follows:

[0265] MHVF1-SfiI: ATGCCATGACTGTggcccaggcggcc GAG GTG AAG CTT CTC GAG TCT GG (SEQ ID NO: 34);

[0266] MHVF2-SfiI: CATGCCATGACTGTggcccaggcggcc SAG GTS CAG CTG MAG GAG TCW GG (SEQ ID NO: 35);

[0267] MHVF3-SfiI: CATGCCATGACTGTggcccaggcggcc GAG GTC CAG CTG CAA CAA TCT GG (SEQ ID NO: 36);

[0268] MHVF4-SfiI: CATGCCATGACTGTggcccaggcggcc SAG GTY CAR CTK CAG CAG YCT GG (SEQ ID NO: 37);

[0269] MHVF5-SfiI: CATGCCATGACTGT ggcccaggcggcc GAR GTG AAG CTT GWG GAG TCTGG (SEQ ID NO: 38).

[0270] B6-IgG2c-Hin-sfi1: ACTCGCGGCCGGCCTGGCCTGTTATGGGCACTCTGGG (SEQ ID NO: 39).

[0271] The reaction system is shown in Table 4:

[0272] Table 4

[0273]

[0274] PCR reaction program: 98°C, 2 min - 30 cycles (98°C, 10 s - 65°C, 20 s - 72°C, 40 s) - 72°C, 5 min - 16°C.

[0275] The PCR amplification product was digested with SfiI (FD1824, Thermo), agarose gel electrophoresis and gel recovery of the target product, and the gel-recovered target fragment was cloned into the SfiI-digested pComb3XSS vector. The R2738 electrocompetent cells were electrotransformed, the IgG2c heavy chain antibody library was prepared and subjected to multiple rounds of panning. Multiple positive clones were selected for sequencing identification, and the results are shown in Table 2. Figure 6

[0276] II. Panning

[0277] 1. Panning

[0278] 1) Coating: Dilute the CRP antigen to 100 μg / mL with coating solution, add to the enzyme-labeled plate (100 μL / well) 2 wells, and coat at 4°C overnight.

[0279] 2) Blocking: aspirate the coating solution, wash the plate 3 times with PBS, and block with 300 μL of 4% skim milk (the second, third, fourth and fifth blocking solutions are 4% BSA), and incubate at 37°C for 2 h.

[0280] 3) Binding: aspirate the blocking solution, wash the plate 3 times with PBS, add 100 μL of phage display library, and incubate at 37°C for 1 h.

[0281] 4) Washing: aspirate the unbound phage, and wash with PBST (a total of five rounds of panning were performed in this application, the first and second rounds were washed 3 times with PBST, and the third, fourth and fifth rounds were washed 10 times with PBST).

[0282] ​5) Elution: Add 100 μL Gly-HCl (pH 3.0), 37 °C, 5 min, gently pipette several times.

[0283] 6) Neutralization: pipette the liquid in the well to a centrifuge tube, pre- add 15 μL neutralization buffer (1 M Tris-Hcl, PH=8.8) and mix well.

[0284] 7) Take 10 μL of the neutralized eluate to determine the titer, the rest of the eluate is used for the next round of panning after amplification.

[0285] 2. Phage amplification and purification

[0286] 1) Add the neutralized eluate to 5 mL ER2738 bacteria (commercial strain, OD 600 about 0.5-0.7), mix well;

[0287] 2) Incubate at 37 °C for 30 min, then incubate at 37 °C, 180 rpm for 1 h;

[0288] 3) Add the culture to 20 mL LB medium, incubate at 37 °C, 180 rpm for 2 h;

[0289] 4) Add 20 μL helper phage M13KO7 (2 x 10 9 cfu) (purchased from NEB, Cat. No. N03158), mix well;

[0290] 5) Incubate at 37 °C for 30 min, then incubate at 37 °C, 180 rpm for 1 h, then add ampicillin;

[0291] 6) Incubate at 37 °C, 180 rpm for 1 h, then centrifuge at 8000 rpm for 5 min;

[0292] 7) Resuspend the pellet with 25 mL LB medium / Amp / kan, incubate at 30 °C, 180 rpm overnight (about 14 h).

[0293] 8) Centrifuge at 8000 rpm for 10 min at 4 °C, take the supernatant;

[0294] 9) Add 1 / 5 volume of PEG-NaCl solution, incubate at 4 °C for about 4-6 h;

[0295] 10) Centrifuge at 12000 rpm for 20 min at 4 °C, discard the supernatant;

[0296] 11) Resuspend the pellet with 1 mL, take 10 μL to determine the titer.

[0297] 3. Titer determination

[0298] 1) Dilute the phage to be tested with PBS (10 μL phage added to 990 μL PBS to be 10 -2 ), respectively take 10 μL of the diluted phage to 200 μL of ER2738 bacterial solution, mix well.

[0299] 2) The infected culture was incubated at 37°C for 30 min;

[0300] 3) Spread on LB+Amp + resistant plate;

[0301] 4) Incubate at 37°C overnight;

[0302] 5) Count the colonies and calculate the titer;

[0303] III, Preparation of IgG2c heavy chain antibody variable region library and the results after 5 times of panning are as follows in Table 5:

[0304] Table 5, CRP-MDG1 screening data table

[0305]

[0306]

[0307] A total of 5 times of panning was performed, as shown in the above table, the output phage was obviously enriched, and positive clones were selected by PHAGE-ELISA experiment for sequencing identification.

[0308] Example 7, Prokaryotic expression and biological activity identification of CRP antigen specific IgG2c heavy chain antibody variable region

[0309] After the above example 6, the sequencing sequence was analyzed, and D4-12 (nucleotide sequence and amino acid sequence are shown in Table 6) repeatedly appeared in the first 5 rounds of panning was selected to transfect BL21 E. coli, and prokaryotic induction expression was carried out at 16°C by adding different concentrations of IPTG, and the supernatant was collected by ultrasonic crushing and purified by nickel affinity column.

[0310] Coat specific antigen CRP and irrelevant protein OVA (2 μg / mL), gradient dilution with purified D4-12, ELISA detection, the results show that the purified D4-12 heavy chain antibody variable region can specifically recognize and bind to antigen CRP, and shows good concentration dependence, as shown in Figure 7 .

[0311] Table 6

[0312]

[0313] Example 8, Prokaryotic expression and biological activity identification of CRP antigen specific IgG2c heavy chain antibody variable region

[0314] Following Example 6 above, the sequencing sequence was further analyzed, and the most frequently occurring sequence D5S-12 (nucleotide and amino acid sequences are shown in Table 7) was selected for eukaryotic expression and biological activity identification. KOP293 cells (Zhuhai Kairui) were transfected, and the supernatant of the cultured cells was collected on day 6 and purified using a nickel affinity column.

[0315] Table 7

[0316]

[0317]

[0318] 1. The purified D5S-12 antibody was coated with specific antigen CRP and irrelevant proteins OVA or BSA (2 μg / mL). The antibody was then serially diluted and analyzed by ELISA. The results showed that the purified D5S-12 heavy chain antibody specifically recognized and bound antigen CRP, exhibiting a good concentration-dependent binding affinity. (See results below.) Figure 8 As shown.

[0319] 2. Affinity assay of D5S-12 heavy chain antibody: The affinity of purified D5S-12 heavy chain antibody for antigen CRP was determined using FORTEBIO-OCTET. The antibody was diluted to 10 μg / mL, and the antigen CRP was diluted to 200, 100, 50, 25, 12.5, 6.25, and 3.13 nM. The affinity constant K was then determined. D (M)=9.87E-10,K on (1 / Ms)=8.55E+04,K off (1 / s) = 8.44E-05, heavy chain antibody D5S-12 has a high affinity for antigen CRP, as shown in the results. Figure 9 As shown.

[0320] Part Two: Preparation of IghM-3G3 homozygous mice and their immunization results

[0321] IghM-3G3 mice are C57BL / 6 mice in which the first exon of the Ighm gene, as well as the Ighg3, Ighg1, Ighg2b, and the first exon of the Ighg2c gene, have been knocked out. First, homozygous IghM mice (i.e., C57BL / 6 mice with the first exon of the Ighm gene knocked out) are generated, and then IghM-3G3 homozygous mice are generated based on these homozygous IghM mice.

[0322] Example 9: Preparation of IghM homozygous mice

[0323] The preparation of IghM homozygous mice includes the following steps:

[0324] (1) Obtaining of nucleic acid molecules:

[0325] The schematic diagram of the gene locus of C57BL / 6 mouse antibody heavy chain variable region and constant region is shown in Figure 1 The targeting strategy as shown in Figure 10 was designed to knock out the nucleotide sequence encoding the CH1 domain in the mouse Ighm gene.

[0326] In order to knock out the nucleotide sequence encoding the CH1 domain in the mouse Ighm gene, the inventors selected the sgRNA targeting sequence upstream of the first exon of the mouse Ighm gene (SEQ ID NO: 1, SEQ ID NO: 2) and downstream of the first exon of the mouse Ighm gene (SEQ ID NO: 5, SEQ ID NO: 6), and designed the sgRNA sequence according to the targeting sequence, as shown in Table 8.

[0327] Table 8

[0328]

[0329]

[0330] (2) Constructing the nucleic acid molecules into a backbone plasmid and transcribing in vitro to obtain RNA:

[0331] The forward and reverse DNA oligos of the synthesized sgRNA sequence were annealed to form complementary double-stranded DNA, which was ligated to the sgRNA expression vector (px330) using T4 ligase. After ligation, the plasmid was sequenced by a professional sequencing company. The results showed that the target plasmid was obtained, and the sgRNA was further obtained by in vitro transcription.

[0332] (3) Introducing the sgRNA and Cas9 protein into the host animal zygote:

[0333] The mouse was induced to ovulate, in vitro fertilized, and the zygote was cultured. Then the sgRNA and Cas9 protein were mixed, and the mouse zygote was electroporated, or the Cas9 protein (or Cas9 mRNA, commercially available) was injected into the mouse zygote together with the sgRNA by microinjection.

[0334] (4) Implanting the cells containing the sgRNA and Cas9 protein into a surrogate animal:

[0335] The fertilized egg cell is implanted into a surrogate mother mouse to produce F0 generation chimeric mice. The F0 generation mice in which the knockout has occurred are detected by extracting the mouse tail genomic DNA and PCR detection. The gene knockout mice are sequenced to confirm that the target sequence has been deleted. The F0 generation chimeric mice in which the gene has been correctly knocked out are selected for subsequent breeding and identification.

[0336] PCR primers Ighm-F and Ighm-R can detect the knockout gene (as shown by the arrow in the middle), and the primer sequences are shown in Table 9: Figure 10

[0337] Table 9

[0338]

[0339] The detection results are shown in Figure 11 When PCR detection is performed using the above primers, the Ighm wild-type gene can amplify a band of about 600 bp, and the Ighm CH1 knockout gene can amplify a band of about 300 bp. It can be seen from Figure 11 that clones #1, #2, #3 and #6 contain the Ighm CH1 knockout gene. The gene knockout mice are sequenced to confirm that the first exon of the Ighm gene of the knockout mice is deleted.

[0340] (5) Breeding of heterozygous and homozygous gene knockout mice:

[0341] The F0 generation mice in which the target gene has been knocked out are mated with wild-type mice to obtain F1 generation mice. The genomic DNA of the mouse tail is extracted and PCR detection is performed to select the gene knockout positive F1 generation heterozygous mice that can be stably inherited. The F1 generation heterozygous mice are then mated with each other to obtain the gene knockout positive F2 generation homozygous mice, i.e., IghM homozygous mice. The genotype of the obtained F1 generation heterozygous or F2 generation homozygous mice is determined by the same method and steps as in step 4.

[0342] Example 10, IgM heavy chain antibody gene retrieval

[0343] After immunization with the CRP antigen according to the above Example 2, the IghM homozygous mice are euthanized and the spleen cells are taken. The total RNA is extracted by Trizol lysis, and cDNA is obtained by reverse transcription. The heavy chain variable region and the heavy chain constant region connected thereto are amplified by PCR using IgM subtype antibody specific primers. The primers used and their sequences are as follows:

[0344] MHV1, MHV2, MHV3, MHV4, MHV5, MHV6, MHV7, MHV8, MHV9, MHV10, MHV11, MHV12 are shown in Example 5;

[0345] ​B6IghM CH2R4: GTTCATCTCTGCGACAGC (SEQ ID NO: 46);

[0346] PCR reaction system is shown in Table 10:

[0347] Table 10

[0348]

[0349] PCR reaction program: 98℃, 2min - 30 cycles (98℃, 10s - 50℃, 20s - 72℃, 40s) - 72℃, 5min - 16℃.

[0350] The PCR amplification product was ligated to pEASY-T5 Zero Cloning Vector, TOP10 competent cells were transformed and LB plates (ampicillin resistance) were coated, and clones were picked for colony PCR. The positive clones were sent for sequencing. According to the sequencing results, the IgM antibody heavy chain variable region FR4 expressed in the IghM homozygous mouse was directly connected to CH2 (the initial amino acid sequence AVAEMN). The results are shown in Figure 12 , and the genomic IgM CH1 exon knockout was successful.

[0351] Example 11, Preparation of IghM-3G3 homozygous mice

[0352] A method for preparing IghM-3G3 homozygous mice includes the following steps:

[0353] (1) Obtaining of nucleic acid molecules:

[0354] The schematic diagram of the genetic locus of the antibody heavy chain variable region and constant region of C57BL / 6 mice is shown in Figure 1 , a targeting strategy as shown in Figure 13 is designed. On the basis of the IghM homozygous mice obtained in Example 9, the Ighg3 gene, Ighg1 gene, Ighg2b gene and the first exon located on the Ighg2c gene are further knocked out.

[0355] To knock out the first exon encoding the CH1 domain in mouse Ighm, and the first exon encoding the CH1 domain in Ighg3, Ighg1, Ighg2b, and Ighg2c genes, the inventors selected sgRNA target sequences upstream of the first exon of the mouse Ighg3 gene (SEQ ID NO:7, SEQ ID NO:8) and downstream of the first exon of the mouse Ighg2c gene (SEQ ID NO:3, SEQ ID NO:4) based on IghM homozygous mice. The inventors then designed sgRNA sequences based on these target sequences, as shown in Table 11.

[0356] Table 11

[0357]

[0358] (2) Nucleic acid molecules were constructed into a backbone plasmid and transcribed in vitro to obtain RNA:

[0359] The forward and reverse DNA oligos of the synthesized sgRNA sequence were annealed to form complementary double strands, which were then ligated into the sgRNA expression vector (px330) using T4 ligase. After ligation, the results were verified by sequencing by a professional sequencing company, and the results showed that the target plasmid was obtained. sgRNA was then obtained through in vitro transcription.

[0360] (3) Introduce the sgRNA and Cas9 protein into the fertilized egg of the host animal:

[0361] Mice were induced to ovulate, in vitro fertilized, and fertilized eggs were cultured. Then, sgRNA and Cas9 protein were mixed and electroporated into mouse fertilized eggs, or Cas9 protein (or Cas9 mRNA, which is commercially available) was injected into mouse fertilized eggs together with sgRNA using microinjection.

[0362] (4) Inoculate the cells containing the above-mentioned sgRNA and Cas9 protein into the host animal:

[0363] The fertilized egg cells described above were implanted into surrogate female mice to produce F0 generation chimeric mice. Genomic DNA was extracted from the mouse tails and PCR was used to detect individuals with gene knockout in the F0 generation. Sequencing of the gene knockout mice confirmed the deletion of the target sequence. F0 generation chimeric mice with correctly knocked-out genes were selected for subsequent breeding and identification.

[0364] PCR primers Ighg-1F and Ighg-1R can detect knockout genes, while primers Ighg-2R and Ighg-1F can detect wild-type genes. Figure 13 (The arrows). The primer sequences are shown in Table 12.

[0365] Table 12

[0366]

[0367] Genotyping of IghM-3G3 mice was performed by PCR. Figure 14 The Ighm genotype was identified using primers Ighm-F and Ighm-R: the wild-type Ighm gene amplified approximately 600 bp of the target product, while the knockout gene amplified approximately 300 bp of the target product. The Ighg genotype was identified using primers Ighg-1F, Ighg-1R, and Ighg-2R: the Ighg knockout gene amplified approximately 500 bp of the target product using primers Ighg-1F and Ighg-2R, but no band was amplified using primers Ighg-1F and Ighg-1R; the wild-type Ighg gene amplified no band using primers Ighg-1F and Ighg-2R, but approximately 460 bp of the target product was amplified using primers Ighg-1F and Ighg-1R. + / -: heterozygous; wt: wild-type; - / -: knockout homozygous.

[0368] (5) Breed heterozygous and homozygous gene knockout mice:

[0369] F0 generation mice with the target gene knocked out were crossed with wild-type mice to obtain F1 generation mice. Genome samples were extracted from the tails and analyzed by PCR to select gene-knockout positive F1 generation heterozygous mice that could stably inherit the gene knockout. These F1 generation heterozygous mice were then crossed with each other to obtain gene-knockout positive F2 generation homozygous mice, i.e., IghM-3G3 homozygous mice. Genotyping of the obtained F1 generation heterozygous or F2 generation homozygous mice was performed using the same method as in step 4.

[0370] Example 12: Immunoreactivity and titer detection of IghM-3G3 homozygous mouse antigens

[0371] IghM-3G3 homozygous mice were immunized with human C-reactive protein (CRP).

[0372] The immunization method is as follows: Select male mice aged 6-8 weeks. Add an equal volume of Freund's complete adjuvant (F5881, Sigma) to the human C-reactive protein antigen (CRP, A-5172, Baiqiao Ruijing) and emulsify until it is water-insoluble. This emulsification can be used for the initial subcutaneous injection of multiple doses in mice. The initial immunization dose is 100 μg / mouse. After the initial immunization, subsequent subcutaneous immunizations are performed every 2 weeks. The CRP antigen is emulsified with an equal volume of Freund's incomplete adjuvant (F5506, Sigma) and injected subcutaneously at multiple doses in mice. Each injection dose is 100 μg / mouse.

[0373] Serum titer testing;

[0374] Serum titer detection method as follows: CRP antigen diluted to 2 μg / mL, take 100 μL into polystyrene enzyme-linked detection plate package board, with HRP-goat anti-mouse IgG-Fc (Jackson, 115-035-071) detection of serum with CRP antigen specific binding specific IgG antibody.

[0375] As shown in Figure 15 , respectively, in non-immune, one week after the first immunization, three weeks after the blood, serum with PBS dilution, from 1:500 dilution ratio dilution, ELISA detection of serum titer showed that non-immune and one mouse in vivo did not appear specific antibodies binding antigen CRP, after three immunization, its serum titer is about 1:32000.

[0376] Example 13 IgG2c heavy chain antibody gene extraction

[0377] CRP antigen immunization IghM-3G3 pure type mouse and serum titer detection, the mice were euthanized and spleen cells, Trizol lysis, extraction of total RNA, and reverse transcription to obtain cDNA, using the following IgG2c subtype antibody specific primers by PCR amplification of heavy chain variable region and the heavy chain constant region connected to it.

[0378] MHV1, MHV2, MHV3, MHV4, MHV5, MHV6, MHV7, MHV8, MHV9, MHV10, MHV11, MHV12, B6_IgG2c_CH2R1 are all seen in example 5;

[0379] PCR reaction system, PCR reaction program as shown in example 5:

[0380] The resulting PCR amplification product is connected to pEASY-T5 Zero Cloning vector, TOP10 competent cells and coated LB plate, randomly picked 7 clones, colony PCR identification for positive and sequencing (as Figure 16 A shows that the 650 bp size band is a positive band).

[0381] The sequencing results of positive clones show (as Figure 16As shown in B, the FR4 region of the IgG2c antibody heavy chain variable region produced in the IghM-3G3 homozygous mouse is directly connected to the IgG2c Hinge region (antibody hinge region). Since the structure of the antibody heavy chain is VH-CH1-Hinge-CH2-CH3, and the VH region can be further divided into FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, the FR4 region of the IgG2c antibody heavy chain variable region produced in the IghM-3G3 homozygous mouse is directly connected to the Hinge region (antibody hinge region), indicating that the CH1 exon knockout of IgG2c is successful.

[0382] Example 14, Construction and panning of CRP antigen-specific IgG2c heavy chain antibody variable region phage display library

[0383] After the above Example 13, the steps of phage display library construction and antibody panning are exactly the same as in Example 6, only the parameters in Table 13 are adjusted, and the results after 5 times of panning are shown in Table 13 below:

[0384] Table 13: CRP screening data table

[0385]

[0386] A total of 5 times of panning were performed, and as shown in Table 13, the output phage was obviously enriched. Positive clones were selected by PHAGE-ELISA experiment for sequencing identification, as shown in Table 14.

[0387] Table 14: Amino acid sequences of positive clones

[0388]

[0389] Example 15, Antigen immune response and titer detection of IghM-3G3 homozygous mice

[0390] In this example, IghM-3G3 homozygous mice were immunized with coronavirus S protein antigen.

[0391] The immunization method is as follows: select 6-8 week old male mice, antigen coronavirus S protein (SARS-CoV-2 (2019-nCoV) Spike S1-His Recombinant Protein, 40591-V08H, Yiqiao Shenzhou), and equal volume of Freund's complete adjuvant (F5881, Sigma) are emulsified to a state of not dripping, which can be used for subcutaneous multiple point injection of mice for primary immunization. The injection dose for primary immunization is 100 μg per mouse, and after primary immunization, subsequent subcutaneous immunization is performed every 2 weeks, and the injection dose is 100 μg per mouse each time.

[0392] Serum titer detection

[0393] Serum titer detection method is as follows: coronavirus S protein antigen is diluted to 2 μg / mL, 100 μL is taken to coat the polystyrene enzyme-linked detection plate, and HRP-goat anti-mouse IgG-Fc (Jackson 115-035-071) is used to detect specific IgG antibodies in serum specifically combined with CRP antigen.

[0394] Blood was collected after non-immunization, two weeks after the second immunization, one week after the third immunization, and one week after the fourth immunization, and the serum was diluted with PBS. Starting from a dilution of 1:500, the serum titer was detected by ELISA, and the results are shown in Figure 17 Figure 17 It is shown that no specific antibodies that bind to the antigen coronavirus S protein appear in the body of non-immunized mice, and the serum titer after the second immunization is about 1:64,000.

[0395] Example 16, IgG2c heavy chain antibody gene retrieval

[0396] According to the above example 15, IghM-3G3 homozygous mice were immunized with coronavirus S protein antigen and detected by serum titer, then the mice were euthanized and their spleen cells were taken. The spleen cells were lysed by Trizol, total RNA was extracted, and cDNA was obtained by reverse transcription. Using the following IgG2c subtype antibody specific primers, the heavy chain variable region and the heavy chain constant region connected thereto were amplified by PCR.

[0397] MHV1, MHV2, MHV3, MHV4, MHV5, MHV6, MHV7, MHV8, MHV9, MHV10, MHV11, MHV12, and B6_IgG2c_CH2R1 are all shown in example 5.

[0398] The PCR reaction system and the PCR reaction program are shown in example 5:

[0399] The obtained PCR amplification product was connected to pEASY-T5 Zero Cloning Vector, TOP10 competent cells were transformed and plated on LB plates, 23 clones were randomly picked, and the colony PCR positive clones were sent for sequencing (the PCR results are shown in Figure 18 A, wherein the 650 bp size band is a positive band).

[0400] Example 17, coronavirus S protein antigen specific IgG2c heavy chain antibody variable region phage library display construction and panning;

[0401] ​The steps of phage display library construction and antibody panning were the same as those in Example 6, and a total of 5 pannings were performed. The output phage was obviously enriched each time, and positive clones were selected by PHAGE-ELISA experiment and sent for sequencing identification, as shown in Table 15. The CDR regions of these sequences were analyzed, and the results are shown in Figure 18 B.

[0402] Table 15: Amino acid sequences of positive clones

[0403]

[0404]

[0405] The sequencing sequences were analyzed, and S-9, S-19, S-27 and S-47 (the amino acid sequences are shown in Table 15) appearing in the first 5 rounds of panning were selected to transfect BL21 E. coli, and prokaryotic induction expression was performed at 30°C by adding different concentrations of IPTG. The supernatant was collected by ultrasonic disruption and subjected to nickel affinity column purification.

[0406] The specific antigen coronavirus S protein and irrelevant protein OVA (2 μL g / mL) were coated, and the purified S-9, S-19, S-27 and S-47 antibodies were gradient diluted, and detected by ELISA method. The results showed that the heavy chain antibody variable region retrieved this time could specifically recognize and bind to the antigen coronavirus S protein, and showed good concentration dependence, as shown in Figure 19 .

[0407] Example 18, IghM-DG1 homozygous mouse antigen immune response and titer detection

[0408] In this example, IghM-DG1 homozygous mice were immunized with coronavirus S protein antigen.

[0409] The steps of mouse antigen immunization operation and serum titer detection were the same as those in Example 15, and the serum titer detection results are shown in Figure 20 A. The steps of phage display library construction and antibody panning were the same as those in Example 6, and a total of 5 pannings were performed. The output phage was obviously enriched each time, and positive clones were selected by PHAGE-ELISA experiment and sent for sequencing identification, as shown in Table 16. The CDR regions of these sequences were analyzed, and the results are shown in Figure 20 B.

[0410] Table 16: Amino acid sequences of positive clones

[0411]

[0412]

[0413] The sequencing sequences were analyzed, and the DNA sequences of S-1, S-2, S-7, S-12, S-17, S19 and S-65 antibodies (amino acid sequences are shown in Table 16) appearing in the first 5 rounds of panning were cloned into the PET28 vector and transfected into BL21 E. coli, and prokaryotic induction expression was performed at 16°C by adding different concentrations of IPTG, and the supernatant was collected by ultrasonic disruption and purified by nickel affinity column.

[0414] The specific antigen coronavirus S protein and the irrelevant protein OVA (2 μg / mL) were coated, and the purified S-1, S-7, S-12, S-17, S19, S-25, S-51 and S-65 antibodies were gradiently diluted, and detected by ELISA method, and the results showed that the heavy chain antibody variable region retrieved this time could specifically recognize and bind to the antigen coronavirus S protein, and showed good concentration dependence, as shown in Figure 21 .

[0415] Example 19, IgG2c heavy chain antibody gene retrieval

[0416] In this embodiment, MDG1 homozygous mice were immunized with coronavirus N protein antigen.

[0417] The immunization method and serum titer detection method were exactly the same as in Example 15, and the serum titer detection results after immunization are shown in Figure 22 A. The antigen used in this embodiment is coronavirus N protein (SARS-CoV-2 (2019-nCoV) Nucleocapsid-His recombinant Protein, 40588-V08B-B, Yiqiao Shenzhou).

[0418] The steps of phage display library construction and antibody panning were exactly the same as in Example 6, and a total of 5 times of panning were performed, and the phage output each time was obviously enriched, and the positive clones were selected by PHAGE-ELISA experiment and sent for sequencing identification, as shown in Table 17. And the similarities and differences of the CDR regions of these sequences were analyzed, as shown in Figure 22 B.

[0419] Table 17: Amino acid sequences of positive clones

[0420]

[0421] The DNA sequences of the positive clones were cloned into the PET28 vector, transformed into BL21 bacteria, induced for expression, and then the target protein was purified by nickel column, and the specificity and binding force of the antibody were detected by ELISA method, and the results are shown in Figure 23 , Figure 23 The results showed that the heavy chain antibody variable region retrieved this time could specifically recognize and bind to the antigen coronavirus S protein, and showed good concentration dependence.

[0422] Example 20. Detecting the difference of the transcriptional level of each immunoglobulin gene in two genotypes of mice by real-time PCR

[0423] Extract RNA from the spleen of MDG1 mice and wild type mice, and reverse transcribe into cDNA. Take 5 μL of 5-fold diluted cDNA for real-time PCR experiment. Select 4 individuals for each genotype, and perform 2 technical replicates for each gene of each individual. The primers used in the experiment and the length of the amplified fragments are shown in Table 18, and the real-time PCR amplification system is shown in Table 19.

[0424] Table 18. Primer sequences and the length of the amplified fragments used in real-time PCR experiment

[0425]

[0426]

[0427] Table 19. Real-time PCR amplification system

[0428] 2 x SYBR Green mix 10 μL Upstream primer (10 μM) 1 μL Downstream primer (10 μM) 1 μL cDNA 5 μL ddH2O 3 μL

[0429] Amplification procedure:

[0430] 95℃: 15 min

[0431]

[0432] Melting curve

[0433] 65℃: 1 min

[0434] Continuously increase the temperature to 95℃ at a rate of 0.11℃ / s

[0435] After the procedure, judge the reliability of the values according to the melting curve, and then calculate the relative expression level of the transcripts of each immunoglobulin gene by using 2 -ΔΔCt Method, perform statistical analysis by using two-tailed T test, and the statistical results are shown in Figure 24 , Figure 25 and Figure 26 From these results, it can be seen that the expression level of μ gene transcripts in the bone marrow, spleen and small intestine of MDG1 mice is lower than that of wild type mice, the expression level of γ2c gene transcripts is higher than that of wild type mice, and the expression level of γ2c gene transcripts in the three immune tissues of MDG1 mice is higher than that of μ gene transcripts in wild type mice, and there is no statistical difference in the expression level of α gene transcripts between the two genotypes of mice.

[0436] Example 21. Detecting the expression form of IgG2c in the serum of MDG1 mice by Western Blot

[0437] Western Blot detection was performed on the serum of 8-week-old wild-type mice and MDG1 mice with the same genetic background. The serum of wild-type mice was diluted 20 times with PBS, and the serum of MDG1 mice was diluted 100 times with PBS. 1 mM DTT was used to open the intramolecular disulfide bond under reducing conditions. Goat Anti-Mouse IgG2c heavy chain (HRP) antibody was diluted 10,000 times. The results of Western Blot detection are shown in Figure 27 Figure 27 It can be seen that the molecular weight of IgG2c in the serum of MDG1 mice is about 45 kDa under reducing conditions and about 95 kDa under non-reducing conditions, which is consistent with the molecular weight of CH1 domain and light chain deletion.

[0438] Example 22, ELISA detection of the expression level of each immunoglobulin in the serum of MDG1 mice

[0439] The serum of 8-week-old wild-type mice and MDG1 mice with the same genetic background was detected by double-antibody sandwich ELISA. IgM of wild-type mice was diluted 2,000 times, IgG2c was diluted 4,000 times, IgG was diluted 10,000 times, IgA was diluted 5,000 times, and IgE was diluted 20 times. The absorbance values of each sample well at 450 nm were read using a microplate reader, and the immunoglobulin content of each well was calculated using ELISA Calc according to the four-parameter fitting to obtain the standard curve. Two-tailed T test was used for statistical analysis.

[0440] The results are shown in Figure 28 Figure 28 It can be seen that MDG1 mice do not express IgM, and the expression level of IgG2c is significantly higher than that of wild-type mice, and the expression level of IgM is comparable to that of wild-type mice. Since there are other IgG subtypes in wild-type mice, the expression level of total IgG in their serum is significantly higher than that of MDG1 mice. The expression level of IgE in the serum of MDG1 mice is significantly lower than that of wild-type mice, and the expression level of IgA does not show statistical difference compared with wild-type mice.

[0441] Example 23, flow cytometry detection of the development of B cells in the bone marrow, spleen and peritoneal cavity of MDG1 mice

[0442] Bone marrow B cells:

[0443] ​​Prepare 6 wild type mice and 6 MDG1 mice of 8 weeks old in the same genetic background, take their two femurs and tibias, flush the bone marrow cells into centrifuge tubes by FACS, resuspend the cells by ACK after short centrifugation, filter the cell suspension by 70 μm filter screen, discard the supernatant after centrifugation, resuspend the cells by 1 mL FACS, take 50 μL of the cells for staining, take 10 μL of the cells to dilute 40 times for counting, the staining scheme for bone marrow B cells is shown in Table 20.

[0444] Spleen B cells:

[0445] Prepare 4 wild type mice and 4 MDG1 mice of 8 weeks old in the same genetic background, place a 70 μm filter screen in a 60 mm dish, add 1 mL ACK, place their spleens on the filter screen and grind them gently, collect the cell suspension after grinding, discard the supernatant after short centrifugation, resuspend the cells by 1 mL FACS, take 50 μL of the cells for staining, take 10 μL of the cells to dilute 40 times for counting, the staining scheme for spleen B cells is shown in Table 20.

[0446] Peritoneal cavity B cells:

[0447] Prepare 7 wild type mice and 7 MDG1 mice of 8 weeks old in the same genetic background, fix their abdomen upwards on a foam board, cut the skin of the abdomen to expose the peritoneal membrane, inject 5 mL FACS into the peritoneal cavity by a syringe, collect the cell suspension into a centrifuge tube after blowing and sucking 2-3 times by a pipette, resuspend the cells by ACK after short centrifugation, filter the cell suspension by 70 μm filter screen, discard the supernatant after centrifugation, resuspend the cells by 200 μL FACS, take 100 μL of the cells for staining, the staining scheme for peritoneal cavity B cells is shown in Table 20.

[0448] Table 20: Staining scheme for flow cytometry experiment

[0449] APC V450 V500 PE PE-Cy7 PerCP APC-Cy7 FITC Bone marrow B220 CD43 IgM IgG2c Spleen B220 CD138 CD19 CD23 CD21 7-AAD IgM IgG2c Peritoneal cavity CD23 CD5 CD19 7-AAD

[0450] The flow cytometry results of B cells in bone marrow are shown in Table 21, Figure 29 Figure 29 The results show that the proportion and number of B cells in the bone marrow of MDG1 mice have no statistical difference compared with wild type mice, the proportion of progenitor B cells and pre-B cells has no statistical difference compared with wild type mice, but the number is significantly reduced, IgM is highly expressed in mature B cells and lowly expressed in immature B cells, since MDG1 mice lack the μ gene expressing IgM, the development of immature B cells and mature B cells in vivo cannot be determined, but there are a large number of IgG2c+B cells in MDG1 mice, the proportion of this group of B cells in wild type mice is very low.

[0451] The flow cytometry results of B cells in spleen are shown in Table 22,​Figure 30 As shown in Figure 30 The results show that the proportion of B cells in the spleen of MDG1 mice is significantly lower than that of wild-type mice, but there is no statistical difference in the number; the proportion and number of IgG2c+ B cells in the spleen of MDG1 mice are significantly higher than those of IgM+ B cells in wild-type mice, which may be caused by the class switch recombination of IgM to other immunoglobulin subtypes in wild-type mice; since the flow cytometry experiment this time selects mice in an unstimulated state, the proportion and number of plasma cells in the spleen of wild-type mice and MDG1 mice are both low, and there is no statistical difference; the proportion and number of follicular B cells, transitional B cells and marginal zone B cells in the spleen of MDG1 mice show no statistical difference compared with wild-type mice.

[0452] The flow cytometry results of B cells in the peritoneal cavity are shown in Figure 31 As shown in Figure 31 The results show that the proportion of B cells in the peritoneal cavity of MDG1 mice is significantly higher than that of wild-type mice, the proportion of IgM+ B1a cells is significantly reduced in MDG1 mice, and the proportion of B1b and B2 cells is significantly increased in MDG1 mice.

[0453] Example 24, immunizing wild-type mice and MDG1 mice with specific antigens

[0454] Prepare 6-7 wild-type mice and MDG1 mice of the same genetic background, each of 6-7 weeks old, and use chloramphenicol coupled with BSA and atrazine for immunization experiments, 100 μg / 100 μL per mouse per time. The first immunization uses Freund's complete adjuvant, 50 μL is injected subcutaneously on the back, and 50 μL is injected intraperitoneally. The booster immunization uses Freund's incomplete adjuvant, 100 μL is injected intraperitoneally, a total of 4 times. The internal canthus blood is collected 3 days before the first immunization and 3 days after each booster immunization.

[0455] Example 25, ELISA detection of the change trend of the relative expression amount of antigen-specific antibodies in the serum of mice after immunization

[0456] To avoid the interference of BSA-specific antibodies in serum to the detection results after immune stimulation, the OVA-coupled chloramphenicol and atrazine were used as the coating antigen in the ELISA experiment, the antigen coating amount was 200 ng / 100 μL / well, the serum dilution multiple was 4000 times in the detection of antigen-specific IgM, IgG2c, IgG and IgA, and the serum dilution multiple was 100 times in the detection of IgE, in order to ensure the consistency of each sample well, the reaction time was strictly controlled at 20 min after the addition of TMB color developing liquid, and then the absorbance value at 450 nm was read by the enzyme label instrument, the individuals without immune reaction were removed, and the change trend graph of the relative expression amount of antigen-specific antibodies was drawn.

[0457] The change of the relative expression amount of chloramphenicol and atrazine-specific antibodies is shown in Figure 32 and Figure 33 The results show that, from the overall immune response, the immune effect of chloramphenicol is better than that of atrazine. The change trend of antigen-specific IgG2c in MDG1 mice is similar to that of IgG2c in wild type mice, and is different from the continuous low level expression of IgM in wild type mice. Because there are other IgG subtypes in wild type mice, the content of antigen-specific total IgG in wild type mice is higher than that in MDG1 mice, in addition, the relative expression amount of antigen-specific IgA and IgE in MDG1 mice is slightly higher than that in wild type mice.

[0458] Example 26, Development Detection of Germinal Center B Cells and Plasma Cells in Spleen after Antigen Immunization

[0459] Take 6 wild type mice and 6 MDG1 mice after antigen immunization, place a 70 μm filter screen in a 60 mm dish, add 1 mL ACK, take the spleen and place it on the filter screen and grind it gently, collect the cell suspension after grinding, centrifuge briefly and discard the supernatant, add 1 mL FACS to resuspend the cells, take 20 μL of the cells for staining, take 10 μL of the cells and dilute them 80 times for counting, the staining scheme of spleen B cells after immunization is shown in Table 21.

[0460] Table 21: Staining scheme of spleen B cells after immunization

[0461] FITC PerCP APC PE-Cy7 APC-Cy7 V450 V500 Spleen IgG2c 7-AAD B220 Fas CD38 CD138 CD19

[0462] The development of spleen B cells, germinal center B cells and plasma cells in mice after antigen immunization is shown in Figure 34 Figure 34 ​The results showed that the proportion of spleen B cells in MDG1 mice after immunization was significantly lower than that in wild-type mice, but there was no statistically significant difference in the number of cells. The proportion and number of germinal center B cells in MDG1 mice were significantly lower than those in wild-type mice, while the proportion of IgG2c+GC B cells was significantly higher than that in wild-type mice, but there was no statistically significant difference in the number of cells. There were no statistically significant differences in the proportion and number of plasma cells and IgG2c+ plasma cells between MDG1 mice and wild-type mice after antigen immunization.

[0463] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application, and are not intended to limit them. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of this application.

[0464] Industrial applicability

[0465] The non-human mammals or their offspring obtained by the preparation method of this application do not introduce any exogenous genes encoding antibody heavy chain variable regions and constant regions. They can directly utilize all VDJ genes encoding antibody heavy chain variable regions in their own genome, thereby generating heavy chain antibodies with better diversity through heavy chain variable region rearrangement. SEQUENCE LISTING <110> Beijing Renyuan Xinsheng Biotechnology Co., Ltd. <120> A method for preparing a non-human mammal or its offspring and its application <130> 1055-190483F <140> 2021800541157 <150> CN202010924095.1 <151> 2020-09-04 <160> 76 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Mouse (Mus musculus) <220> <221> misc_feature <222> (1)..(20) <223> Targeting sequence for sgRNA selected upstream of the first exon of the mouse Ighm gene <400> 1 gactctctga ggaccagaga 20 <210> 2 <211> 20 <212> DNA <213> Mus musculus <220> <221> misc_feature <222> (1)..(20) <223> Targeting sequence for sgRNA selected upstream of the first exon of the mouse Ighm gene <400> 2 tgggaaggac tgactctctg 20 <210> 3 <211> 20 <212> DNA <213> Mus musculus <220> <221> misc_feature <222> (1)..(20) <223> Targeting sequence for sgRNA selected downstream of the 1st exon of the mouse Ighg2c <400> 3 agtggacaag aaaattggtg 20 <210> 4 <211> 20 <212> DNA <213> Mus musculus <220> <221> misc_feature <222> (1)..(20) <223> Targeting sequence for sgRNA selected downstream of the 1st exon of the mouse Ighg2c <400> 4 cttgtgaact tctactcccc 20 <210> 5 <211> 20 <212> DNA <213> Mus musculus <220> <221> misc_feature <222> (1)..(20) <223> Targeting sequence for sgRNA selected downstream of the first exon of the mouse Ighm gene <400> 5 gatctgcatg tgcccattcc 20 <210> 6 <211> 20 <212> DNA <213> Mus musculus <220> <221> misc_feature <222> (1)..(20) <223> Targeting sequence for sgRNA selected downstream of the first exon of the mouse Ighm gene <400> 6 ggtttggttc ttacctggaa 20 <210> 7 <211> 20 <212> DNA <213> Mus musculus <220> <221> misc_feature <222> (1)..(20) <223> Targeting sequence for sgRNA selected upstream of the first exon of the mouse Ighg3 gene <400> 7 tgttgtagct gcaagatagg 20 <210> 8 <211> 20 <212> DNA <213> Mus musculus <220> <221> misc_feature <222> (1)..(20) <223> Targeting sequence of sgRNA selected upstream of the first exon of the mouse Ighg3 gene <400> 8 gagtgaggtt atcagacagc 20 <210> 9 <211> 113 <212> RNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(113) <223> sgRNA sequence targeting upstream of the first exon of the mouse Ighm gene <400> 9 gacucucuga ggaccagaga guuuaagagc uaugcuggaa acagcauagc aaguuuaaau 60 aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 113 <210> 10 <211> 114 <212> RNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(114) <223> sgRNA sequence targeting upstream of the first exon of the mouse Ighm gene <400> 10 gugggaagga cugacucucu gguuuaagag cuaugcugga aacagcauag caaguuuaaa 60 uaaggcuagu ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 114 <210> 11 <211> 114 <212> RNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(114) <223> sgRNA sequence targeting downstream of the first exon of mouse Ighg2c <400> 11 gaguggacaa gaaaauuggu gguuuaagag cuaugcugga aacagcauag caaguuuaaa 60 uaaggcuagu ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 114 <210> 12 <211> 114 <212> RNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(114) <223> sgRNA sequence targeting downstream of the first exon of mouse Ighg2c <400> 12 gcuugugaac uucuacuccc cguuuaagag cuaugcugga aacagcauag caaguuuaaa 60 uaaggcuagu ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 114 <210> 13 <211> 113 <212> RNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(113) <223> sgRNA sequence targeting downstream of the first exon of mouse Ighm gene <400> 13 GUGUUGUAGCUGCAAGAUAGGGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUA AA 60 AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCgAGUCGGUGCUUUUUUU 113 <210> 14 <211> 113 <212> RNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(113) <223> sgRNA sequence targeting downstream of the first exon of the mouse Ighm gene <400> 14 GGUUUGGUUCUUACcUGGAAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUA AA 60 AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCgAGUCGGUGCUUUUUUU 113 <210> 15 <211> 114 <212> RNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(114) <223> sgRNA sequence targeting upstream of the first exon of the mouse Ighg3 gene <400> 15 GUGUUGUAGCUGCAAGAUAGGGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUA AA 60 UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCgAGUCGGUGCUUUUUUUU 114 <210> 16 <211> 113 <212> RNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(113) <223> sgRNA sequence targeting the first exon of the mouse Ighg3 gene <400> 16 gagugagguu aucagacagc guuuaagagc uaugcuggaa acagcauagc aaguuuaaau 60 aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuu 113 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(20) <223> PCR primer to detect knockout of gene Ighm-d-g-1F <400> 17 gttcatgccc ctagagttgg 20 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(20) <223> PCR primer to detect knockout of gene Ighm-d-g-1R <400> 18 taccattctc cctggagtgg 20 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(20) <223> PCR primer Ighd-2F to detect wild type gene <400> 19 gctcctgaga ctggccatag 20 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(20) <223> PCR primer Ighd-2R to detect wild type gene <400> 20 aaaagggagg gaatgaatgg 20 <210> 21 <211> 27 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(27) <223> PCR primer MHV1 <220> <221> misc_feature <222> (21)..(21) <223> s = g or c <400> 21 atgaaatgca gctggggcat sttcttc 27 <210> 22 <211> 26 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR primer MHV2 <220> <221> misc_feature <222> (14)..(14) <223> r = g or a <220> <221> misc_feature <222> (21)..(21) <223> s = g or c <220> <221> misc_feature <222> (22)..(22) <223> y = t or c <400> 22 atgggatgga gctrtatcat sytctt 26 <210> 23 <211> 27 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(27) <223> PCR primer MHV3 <220> <221> misc_feature <222> (7)..(7) <223> w = a or t <400> 23 atgaagwtgt ggttaaactg ggttttt 27 <210> 24 <211> 25 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(25) <223> PCR primer MHV4 <220> <221> misc_feature <222> (4)..(4) <223> r = g or a <220> <221> misc_feature <222> (13)..(13) <223> y = t or c <220> <221> misc_feature <222> (22)..(22) <223> r = g or a <400> 24 atgractttg ggytcagctt grttt 25 <210> 25 <211> 32 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(32) <223> PCR primer MHV5 <400> 25 atgggactcc aggcttcaat ttagttttcc tt 32 <210> 26 <211> 29 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(29) <223> PCR primer MHV6 <220> <221> misc_feature <222> (11)..(11) <223> y = t or c <220> <221> misc_feature <222> (14)..(14) <223> r = g or a <220> <221> misc_feature <222> (16)..(16) <223> s = g or c <220> <221> misc_feature <222> (20)..(20) <223> r = g or a <400> 26 atggcttgtc yttrgsgctr ctcttctgc 29 <210> 27 <211> 27 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(27) <223> PCR primer MHV7 <220> <221> misc_feature <222> (5)..(5) <223> r = g or a <220> <221> misc_feature <222> (13)..(13) <223> k = g or t <220> <221> misc_feature <222> (16)..(16) <223> r = g or a <220> <221> misc_feature <222> (23)..(23) <223> m = a or c <400> 27 atggratgga gckggrgtct ttmtctt 27 <210> 28 <211> 23 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(23) <223> PCR primer MHV8 <400> 28 atgagagtgc tgattctttt gtg 23 <210> 29 <211> 31 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(31) <223> PCR primer MHV9 <220> <221> misc_feature <222> (5)..(5) <223> m = a or c <220> <221> misc_feature <222> (17)..(17) <223> m = a or c <400> 29 atggmttggg tgtggamctt gcttattcct g 31 <210> 30 <211> 28 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(28) <223> PCR primer MHV10 <400> 30 atgggcagac ttaccattct cattcctg 28 <210> 31 <211> 28 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(28) <223> PCR primer MHV11 <400> 31 atggattttg ggctgatttt ttttattg 28 <210> 32 <211> 26 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR primer MHV12 <400> 32 atgatggtgt taagtccttc tgtacc 26 <210> 33 <211> 20 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(20) <223> PCR primer B6_IgG2c_CH2 R1 <400> 33 tggtccaccc aagaggtctg 20 <210> 34 <211> 49 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(41) <223> PCR primer MHVF1-Sfil <400> 34 atgccatgac tgtggcccag gcggccgagg tgaagcttct cgagtctgg 49 <210> 35 <211> 50 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(42) <223> PCR primer MHVF2-Sfil <220> <221> misc_feature <222> (28)..(28) <223> s = g or c <220> <221> misc_feature <222> (33)..(33) <223> s = g or c <220> <221> misc_feature <222> (40)..(40) <223> m = a or c <220> <221> misc_feature <222> (48)..(48) <223> w = a or t <400> 35 catgccatga ctgtggccca ggcggccsag gtscagctgm aggagtcwgg 50 <210> 36 <211> 50 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(42) <223> PCR primer MHVF3-Sfil <400> 36 catgccatga ctgtggccca ggcggccgag gtccagctgc aacaatctgg 50 <210> 37 <211> 50 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(42) <223> PCR primer MHVF4-Sfil <220> <221> misc_feature <222> (28)..(28) <223> s = g or c <220> <221> misc_feature <222> (33)..(33) <223> y = t or c <220> <221> misc_feature <222> (36)..(36) <223> r = g or a <220> <221> misc_feature <222> (39)..(39) <223> k = g or t <220> <221> misc_feature <222> (46)..(46) <223> y = t or c <400> 37 catgccatga ctgtggccca ggcggccsag gtycarctkc agcagyctgg 50 <210> 38 <211> 50 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(41) <223> PCR primer MHVF5-Sfil <220> <221> misc_feature <222> (30)..(30) <223> r = g or a <220> <221> misc_feature <222> (41)..(41) <223> w = a or t <400> 38 catgccatga ctgtggccca ggcggccgar gtgaagcttg wggagtctgg 50 <210> 39 <211> 37 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(37) <223> PCR primer B6-IgG2c-Hin-sfil <400> 39 actcgcggcc ggcctggcct gttatgggca ctctggg 37 <210> 40 <211> 357 <212> DNA <213> Mus musculus <220> <221> misc_feature <222> (1)..(357) <223> CRP antigen-specific IgG2c heavy chain antibody variable region nucleotide sequence <400> 40 gaggtccagc tgcaacaatc tggacctgag ttggtgaagc ctggggcttc agtgaagatt 60 tcctgtaagg cttctggata catgttcagt gactactata tgaattgggt gaagcagagc 120 catggaaaga gccttgagtg gattggaaat gttgatccta acactgataa tactatatac 180 aaccagaact tcaaggacaa ggccacattg actgtagaca ggtcctccag aacagcctac 240 atggaactcc acagcctgac atctgaggac tctgcagtct attactgtgc aagatcgagg 300 ttctatgatc cctggtttgc ttactggggc caagggactc tggtcactgt ctctgca 357 <210> 41 <211> 119 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(119) <223> CRP antigen-specific IgG2c heavy chain antibody variable region amino acid sequence <400> 41 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Met Phe Ser Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asn Val Asp Pro Asn Thr Asp Asn Thr Ile Tyr Asn Gln Asn Phe 50 55 60 Lys Asp Lys Ala Thr Leu Thr Val Asp Arg Ser Ser Arg Thr Ala Tyr 65 70 75 80 Met Glu Leu His Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Arg Phe Tyr Asp Pro Trp Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ala 115 <210> 42 <211> 348 <212> DNA <213> Mouse (Mus musculus) <220> <221> misc_feature <222> (1)..(348) <223> CRP antigen-specific IgG2c heavy chain antibody variable region nucleotide sequence <400> 42 gaggtgaagc ttctcgagtc tgggggaggc ttagtgaagc ctggagggtc cctgaaactc 60 tcctgtgcag cctctggatt cactttcagt gactatggca tgtcttggat tcgccagact 120 ccagacaaga ggctggagtg ggtcgcaacc attagtagtg gtaatactta cacctattat 180 tcaaaaagtg tgaaggggcg attcaccatc tccagagaca atgccaagaa caccctgtac 240 ctgcaaatga gcagtctgaa gtctgaagac acagccatatattactgttc aagacatacc 300 tctgattatt accctctgag ccaagggact ctggtcactg tctctgca 348 <210> 43 <211> 116 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(116) <223> CRP antigen-specific IgG2c heavy chain antibody variable region amino acid sequence <400> 43 Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Gly Met Ser Trp Ile Arg Gln Thr Pro Asp Lys Arg Leu Glu Trp Val 35 40 45 Ala Thr Ile Ser Ser Gly Asn Thr Tyr Thr Tyr Tyr Ser Lys Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Ile Tyr Tyr Cys 85 90 95 Ser Arg His Thr Ser Asp Tyr Tyr Pro Leu Ser Gln Gly Thr Leu Val 100 105 110 Thr Val Ser Ala 115 <210> 44 <211> 20 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(20) <223> PCR primer to detect knockout of gene Ighm-F <400> 44 ctgtggctag aaggcagctc 20 <210> 45 <211> 20 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(20) <223> PCR primer to detect knockout of gene Ighm-R <400> 45 atctctgcga cagctggaat 20 <210> 46 <211> 18 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (1)..(18) <223> PCR primer B6 - IghM CH2 R4 <400> 46 gttcatctct gcgacagc 18 <210> 47 <211> 117 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(117) <223> CRP antigen-specific IgG2c heavy chain antibody variable region amino acid sequence <400> 47 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Val Leu Lys Pro Gly Thr 1 5 10 15 Ser Val Arg Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Asn Ile His Trp Val Lys Gln Ser Arg Gly Glu Ser Leu Glu Trp Ile 35 40 45 Gly Phe Val Asn Pro Asp Thr Gly Asp Thr Tyr Tyr Tyr Lys Asn Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Phe Asn Arg Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Asp Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Thr Thr Val Glu Lys Asp Tyr Trp Gly Gln Gly Thr Ile 100 105 110 Leu Thr Val Ser Ser 115 <210> 48 <211> 117 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(117) <223> CRP antigen-specific IgG2c heavy chain antibody variable region amino acid sequence <400> 48 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Arg Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Asn Ile His Trp Val Lys Gln Ser His Gly Glu Ser Leu Glu Trp Ile 35 40 45 Gly Phe Val Asn Pro Asp Asn Gly Asp Thr Tyr Tyr Tyr Lys Asn Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Phe Asn Arg Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Asp Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Thr Thr Val Glu Lys Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110 Leu Thr Val Ser Ser 115 <210> 49 <211> 117 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(117) <223> CRP antigen-specific IgG2c heavy chain antibody variable region amino acid sequence <400> 49 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Arg Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Asn Ile His Trp Val Lys Gln Ser His Gly Glu Ser Leu Glu Trp Ile 35 40 45 Gly Phe Ile Asn Pro Asp Asn Gly Asp Thr Tyr Tyr Tyr Lys Asn Phe 50 55 60 Arg Gly Lys Ala Thr Leu Thr Leu Asn Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Asp Leu Arg Ser Leu Thr Ser Glu Asp Ser Gly Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Thr Thr Val Glu Lys Asp Tyr Trp Gly Gln Gly Thr Ile 100 105 110 Leu Thr Val Ser Ser 115 <210> 50 <211> 124 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(124) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-9 specific to coronavirus S protein antigen <400> 50 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Gly Asp Ala Asn Tyr Asn Gln Ser Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Pro Pro Leu Tyr Tyr Tyr Asn Asp Ser His Trp Tyr Phe Asn 100 105 110 Val Trp Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 51 <211> 124 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(124) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-19 specific to coronavirus S protein antigen <400> 51 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Ser Asp Ser Asn Tyr Asn Gln Asn Phe 50 55 60 Lys Asp Lys Ala Thr Leu Thr Val Asp Arg Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Pro Pro Leu Tyr Tyr Tyr Asn Asn Ser His Trp Tyr Phe Asn 100 105 110 Val Trp Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 52 <211> 124 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(124) <223> The variable region amino acid sequence of coronavirus S protein antigen-specific IgG2c heavy chain antibody S-27 <400> 52 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Arg Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Gly Asp Thr Asn Tyr Asn Pro Asn Phe 50 55 60 Lys Asp Lys Ala Thr Leu Thr Val Asp Met Ser Ser Thr Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ala Lys Pro Pro Leu Tyr Tyr Tyr Asn Asn Ser His Trp Tyr Phe Asn 100 105 110 Val Trp Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 53 <211> 116 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(116) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-47 specific for coronavirus S protein antigens <400> 53 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Asp 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Asp Tyr 20 25 30 Phe Ile Asn Trp Val Met Arg Ser His Gly Lys Gly Leu Glu Trp Ile 35 40 45 Gly Arg Ile Asn Pro Tyr Asn Gly Asp Thr Phe Phe Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Ile Leu Thr Val Asp Thr Ser Ser Ser Thr Ala His 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Thr Tyr Gly Ser Pro Met Asp Tyr Trp Gly Gln Gly Thr Ser Val 100 105 110 Thr Val Ser Ser 115 <210> 54 <211> 124 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(124) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-1 specific to coronavirus S protein antigen <400> 54 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Gly Gly Ala Asn Tyr Asn Gln Thr Phe 50 55 60 Lys Gly Lys Ala Thr Phe Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Gly Pro Leu Tyr Tyr Tyr Asn Ser Ser Asn Trp Tyr Phe Asp 100 105 110 Val Arg Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 55 <211> 124 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(124) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-2 specific to coronavirus S protein antigen <400> 55 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Gly Gly Thr Ser Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Gly Pro Leu Tyr Tyr Tyr Asn Ser Ser Asn Trp Tyr Phe Asp 100 105 110 Val Arg Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 56 <211> 124 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(124) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-7 specific to coronavirus S protein antigen <400> 56 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Ile Asn Trp Val Lys Gln Ser His Gly Lys Ser Arg Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Lys Asn Gly Gly Thr Asn Phe Asn Arg Glu Phe 50 55 60 Lys Gly Glu Ala Thr Leu Thr Val Asp Lys Ser Ser Thr Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Gly Pro Leu Tyr Tyr Tyr Asn Asn Ser Tyr Trp Tyr Phe Asp 100 105 110 Val Trp Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 57 <211> 124 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(124) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-12 specific for coronavirus S protein antigen <400> 57 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Arg Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Gly Val Thr Ser Tyr Asn Gln Asn Phe 50 55 60 Lys Gly Glu Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Gly Pro Leu Tyr Tyr Tyr Asn Ser Ser Asn Trp Tyr Phe Asp 100 105 110 Val Trp Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 58 <211> 124 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(124) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-17 specific for coronavirus S protein antigens <400> 58 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Met Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Gly Gly Ala Asn Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Gly Pro Leu Tyr Tyr Tyr Asn Ser Ser Asn Trp Tyr Phe Asp 100 105 110 Val Arg Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 59 <211> 124 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(124) <223> The variable region amino acid sequence of coronavirus S protein antigen-specific IgG2c heavy chain antibody S-19 <400> 59 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Gly Gly Ala Asn Tyr Asn Gln Thr Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Gly Pro Leu Tyr Tyr Tyr Asn Ser Ser Thr Trp Tyr Phe Asp 100 105 110 Val Arg Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 60 <211> 124 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(124) <223> The variable region amino acid sequence of coronavirus S protein antigen-specific IgG2c heavy chain antibody S-25 <400> 60 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Asn Asn Gly Gly Thr Ser Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Gly Pro Leu Tyr Tyr Tyr Asn Asn Ser Asn Trp Tyr Phe Asp 100 105 110 Val Arg Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 61 <211> 124 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(124) <223> The variable region amino acid sequence of coronavirus S protein antigen-specific IgG2c heavy chain antibody S-51 <400> 61 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Met Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Ser Thr Gly Gly Thr Ser Tyr Asn Gln Thr Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Gly Pro Leu Tyr Tyr Tyr Asn Ser Ser Asn Trp Tyr Phe Asp 100 105 110 Val Arg Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 62 <211> 124 <212> PRT <213> Mus musculus <220> <221> DOMAIN <222> (1)..(124) <223> Variable region amino acid sequence of IgG2c heavy chain antibody S-65 specific for coronavirus S protein antigens <400> 62 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Ile Asn Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asn Pro Lys Asn Gly Gly Ser Asn Tyr Asn Gln Thr Phe 50 55 60 Lys Gly Glu Ala Thr Leu Thr Val Asp Lys Ser Ser Asn Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Pro Leu Tyr Tyr Tyr Asn Ser Thr Tyr Trp Tyr Phe Asp 100 105 110 Val Trp Gly Thr Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 63 <211> 122 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(122) <223> The variable region amino acid sequence of coronavirus N protein antigen-specific IgG2c heavy chain antibody N-1 <400> 63 Glu Val Gln Leu Gln Glu Ser Gly Pro Gly Met Val Lys Pro Ser Gln 1 5 10 15 Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser Gly 20 25 30 Tyr Asp Trp His Trp Ile Arg Gln Phe Pro Gly Asn Lys Gln Glu Trp 35 40 45 Leu Gly Tyr Ile Thr Tyr Asp Gly Ser Asn His Tyr Asn Pro Ser Leu 50 55 60 Lys Asn Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe 65 70 75 80 Leu Lys Leu Ser Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Asp Asp Tyr Asp Gly Asp Tyr Tyr Thr Met Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> 64 <211> 122 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(122) <223> The variable region amino acid sequence of coronavirus N protein antigen-specific IgG2c heavy chain antibody N-2 <400> 64 Glu Val Gln Leu Lys Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr Ile Ser Ser Gly Ser Ser Thr Ile Tyr Tyr Ala Asp Thr Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Phe 65 70 75 80 Leu Gln Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Ile Tyr Tyr Cys 85 90 95 Ala Arg Leu Asp Asp Tyr Asp Ala Asp Tyr Tyr Ala Met Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> 65 <211> 122 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(122) <223> The variable region amino acid sequence of coronavirus N protein antigen-specific IgG2c heavy chain antibody N-3 <400> 65 Gln Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser Gly 20 25 30 Tyr Asp Trp His Trp Ile Arg His Phe Pro Gly Asn Lys Leu Glu Trp 35 40 45 Met Gly Tyr Ile Ser Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu 50 55 60 Lys Ser Arg Ile Ser Ile Thr His Asp Thr Ser Lys Asn His Phe Phe 65 70 75 80 Leu Lys Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Asp Asp Tyr Asp Gly Asp Tyr Tyr Thr Met Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> 66 <211> 122 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(122) <223> The variable region amino acid sequence of coronavirus N protein antigen-specific IgG2c heavy chain antibody N-5 <400> 66 Glu Val Gln Leu Lys Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Ser Leu Ser Leu Thr Cys Ser Val Thr Gly Tyr Ser Ile Thr Ser Gly 20 25 30 Tyr Tyr Trp Tyr Trp Ile Arg Gln Phe Pro Gly Asn Lys Gln Glu Trp 35 40 45 Leu Gly Tyr Ile Thr Tyr Asp Gly Ser Asn His Tyr Asn Pro Ser Leu 50 55 60 Lys Asn Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe 65 70 75 80 Leu Lys Leu Ser Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Asp Asp Tyr Asp Gly Asp Tyr Tyr Thr Met Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> 67 <211> 116 <212> PRT <213> Mouse (Mus musculus) <220> <221> DOMAIN <222> (1)..(116) <223> The variable region amino acid sequence of coronavirus N protein antigen-specific IgG2c heavy chain antibody N-23 <400> 67 Glu Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Glu Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr Ile Ser Ser Gly Ser Ser Thr Ile Tyr Tyr Ala Asp Thr Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Phe 65 70 75 80 Leu Gln Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Arg Gly Leu Asp Ala Met Asp Asn Trp Gly Gln Gly Thr Ser Val 100 105 110 Thr Val Ser Ser 115 <210> 68 <211> 18 <212> DNA <213> Artificial sequence <220> <223> PCR forward primer for amplifying mu gene JH2 <220> <221> misc_feature <222> (1)..(18) <400> 68 ctactggggc caaggcac 18 <210> 69 <211> 20 <212> DNA <213> Artificial sequence <220> <223> PCR reverse primer for amplifying mu gene q-IgM-CH1-R <220> <221> misc_feature <222> (1)..(20) <400> 69 agcccatggc caccagattc 20 <210> 70 <211> 22 <212> DNA <213> Artificial sequence <220> <223> PCR forward primer for amplifying gamma 2c gene q-IgG2c-hinge-CH2-F <220> <221> misc_feature <222> (1)..(22) <400> 70 atgcgcagct ccagacctct tg 22 <210> 71 <211> 19 <212> DNA <213> Artificial sequence <220> <223> PCR reverse primer for amplifying gamma 2c gene q-IgG2c-CH2-R <220> <221> misc_feature <222> (1)..(19) <400> 71 ggctcaggga gatcatgag 19 <210> 72 <211> 22 <212> DNA <213> Artificial sequence <220> <223> PCR forward primer for amplifying alpha gene JH2-3 <220> <221> misc_feature <222> (1)..(22) <400> 72 tactggggcc aaggcaccac tc 22 <210> 73 <211> 22 <212> DNA <213> Artificial sequence <220> <223> PCR reverse primer for amplification of alpha gene q-IgA-CH1-R <220> <221> misc_feature <222> (1)..(22) <400> 73 gggtcacttg acagagctcg tg 22 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer Ighg-1 F <220> <221> misc_feature <222> (1)..(20) <400> 74 ggaatcaaag gacagcagga 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer Ighg-1 R <400> 75 agtgtcaccg aggatccaga 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer Ighg-2 R <220> <221> misc_feature <222> (1)..(20) <400> 76 ccaaacaggg cttggagact 20

Claims

1. A method for preparing C57BL / 6 mice or their progeny, characterized in that, Includes the following steps: Steps for knocking out the genes encoding the antibody IgM heavy chain constant region and the genes encoding the IgD heavy chain constant region in the genome of C57BL / 6 mice; And, the steps of knocking out the nucleotide sequence encoding the CH1 domain in the genome of C57BL / 6 mice, starting from the gene encoding the IgG3 heavy chain constant region to the gene encoding the IgG2c heavy chain constant region.

2. The preparation method according to claim 1, characterized in that: The C57BL / 6 mouse genome includes complete genes encoding the κ light chain and / or the λ light chain.

3. The preparation method according to claim 2, characterized in that: The C57BL / 6 mice were able to express κ light chain and / or λ light chain normally.

4. The preparation method according to claim 1, characterized in that, In the gene knockout step, two sgRNAs targeting the exon 1 of the mouse gene encoding the IgM heavy chain constant region and two sgRNAs targeting the exon 1 of the mouse gene encoding the IgG2c heavy chain constant region were used. The targeting sequences of the two sgRNAs upstream of exon 1 of the mouse gene encoding the IgM heavy chain constant region are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the targeting sequences of the two sgRNAs downstream of exon 1 of the mouse gene encoding the IgG2c heavy chain constant region are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

5. The preparation method according to claim 4, characterized in that, The sequences of the two sgRNAs targeting the exon 1 of the mouse gene encoding the IgM heavy chain constant region are SEQ ID NO.9 and SEQ ID NO.10, respectively, and the sequences of the two sgRNAs targeting the exon 1 of the mouse gene encoding the IgG2c heavy chain constant region are SEQ ID NO.11 and SEQ ID NO.12, respectively.

6. The preparation method according to any one of claims 1-5, characterized in that, The C57BL / 6 mice or their progeny were used to produce heavy chain IgG2c antibodies.

7. A method for preparing C57BL / 6 mice or their progeny, characterized in that, Includes the following steps: The steps to knock out the nucleotide sequence encoding the CH1 domain on the gene encoding the IgM heavy chain constant region in the genome of C57BL / 6 mice; And, the steps of knocking out the nucleotide sequence encoding the CH1 domain in the genome of C57BL / 6 mice, starting from the gene encoding the IgG3 heavy chain constant region to the gene encoding the IgG2c heavy chain constant region.

8. The preparation method according to claim 7, characterized in that: The C57BL / 6 mouse genome includes complete genes encoding the κ light chain and / or the λ light chain.

9. The preparation method according to claim 8, characterized in that: The C57BL / 6 mice were able to express κ light chain and / or λ light chain normally.

10. The preparation method according to claim 7, characterized in that, In the gene knockout step, two sgRNAs targeting the exon 1 of the mouse gene encoding the IgM heavy chain constant region, two sgRNAs targeting the exon 1 of the mouse gene encoding the IgM heavy chain constant region, two sgRNAs targeting the exon 1 of the mouse gene encoding the IgG3 heavy chain constant region, and two sgRNAs targeting the exon 1 of the mouse gene encoding the IgG2c heavy chain constant region were used.

11. The preparation method according to claim 10, characterized in that, The target sequences of the two sgRNAs upstream of exon 1 of the gene encoding the constant region of the mouse IgM heavy chain are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The target sequences of the two sgRNAs downstream of exon 1 of the gene encoding the constant region of the mouse IgM heavy chain are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. The target sequences of the two sgRNAs upstream of exon 1 of the gene encoding the constant region of the mouse IgG3 heavy chain are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively. The target sequences of the two sgRNAs downstream of exon 1 of the mouse gene encoding the constant region of the IgG2c heavy chain are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

12. The preparation method according to claim 11, characterized in that, The sequences of the two sgRNAs upstream of exon 1 of the gene encoding the constant region of the mouse IgM heavy chain are SEQ ID NO.9 and SEQ ID NO.10, respectively; The sequences of two sgRNAs downstream of exon 1 of the gene encoding the constant region of the mouse IgM heavy chain are SEQ ID NO.13 and SEQ ID NO.14, respectively. The sequences of two sgRNAs targeting the exon 1 of the mouse gene encoding the constant region of the IgG3 heavy chain are SEQ ID NO.15 and SEQ ID NO.16, respectively. The sequences of the two sgRNAs downstream of exon 1 of the gene encoding the constant region of the mouse IgG2c heavy chain are SEQ ID NO.11 and SEQ ID NO.12, respectively.

13. The preparation method according to any one of claims 7-12, characterized in that, The C57BL / 6 mice or their progeny were used to produce heavy chain IgG2c antibodies.

14. The use of a C57BL / 6 mouse or its progeny constructed by the preparation method according to any one of claims 1-6, or a C57BL / 6 mouse or its progeny constructed by the preparation method according to any one of claims 7-13, in screening for target heavy chain antibodies.

15. The application according to claim 14, characterized in that, Phage display was used when screening for target heavy chain antibodies.

16. The application according to claim 14 or 15, characterized in that, The target heavy chain antibody for screening is a C-reactive protein antigen-specific IgG2c heavy chain antibody.

17. A method for screening target heavy chain antibodies, comprising using C57BL / 6 mice or their progeny constructed by the preparation method according to any one of claims 1-6 or C57BL / 6 mice or their progeny constructed by the preparation method according to any one of claims 7-13 as immunized animals for screening.

18. The method according to claim 17, wherein, Phage display was used when screening for target heavy chain antibodies.

19. The method according to claim 17 or 18, wherein, The target heavy chain antibody for screening is a C-reactive protein antigen-specific IgG2c heavy chain antibody.

20. A non-human mammalian cell, cell line, or primary cell culture, characterized in that, The non-human mammalian cells or cell lines or primary cell cultures are derived from C57BL / 6 mice or their progeny constructed by the preparation method described in any one of claims 1-6, or from C57BL / 6 mice or their progeny constructed by the preparation method described in any one of claims 7-13.

21. An isolated tissue or organ or its culture, characterized in that, The isolated tissue or organ or its culture is derived from C57BL / 6 mice or their progeny prepared by the preparation method described in any one of claims 1-6, or C57BL / 6 mice or their progeny prepared by the preparation method described in any one of claims 7-13.

22. An sgRNA composition, characterized in that, The sgRNA composition comprises: (1) Two sgRNAs targeting the target sequences shown in SEQ ID NO.1 and SEQ ID NO.2 upstream of exon 1 of the mouse gene encoding the IgM heavy chain constant region, and (2) Two sgRNAs targeting the downstream exon 1 of the mouse gene encoding the constant region of the IgG2c heavy chain, as shown in SEQ ID NO.3 and SEQ ID NO.

4.

23. The sgRNA composition according to claim 22, characterized in that, The sequences of the two sgRNAs in (1) are SEQ ID NO.9 and SEQ ID NO.10, respectively, and the sequences of the two sgRNAs in (2) are SEQ ID NO.11 and SEQ ID NO.12, respectively.

24. An sgRNA composition, characterized in that, The sgRNA composition comprises: 1) Target the sgRNA upstream of exon 1 of the mouse gene encoding the IgM heavy chain constant region, and target the sgRNA downstream of exon 1 of the mouse gene encoding the IgG2c heavy chain constant region; or, 2) Target the sgRNA upstream and downstream of exon 1 of the gene encoding the IgM heavy chain constant region in mice; or, 3) Target the sgRNA upstream of exon 1 of the mouse gene encoding the constant region of the IgG3 heavy chain, and target the sgRNA downstream of exon 1 of the mouse gene encoding IgG2c.

25. The sgRNA composition according to claim 24, characterized in that, The sgRNAs upstream of exon 1 of the gene targeting the mouse IgM heavy chain constant region are SEQ ID NO. 9 and SEQ ID NO. 10; the sgRNAs downstream of exon 1 of the gene targeting the mouse IgM heavy chain constant region are SEQ ID NO. 13 and SEQ ID NO. 14; the sgRNAs upstream of exon 1 of the gene targeting the mouse IgG3 heavy chain constant region are SEQ ID NO. 15 and SEQ ID NO. 16; and the sgRNAs downstream of exon 1 of the gene targeting the mouse IgG2c heavy chain constant region are SEQ ID NO. 11 and SEQ ID NO.

12.

26. A knockout vector, characterized in that, include: The DNA sequence encoding each sgRNA in the sgRNA composition as described in any one of claims 22-25.

27. The knockout carrier according to claim 26, characterized in that, The backbone of the knockout vector is an sgRNA expression vector.

28. A cell characterized by, It includes the knockout vector as described in any one of claims 26-27.

Citation Information

Patent Citations

  • Nucleic acid molecule and application to preparing human derived single domain antibody

    CN108486125A

  • Genetically modified non-human animals and methods for producing heavy chain-only antibodies

    CN109906030A

  • Construction method and application of mouse expressing heavy-chain antibody IgG1

    CN119184026A