A water temperature optimized immersion immune system and its application

Abstract

The present invention discloses a water temperature optimized immersion immune system and its application. The water temperature optimized immersion immune system of the present invention is provided with a first-stage water temperature and a second-stage water temperature; the first-stage water temperature is 22°C±1°C; the second-stage water temperature is 28°C±1°C; the water temperature optimized immersion immune system is used to improve the protection rate of the infectious spleen and kidney necrosis virus orf074r gene deletion virus immersion vaccine. Treatment with the water temperature optimized immersion immune system of the present invention can significantly reduce the virulence of the infectious spleen and kidney necrosis virus orf074r gene deletion virus, improve the protection rate of aquatic products, and is of great significance for effectively controlling the outbreak of infectious spleen and kidney necrosis virus disease and reducing the disease risk and disease prevention and control costs of aquaculture.

Description

Technical Field

[0001] The invention relates to the technical field of vaccines, in particular to a water temperature optimized immersion immune system and application thereof. Background Art

[0002] Viral infectious diseases in intensive fish farming cause huge economic losses to the fish farming industry. Among them, iridovirus is one of the most prevalent and pathogenic viral pathogens in marine and freshwater farmed fish, especially infectious spleen and kidney necrosis virus (ISKNV) of the genus Cytomegalovirus, which can infect more than 50 species of marine and freshwater fish, causing a major impact on the healthy and sustainable development of my country's aquaculture industry. In order to prevent fish viral diseases, vaccination is a very important and effective means, and it also contributes to the environmental, social and economic sustainable development of global aquaculture. There are many types of vaccines. Immersion vaccines have become a research hotspot for the development of fish virus vaccines due to their advantages of little damage to fish, labor saving and high efficiency.

[0003] In the related technology, the gene-deleted attenuated vaccine has the potential to be immunized through the immersion route because it retains the activity of the virus. Previous studies have shown that the ISKNV orf074r gene-deleted virus strain (Δorf074r) was constructed using homologous recombination technology and used as an ISKNV candidate vaccine strain. 175g±30g of mandarin fish (Siniperca chuatsi) was immunized with Δorf074r with a physical titer of 9.0E3 / mL, and the water was changed after 3 hours of immersion, and the death of mandarin fish within 20 days was observed. The results showed that the survival rate of the Δorf074r-immersed experimental group was 44.19% after 20 days of breeding, and all the mandarin fish in the control group (immersed and infected with 8.0E5 / mL of wild-type ISKNV virus) died within 11 days, indicating that the virulence of Δorf074r was reduced by 40% compared with the wild-type virus. The surviving mandarin fish in the experimental group were further challenged with 8.0E6 / mL of the wild-type strain, and a control group of 20 fish was set up for 20 days of culture, and the protection rate was counted every day. The results showed that the protection rate of the Δorf074r experimental group was 44.44%, while the 20 mandarin fish in the control group that were not immunized with the attenuated vaccine all died within 12 days after the wild-type strain challenge, indicating that the use of Δorf074r for soaking immunization of mandarin fish can achieve a certain immune prevention effect. However, there are still certain limitations when using Δorf074r for soaking immunization of mandarin fish, that is, its protection rate 20 days after vaccination can only reach about 40%, which is difficult to be further improved.

[0004] Therefore, it is necessary to find a water temperature optimization immersion immune system that can improve the protection rate of the immersion vaccine, which can effectively reduce the mortality rate of the infectious spleen and kidney necrosis virus orf074r gene deletion virus vaccine. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes a water temperature optimized immersion immune system, which is used to improve the protection rate of infectious spleen and kidney necrosis virus orf074r gene deletion virus immersion vaccine, and has the advantages of little damage to fish body and high efficiency.

[0006] The present invention also proposes an application of the water temperature optimized soaking immune system in improving the immunity of aquatic products to infectious spleen and kidney necrosis virus.

[0007] The present invention also proposes an application of the water temperature optimized immersion immune system in reducing the mortality rate of aquatic products.

[0008] The present invention also proposes an application of the water temperature optimized immersion immune system in aquaculture.

[0009] In a first aspect of the present invention, there is provided a water temperature optimized immersion immune system, wherein the water temperature optimized immersion immune system is provided with a first stage water temperature and a second stage water temperature;

[0010] The water temperature in the first stage is 22°C ± 1°C;

[0011] The water temperature in the second stage is 28°C ± 1°C;

[0012] The water temperature optimization soaking immune system is used to improve the protection rate of the infectious spleen and kidney necrosis virus orf074r gene deleted virus soaking vaccine.

[0013] The system according to the embodiment of the present invention has at least the following beneficial effects: the water temperature optimized immersion immune system of the present invention is used to improve the protection rate of the infectious spleen and kidney necrosis virus orf074r gene deleted virus immersion vaccine, which can significantly reduce the virulence of the infectious spleen and kidney necrosis virus orf074r gene deleted virus and improve the protection rate of aquatic products.

[0014] According to some embodiments of the present invention, the water temperature optimized immersion immune system is a programmable temperature controlled immersion device for improving immune protection rate.

[0015] The second aspect of the present invention provides an application of a water temperature optimized immersion immune system in improving the immunity of aquatic products to infectious spleen and kidney necrosis virus.

[0016] The third aspect of the present invention provides an application of a water temperature optimized immersion immune system in reducing the mortality rate of aquatic products.

[0017] A fourth aspect of the present invention provides an application of a water temperature optimized immersion immune system in aquaculture.

[0018] According to some embodiments of the present invention, the application specifically comprises the following steps:

[0019] Step S1, under the water temperature condition of the first stage, immunizing the fish with an immersion vaccine containing the infectious spleen and kidney necrosis virus orf074r gene deletion virus to obtain immunized fish;

[0020] Step S2, replacing the soaked vaccine with aquaculture water, and aquaculture under the first stage water temperature conditions for 28 to 32 days, and then adjusting the water temperature to the second stage water temperature to continue aquaculture.

[0021] According to some embodiments of the present invention, the fish is a fish that does not carry infectious spleen and kidney necrosis virus.

[0022] According to some embodiments of the present invention, the primer set for identifying whether the fish carries infectious spleen and kidney necrosis virus includes at least one of an ISKNV mcp (major capsid protein gene) primer set and an MRV (Mandarin fish ranavirus, MRV) mcp primer set;

[0023] Preferably, the nucleotide sequence of ISKNV-mcp-F in the ISKNV mcp primer set is as shown in SEQ ID NO: 1;

[0024] The ISKNV-mcp-R nucleotide sequence in the ISKNV mcp primer set is shown in SEQ ID NO: 2;

[0025] More preferably, the nucleotide sequence of MRV-mcp-F in the MRV mcp primer set is as shown in SEQ ID NO: 3;

[0026] The MRV-mcp-R nucleotide sequence in the MRV mcp primer set is shown in SEQ ID NO:4.

[0027] According to some embodiments of the present invention, the fish is selected from at least one of mandarin fish, seabass, large yellow croaker, and turbot.

[0028] According to some embodiments of the present invention, the concentration of the infectious spleen and kidney necrosis virus orf074r gene deletion virus in the soaking vaccine is 1×10 5 copies / mL~1×10 6 copies / mL.

[0029] Preferably, the concentration of the infectious spleen and kidney necrosis virus orf074r gene deletion virus in the soaking vaccine is 4×10 5 copies / mL~6×10 5 copies / mL;

[0030] More preferably, the concentration of the infectious spleen and kidney necrosis virus orf074r gene-deficient virus in the soaking vaccine is 5×10 5 copies / mL.

[0031] Since Δorf074r is still pathogenic to mandarin fish, high virus concentration may cause the death of mandarin fish after immersion immunization; the experimental results show that 5×10 3 The immune protection effect of Δorf074r at 1×10 copies / mL on mandarin fish was 0, so too low a concentration might lead to poor protection effect; while concentrations higher than 1×10 7 copies / mL, the mortality rate in the immunization stage is higher than 60%.

[0032] According to some embodiments of the present invention, the immune treatment time is 3h to 5h.

[0033] According to some embodiments of the present invention, the continued cultivation period is 5 to 15 days.

[0034] According to some embodiments of the present invention, the continued cultivation period is 8 to 12 days.

[0035] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0037] Figure 1 It is a statistical diagram of the survival rate of mandarin fish at different immersion temperatures of the present invention.

[0038] Figure 2 This is a graph showing the effect of low-temperature immersion of Δorf074r on the protection rate of mandarin fish in the present invention.

[0039] Figure 3 This is another diagram showing the effect of low-temperature immersion of Δorf074r on the protection rate of mandarin fish in the present invention.

[0040] Figure 4 This is the replication curve of Δorf074r in the spleen of mandarin fish under low temperature of the present invention.

[0041] Figure 5This is a pathological section of the spleen tissue of mandarin fish after immersion treatment with Δorf074r at low temperature in the present invention.

[0042] Figure 6 This is a statistical graph of ISKNV-specific IgM levels in serum of mandarin fish after immersion treatment with Δorf074r at low temperature in the present invention.

[0043] Figure 7 This is the result of measuring the ISKNV-specific neutralizing antibody titer after challenge at low temperature in the present invention. DETAILED DESCRIPTION

[0044] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0045] In the description of the present invention, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.

[0046] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0047] In the present invention, "water temperature optimized immersion immune system" is a programmable temperature-controlled immersion device for improving immune protection rate, wherein two different immersion temperatures are provided, the first immersion temperature is 22°C±1°C, and the cycle is 28 to 35 days; the second immersion temperature is 28°C±1°C, and the cycle is 5 to 15 days.

[0048] In the embodiment of the present invention, the specific preparation method of the soaking vaccine of infectious spleen and kidney necrosis virus orf074r gene deletion virus includes the following steps:

[0049] Mandarin fish fry cells were infected with the Δorf074r virus suspension at an MOI (multiplicity of infection) of 1. After 96 hours of culture, the supernatant was obtained and filtered using a 0.22 μm filter membrane.

[0050] The method for obtaining Δorf074r is described in patent document CN 108384763 A.

[0051] Example 1

[0052] This embodiment is an application of water temperature optimization soaking immune system in improving the protection rate of infectious spleen and kidney necrosis virus orf074r gene deletion virus soaking vaccine, which specifically includes the following steps:

[0053] Mandarin fish that did not carry infectious spleen and kidney necrosis virus were selected and placed in water at 22°C and containing 5×10 5 The copies / mL infectious spleen and kidney necrosis virus orf074r gene deleted virus immersion vaccine was immersed in the water temperature optimized immersion immune system for 4 hours, and then the immersion vaccine in the water temperature optimized immersion immune system was replaced with the aquaculture water. After continuous aquaculture for 30 days, the water temperature was adjusted to 28℃ for continued cultivation.

[0054] Comparative Example 1

[0055] This comparative example is an application of an immersion system in improving the protection rate of an infectious spleen and kidney necrosis virus orf074r gene-deficient virus immersion vaccine, which specifically includes the following steps:

[0056] Mandarin fish that did not carry infectious spleen and kidney necrosis virus were selected and placed in water at 28°C and containing 5×10 5 The water temperature of the copies / mL infectious spleen and kidney necrosis virus orf074r gene deletion virus immersion vaccine was optimized and immersed in the immune system for 4 hours, and then the immersion vaccine was replaced with the aquaculture water and continued to be cultured for 30 days.

[0057] Test example

[0058] (I) Preparation of experimental animals

[0059] First, the batch of mandarin fish to be tested was tested for common pathogens such as ISKNV or mandarin fish virus (MRV). The spleens of several mandarin fish (larger than 6 cm) were randomly selected from the batch and used DNA was extracted using the Tissue DNA Kit. The specific extraction method is as follows:

[0060] (1) Weigh 30 mg of tissue and place it in a 1.5 mL centrifuge tube;

[0061] (2) Add 200 μL TL buffer;

[0062] (3) Add 25 μL of proteinase K solution and vortex to mix thoroughly;

[0063] (4) Centrifuge at maximum speed for 5 min;

[0064] (5) Transfer the supernatant to a 1.5 mL centrifuge tube and extract DNA according to the kit instructions.

[0065] The sample DNA was amplified by PCR using ISKNV mcp and MRV mcp detection primers, respectively. The sequences of ISKNV mcp and MRV mcp detection primers are shown in Table 1.

[0066] Table 1: Primer sequences for ISKNV mcp and MRV mcp detection

[0067] Primer name Sequence (5'-3') ISKNV-mcp-F CGTGAGACCGTGCGTAGT(SEQ ID NO:1) ISKNV-mcp-R AGGGTGACGGTCGATATG(SEQ ID NO:2) MRV-mcp-F ACGGTGGAAAAGATGCAACTACTT(SEQ ID NO:3) MRV-mcp-R ATGACCACCAGGGCGTATTTCT(SEQ ID NO:4)

[0068] The PCR reaction system (50 μL) is shown in Table 2.

[0069] Table 2: PCR reaction system

[0070] Reagents Volume (μL) 2×KOD Buffer 25μL dNTPs 10μL Primer F 1μL Primer R 1μL DNA 1μL KOD-FX 1μL <![CDATA[ddH2O]]> Add to 50 μL

[0071] The PCR amplification program is shown in Table 3.

[0072] Table 3: PCR amplification program

[0073]

[0074] After PCR amplification, the PCR products were analyzed by agarose gel electrophoresis, and it was confirmed that this batch of mandarin fish did not carry ISKNV or mandarin fish virus.

[0075] Then, the mandarin fish that did not carry ISKNV or Rana chuatsi virus were taken to the experimental tank and used as test subjects after being confirmed to have no abnormal conditions.

[0076] (II) Lethality analysis of vaccines soaked in Δorf074r gene-deficient virus at different temperatures

[0077] 1. Experimental materials and methods

[0078] A total of 180 mandarin fish that were confirmed not to carry ISKNV or mandarin fish virus were taken and divided into Δorf074r-22℃ group, Δorf074r-28℃ group, wild-type virus-22℃ group (WT-22℃), wild-type virus-28℃ group (WT-28℃), DMEM-22℃ control group and DMEM-28℃ control group, with 30 fish in each group, and cultured in 3 fish tanks.

[0079] Use 5×10 5The Δorf074r-22℃ group mandarin fish were immersed in the vaccine containing Δorf074r at 10 copies / mL. The immersion time was 4 hours, the temperature was 22℃, and the oxygen content during the immersion process was 7mg / mL-8mg / mL. Then the Δorf074r-22℃ group mandarin fish infected with Δorf074r were transferred to conventional aquaculture water at 22℃ for immersion culture. On the 31st day after immersion, the water temperature was adjusted to 28℃, and the observation was continued for 10 days, during which the survival rate was recorded every day. The difference between the WT-22℃ group and the Δorf074r-22℃ group was that the immersion vaccine containing Δorf074r was replaced by the WT ISKNV virus suspension during the immersion process. The difference between the DMEM-22℃ control group and the Δorf074r-22℃ group was that 5×10 5 The number of copies / mL of Δorf074r was 44.5, 12.5 and 14.5, respectively. Each group was repeated three times, and the average survival rate was calculated.

[0080] Use 5×10 5 The Δorf074r-28℃ group mandarin fish were immersed in the vaccine containing Δorf074r at 28℃ for 4 hours, and the oxygen content during the immersion immunization process was 7mg / mL-8mg / mL. Then the Δorf074r-28℃ group mandarin fish infected with Δorf074r were transferred to conventional aquaculture water at 28℃ for immersion culture for 30 days, and the survival rate was recorded every day during the period. The difference between the WT-28℃ group and the Δorf074r-28℃ group was that the immersion vaccine containing Δorf074r was replaced by the WT ISKNV virus suspension during the immersion immunization process. The difference between the DMEM-28℃ control group and the Δorf074r-28℃ group was that 5×10 5 The number of copies / mL of Δorf074r was 44.5, 12.5 and 14.5, respectively. Each group was repeated three times, and the survival rate was calculated.

[0081] 2. Test results

[0082] The average survival rates of mandarin fish in the Δorf074r-22℃ group, Δorf074r-28℃ group, WT-22℃ group, WT-28℃ group, DMEM-22℃ control group, and DMEM-28℃ control group are shown in Table 1.

[0083] Table 1: Statistics of average survival rate of mandarin fish

[0084]

[0085]

[0086] From the table, it can be analyzed that the average survival rate of the mandarin fish in the DMEM-22℃ and DMEM-28℃ control groups was 100%, indicating that there was no abnormality in the breeding conditions; there was no death in the Δorf074r-22℃ group during the breeding period at 22℃ water temperature, and the average survival rate was 100%; the mandarin fish in the Δorf074r-28℃ group had a mortality rate of 47% during the 30 days of breeding at 28℃ water temperature, and the average survival rate was only 53%; the mandarin fish in the WT-22℃ group had an average survival rate of 67% after being cultured at 22℃ water temperature for 30 days, and all died within 7 days after the water temperature was adjusted to 28℃.

[0087] Furthermore, in order to intuitively see the difference, the present invention statistically analyzed the survival of mandarin fish in the Δorf074r-22℃ group, Δorf074r-28℃ group, WT-22℃ group, WT-28℃ group, DMEM-22℃ control group and DMEM-28℃ control group. Figure 1 As shown. Figure 1 It can be seen that the survival rate of the Δorf074r-22℃ group was significantly improved compared with the wild-type virus group.

[0088] In summary, compared with the immersion temperature of 28℃, the virulence of the Δorf074r gene-deficient virus immersion vaccine was significantly weakened at the immersion temperature of 22℃. Although the mortality rate of WT ISKNV dropped to 33% at 22℃, all the infected fish died after the temperature was raised to 28℃, which once again proved that Δorf074r can effectively reduce the mortality rate.

[0089] (III) Test on the protection rate of Δorf074r gene-deficient virus soaked vaccine at low temperature

[0090] In order to further test the protection rate of Δorf074r gene-deficient virus soaked vaccine under low temperature, this experiment used 1.67×10 8 The surviving mandarin fish (Δorf074r-22℃ group, Δorf074r-28℃ group and DMEM-22℃ control group) after the above immunization were challenged by intraperitoneal injection of WT ISKNV virus suspension of copies, and the survival rate was continuously counted for 21 days after challenge.

[0091] The test results are as follows Figure 2 As shown, from Figure 2 It can be analyzed that: 21 days later, the survival rate of the surviving mandarin fish in the Δorf074r-22℃ group after infection was 80%, the survival rate of the surviving mandarin fish in the Δorf074r-28℃ group after infection was 100%, and the survival rate of the mandarin fish in the DMEM control group after infection was 0. It can be seen that the low-temperature immersion immunization of Δorf074r has an 80% protection rate for mandarin fish.

[0092] Furthermore, in order to simulate the natural infection mode of ISKNV, in another experiment, WT ISKNV virus suspension was used at 5×10 6 The concentration of 100 copies / mL was used to treat the mandarin fish soaked in Δorf074r at low temperature (Δorf074r-22℃ group) and the mandarin fish soaked in Δorf074r at 28℃ (Δorf074r-28℃ group). The observation was continued for 21 days after the infection, and the survival rate was calculated every day. Figure 3 As shown, the results showed that the survival rate of mandarin fish soaked in Δorf074r (Δorf074r-22℃ group) after infection was 80%, which was equivalent to the effect of Δorf074r-28℃ group; while the survival rate of mandarin fish soaked in DMEM after infection was 0, which once again proved that the low-temperature immersion immunization of Δorf074r had an 80% protection rate for mandarin fish.

[0093] (IV) Replication curves of Δorf074r in mandarin fish spleen at different temperatures

[0094] To detect the replication of Δorf074r in the spleen at different temperatures, mandarin fish were immersed in Δorf074r virus suspension at 22°C and 28°C (immersion concentration was 5×10 5 The virus titer was detected by taking spleens on the 3rd, 6th, 9th, 12th, 15th, 18th and 30th days of immersion. The results were the average of 3 replicates, and replication curves were drawn, with error bars representing standard deviations.

[0095] The results of the test using Δorf074r virus suspension to immerse mandarin fish at 22°C are as follows Figure 4 As shown in the figure, the results showed that Δorf074r was detected in the sample on the 18th day after immersion, and the titer at this time was 10 4.07 TCID 50 / mL (each 1mL contains 30mg tissue); Δorf074r was not detected in the sample on the 30th day, indicating that Δorf074r had been cleared by the fish body at this time, so no death would be caused when the temperature subsequently rose to 28°C, ensuring the safety of low-temperature immersion immunization of Δorf074r.

[0096] The results of the immersion experiment at 28°C showed that the titer of Δorf074r reached 10 on the 12th day. 6.66 TCID 50 / mL, the fish began to die. Therefore, it was preliminarily judged that the replication speed and amount of Δorf074r decreased at 22°C compared with 28°C, thus reducing the mortality rate.

[0097] (V) Pathological sections of spleen tissue of mandarin fish under low temperature treatment

[0098] To detect the lesions of spleen tissue caused by Δorf074r at low temperature, Δorf074r virus suspension was used at 5×10 5 The fish were immersed in DMEM at a concentration of 100 copies / mL. The control group was immersed in DMEM. The spleens were taken out on the 9th, 12th and 15th days after immersion to make histopathological sections and perform HE staining.

[0099] The results are as follows Figure 5 As shown in the figure, where the scale bar is 50 μm, the results showed that the mandarin fish immersed in Δorf074r at 22°C had almost no swollen cells in the spleen on the 9th, 12th and 15th days, which was similar to that of the mandarin fish immersed in DMEM. This shows that immersion of mandarin fish in Δorf074r at 22°C hardly caused spleen tissue lesions, further ensuring the safety of low-temperature immersion immunization of Δorf074r.

[0100] (VI) Detection of serum ISKNV-specific IgM at low temperature

[0101] To detect the ISKNV-specific IgM level in serum, Δorf074r virus suspension was used at 22°C with 5 × 10 5 The mandarin fish were immersed in DMEM at a concentration of 100 copies / mL, and the control group was immersed in DMEM. Serum samples (named as Δorf074r serum and mock serum, respectively) were collected at designated time points, and the amount of ISKNV-specific IgM was detected by sandwich ELISA.

[0102] The results are as follows Figure 6 As shown in the figure, it can be analyzed that the amount of ISKNV-specific IgM in the Mock serum always maintains a level similar to that when not immersed, with no significant difference; the level of ISKNV-specific IgM in the Δorf074r serum is not significantly increased, and only produces a significant difference from the non-immersion on the 15th day after immersion, and the individual difference is small at this time. The above results show that immersion of Δorf074r at 22°C has a slight induction effect on the production of ISKNV-specific IgM in host serum.

[0103] (VII) Determination of ISKNV-specific neutralizing antibody titers after challenge at low temperature

[0104] Since in the above-mentioned serum ISKNV-specific IgM detection test under low temperature, no significant increase in ISKNV-specific antibody levels was detected in the mandarin fish soaked in Δorf074r on the 15th day after soaking, it is necessary to further detect the changes in ISKNV-specific antibody levels on the 40th day after soaking and after the virus challenge experiment.

[0105] In this experiment, 5×10 5Mandarin fish were soaked in DMEM and cultured at 22°C for 30 days. The water temperature was adjusted to 28°C and cultured for another 10 days. On the 40th day after soaking, 5×10 6 The virus was challenged by immersing the virus in a suspension of WT ISKNV with 10 copies / mL. Serum samples (named Δorf074r serum and mock serum, respectively) were collected at designated time points before and after the challenge and were then analyzed by MN. 50 Analyze and detect the ISKNV neutralizing antibody titer.

[0106] The results are as follows Figure 7 As shown, the results showed that from before the challenge to the 6th day after the challenge, the MN of ISKNV-specific neutralizing antibodies in the Δorf074r serum 50 The titer was maintained at 10 2.3 Around 10 on the 9th day after the attack. 1.7 On the 12th and 15th days, it rose back to 10 2.0 Combined with the experimental results of immersion challenge, 20% of the fish immersed in Δorf074r died on the 9th day after challenge, and it is speculated that the death of the fish may be related to the decline in antibody levels. However, all the fish immersed in DMEM died on the 8th day after challenge, and no ISKNV-specific neutralizing antibodies (MN) were detected in the mock serum from before challenge to the 6th day after challenge. 50 The above results show that the ISKNV-specific neutralizing antibody titer in the serum of fish immersed in Δorf074r at 22°C water temperature remained at a high level on the 40th day after immersion, but decreased slightly on the 9th day after infection and rebounded from the 12th day.

[0107] In summary, the present invention provides a method for reducing the pathogenicity of infectious spleen and kidney necrosis virus orf074r gene deletion virus soaking vaccine (Δorf074r) and improving the immune protection effect by using a temperature-optimized soaking immunization program, which can effectively reduce the pathogenicity of Δorf074r as an ISKNV soaking vaccine and improve its immune protection effect. Immunizing fish with the Δorf074r soaking vaccine method of the present invention can effectively control the outbreak of ISKNV disease, reduce the disease risk and disease prevention and control costs of aquaculture, and is of great significance to promoting the development of aquaculture.

[0108] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A method for increasing the infectious spleen and kidney necrosis virus orf074r The application of a programmable temperature-controlled soaking device for the protection rate of a gene-deficient virus soaking vaccine in the preparation of a product for improving the immunity of mandarin fish to infectious spleen and kidney necrosis virus is characterized in that: The programmable temperature-controlled soaking device is provided with a first-stage water temperature and a second-stage water temperature; The water temperature in the first stage is 22°C ± 1°C, and the water temperature in the first stage is used for immunization and post-immunization treatment. The infectious spleen and kidney necrosis virus in the immersion vaccine in the immunization treatment orf074r The concentration of the gene-deficient virus was 1×10 5 copies / mL~1×10 6 copies / mL, the immunization treatment cycle is 3 h~5 h; the post-immunization treatment is to replace the soaked vaccine with aquaculture water and then culture, and the culture cycle is 28 days~32 days; The water temperature in the second stage is 28°C ± 1°C. The water temperature in the second stage is used for continued breeding, and the cycle is 5 to 15 days.

Images