Application of StHY5 gene in anthocyanin synthesis in potato
By overexpressing the StHY5 gene in potato plants and activating anthocyanin synthesis-related genes and transcription factors, the problem of insufficient anthocyanin synthesis in potatoes was solved, and the breeding of potato varieties with high anthocyanin content was achieved.
Patent Information
- Application Number
- CN202310096845.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-10
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2043-02-10
AI Technical Summary
In the existing technology, although the synthesis pathway of potato anthocyanins is clear, there is a lack of effective gene regulation methods, resulting in insufficient anthocyanin content and difficulty in cultivating new potato varieties with high anthocyanin content.
The StHY5 gene and its overexpression vector are provided. By overexpressing the StHY5 gene in potato plants, the structural genes related to anthocyanin synthesis and the key transcription factor promoters are activated, thereby improving the anthocyanin synthesis capacity.
It significantly increased the anthocyanin content in potato tubers, promoted the accumulation of anthocyanins, and provided gene and vector resources for breeding new potato varieties with high anthocyanin content.
Smart Images

Figure CN116286859B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology and specifically relates to StHY5 Application of genes in anthocyanin synthesis in potato. Background Art
[0002] Potatoes, the world's fourth-largest food crop, are widely cultivated and enjoyed by people worldwide. Their tubers contain a variety of nutrients, including protein, vitamins, minerals, carotene, thiamine, and riboflavin, and are therefore highly nutritious (Zhao Zhiqiang et al., 2019). Compared to ordinary potatoes, colored potatoes are richer in anthocyanins and polyphenols, offering enhanced disease resistance and antioxidant capacity. They have health benefits, including anti-cancer, anti-aging, weight loss, and blood sugar-lowering benefits (Qiu Ju et al., 2018). Anthocyanins are water-soluble flavonoid pigments that often combine with monosaccharides in plants to form natural antioxidant anthocyanins, which also prevent vascular sclerosis. Six major anthocyanidins are found in colored potato tubers: pelargonidin, cyanidin, peonidin, delphinidin, malvidin, and petunidin. Anthocyanins in potatoes are distributed in the peel, flesh, runners, flowers, roots, stems, and leaves, and are found in higher concentrations in tubers (Chen Min et al., 2013). Currently, much research has been done on the anthocyanin synthesis pathway, which is relatively clear. Starting from phenylalanine, it is formed in the cytoplasm after a series of enzymatic reactions and modifications by different transferases. The synthesis process goes through three stages: the conversion of phenylalanine and acetic acid into anthocyanin precursors, flavonoid metabolism, and the production of anthocyanins. During this process, structural genes encoding various enzymes play a vital role in the synthesis of anthocyanins, such as CHS, CHI, F3H, F3’H, F3’5’H, DFR, ANS and UFGT In addition to structural genes, regulatory genes also play a crucial role in anthocyanin biosynthesis. These include transcription factors such as MYB, bHLH, and WD40, which regulate anthocyanin biosynthesis by binding to the promoters of structural genes. These three types of transcription factors not only independently influence anthocyanin synthesis but also interact to form the MBW complex to regulate anthocyanin biosynthesis. The MBW complex has numerous target genes and a stronger ability to activate genes (Liang Lijun et al., 2018; Zhuang Weibing et al., 2018).
[0003] HY5 is a leucine zipper (bZIP) transcription factor and was the first transcription factor discovered to be involved in photomorphogenesis (Wang Zhiran et al., 2018). In recent years, studies have shown its regulatory role in anthocyanin biosynthesis. PAP1 is one of the four R2R3 MYB activators involved in anthocyanin biosynthesis. Early biosynthesis genes are preferentially expressed through PAP1, and HY5 can not only directly regulate the expression of early biosynthesis genes, but also regulate their expression by binding to the G- and ACE-boxes in the PAP1 promoter region, thereby affecting anthocyanin biosynthesis (Dong Ho Shin et al., 2013). MaHY5 Genes, and their expression in different organs at different stages were analyzed. By comparing the anthocyanin content in the corresponding stages and organs, it was found that MaHY5 The expression pattern of anthocyanin accumulation is basically consistent with that of anthocyanin, and both are expressed at higher levels in flowers, indicating that MaHY5 It may be involved in the accumulation process of anthocyanins (Cao Shimeng et al., 2019). Summary of the Invention
[0004] To address the above problems, the present invention provides for the first time a gene that can enhance the synthesis of anthocyanins in potatoes. StHY5 , and the application of its overexpression vector and gene. It provides gene and vector resources for breeding new potato (plant) varieties with high anthocyanin content.
[0005] The specific scheme adopted in the present invention is:
[0006] StHY5 Application of gene in regulating the synthesis of anthocyanins in potato, the StHY5 The gene is 558 bp long and encodes 185 amino acids; StHY5 The nucleotide sequence of the gene is shown in SEQ ID NO: 01, and the encoded amino acid sequence is shown in SEQ ID NO: 02.
[0007] A method for increasing anthocyanin content in potato tubers, the method comprising overexpressing anthocyanin in potato plants StHY5 gene; StHY5 The gene is 558 bp long and encodes 185 amino acids; StHY5 The nucleotide sequence of the gene is shown in SEQ ID NO: 01, and the encoded amino acid sequence is shown in SEQ ID NO: 02.
[0008] As a further optimization of the above solution, the method includes the following steps:
[0009] Step 1: Amplify using potato tuber epidermal cDNA as template StHY5 Gene, the amplification primers are as follows:
[0010] The forward primer was 5'-TAGTGGATCCAAAGAATTCATGCAAGAGCAAGCGACAAG -3',
[0011] The reverse primer was 5′- CGAGAAGCTTTTTGAATTCTCAAATTAAACAATGCCTGTGATTC -3′;
[0012] Step 2: Take the result from step 1 StHY5 The gene was connected to the plant expression vector pSAK-277 to construct the recombinant expression vector pSAK- StHY5 ; Then the recombinant expression vector pSAK- StHY5 Transform Agrobacterium and obtain positive Agrobacterium after screening;
[0013] Step 3: Cut the test tube potatoes grown for 8-12 weeks into 1-2 mm slices, soak them in the positive Agrobacterium solution for 5-10 minutes, and then perform tissue culture to obtain transgenic strains;
[0014] Step 4: Plant the transgenic strain obtained in step 3 and harvest the transgenic potatoes.
[0015] StHY5 Application in activating anthocyanin synthesis related structural genes and key transcription factor promoter activity. Further, the structural gene is StCHI or StF3’5’H , the key transcription factor is StAN2, StMYBA1 or StAN1 .
[0016] The present invention relates to StHY5 Genes were obtained by screening differentially expressed genes in anthocyanin synthesis-related transcriptomes. StHY5 The expression pattern of this gene in potato tubers of different phenotypes was found to be correlated with the anthocyanin content in the tubers. By constructing an overexpression vector, overexpression in tobacco can promote the synthesis of anthocyanin in tobacco leaves, indicating that potato StHY5 The gene plays an important role in the synthesis of anthocyanins. StHY5 Identifying the gene and its role in potato anthocyanin synthesis is of great significance for breeding new potato varieties with high anthocyanin content.
[0017] Beneficial effects: Provides gene and vector resources for breeding new potato (plant) varieties with high anthocyanin content. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 yes StHY5The expression pattern of genes in FT033-5 tubers;
[0019] Figure 2 Overexpression StHY5 Phenotypic identification diagram of transgenic tubers of the gene;
[0020] Figure 3 Overexpression StHY5 Graph of anthocyanin content in transgenic tubers of the gene;
[0021] Figure 4 Overexpression StHY5 Gene in transgenic tubers StHY5 Gene expression pattern analysis diagram;
[0022] Figure 5 Overexpression StHY5 Analysis of the expression patterns of anthocyanin synthesis-related genes in transgenic tubers of the gene;
[0023] Figure 6 This is a diagram of the activation effect of StHY5 protein on the promoters of genes related to anthocyanin synthesis. DETAILED DESCRIPTION
[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.
[0025] The present invention StHY5 The gene was cloned from the cDNA of the potato tuber genotype FT033-5. The skin of the FT033-5 tubers is yellow before exposure to light. After 12 hours of exposure to light, the skin of the tubers begins to turn purple (accumulation of anthocyanins). Anthocyanin accumulation increases with prolonged light exposure. Transcriptome sequencing was performed on FT033-5 tuber epidermal samples treated with light for 0, 2, 6, 12, 24, and 48 hours to identify differentially expressed genes. StHY5 The function of the gene was studied by overexpressing it in potatoes, and it was found that the gene can promote the synthesis of anthocyanins in potatoes.
[0026] The present invention cloned from potato FT033-5 genotype tuber StHY5 The ORF sequence is 558 bp long and encodes 185 amino acids. Overexpression of this gene in potatoes can effectively promote anthocyanin synthesis and increase the anthocyanin content of the plant.
[0027] 1. StHY5 Gene expression analysis
[0028] In the present invention StHY5The gene was found in the transcriptome differentially expressed genes related to anthocyanin synthesis. The epidermis of FT033-5 tubers was yellow before exposure to light, and the color of the tuber epidermis began to turn purple after 12 hours of exposure to light. As the light exposure time increased, the accumulation of anthocyanins increased. The cDNA of the epidermis samples of FT033-5 tubers treated with light for 0h, 12h, 24h, 48h, and 72h was used as a template for the analysis of the expression of anthocyanin in the culture medium. StHY5 Real-time PCR expression analysis was performed. Real-time PCR was performed according to SYBR Premix Ex TM The reaction was performed using a Taq II kit. The reaction system consisted of 12.5 μl of SYBR Mix, 1 μl of each forward and reverse primer, and 1 μl of template, made up to 25 μl with sterile distilled water. The reaction program was as follows: 95°C for 5 min; 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s; and 72°C for 5 min. StHY5 The forward primer was 5′-CTGGAAGCAAGGGTGAAGGA -3′, and the reverse primer was 5′-ACAATTCCCCCAAGCAAATAGG -3′. Stef1α As the internal reference gene, the forward primer was 5'-ATTGGAAACGGATATGCTCCA-3' and the reverse primer was 5'-TCCTTACCTGAACGCCTGTCA-3'. PCR reaction was performed on the iCycler iQ5 Real-time PCR instrument of Bio-Rad. -△△Ct Method for different samples StHY5 The relative expression levels of genes were normalized.
[0029] 2. StHY5 Gene cloning and expression vector construction
[0030] The cDNA of potato tuber epidermis treated with light for 2 h was used as template, 5'-TAGTGGATCCAAAGAATTCATGCAAGAGCAAGCGACAAG -3' (SEQ ID NO: 03) was used as forward primer, and 5'- CGAGAAGCTTTTTGAATTCTCAAATTAAACAATGCCTGTGATTC -3' (SEQ ID NO: 04) was used as reverse primer to amplify the cDNA. StHY5 Gene. The gene fragment was cloned into the plant expression vector pSAK-277 ( EcoRI. Single enzyme digestion) recombination: The recombination reaction system includes 3µL of target gene recovery product, 2µL of digested pSAK-277 vector plasmid, 2µL of 5× MasterMix, and 3µL of dH2O. The prepared reaction system is incubated on ice for 30 minutes for recombination, and then transformed into competent E. coli DH5α cells. After Spe antibiotic selection, single colonies are selected and shaken. Positive clones are sent to the company for sequencing, forming the plant expression vector pSAK- StHY5 Extraction of pSAK- StHY5 The vector plasmid was transformed into Agrobacterium GV3101 and screened with Spe and Rif antibiotics to obtain positive clones, which were used as plant expression vector pSAK- StHY5 Agrobacterium.
[0031] 3. Overexpression in potato StHY5 Gene
[0032] The recombinant plant expression vector pSAK- StHY5 Streak a culture of Agrobacterium onto LB plates (containing 50 mg / L Spe and 50 mg / L Rif) and incubate at 28°C for 48 hours. Pick a single colony and incubate in 10 ml of YEB liquid medium (supplemented with the appropriate antibiotics) at 28°C and 250 rpm for 24 hours. Transfer 5 ml of the culture to 50 ml of fresh LB liquid medium and continue incubating at 28°C and 250 rpm until the OD600 reaches approximately 0.6. Transfer the culture to a centrifuge tube and centrifuge at 5000 rpm for 6 minutes at room temperature. Collect the precipitate and resuspend it in MS liquid medium. Cut the test tube potatoes that have grown for 8-12 weeks and have a diameter of about 0.5 cm into 1-2 mm slices, soak them in the above-mentioned Agrobacterium solution for 5-10 minutes, take them out and dry the surface solution with sterile filter paper, transfer them to symbiotic medium S1 (MS + IAA 0.2 mg / L + BA 0.5 mg / L + GA30.2 mg / L + ZT 2 mg / L), culture them in the dark at 26°C for 2 days, and then transfer them to regeneration medium S2 (MS + IAA 0.1 mg / L + ZT2 mg / L + Kan 60 mg / L + CEF 200 mg / L). Culture them under the conditions of light intensity of 2000 lx, photoperiod of 16 h / d, and 25±1°C until resistant buds grow. Resistant buds were excised and placed in rooting medium (MS + 3% sucrose + 50 mg / L Kan + 200 mg / L CEF) for rooting screening. Whole-plant RNA was extracted from rooted lines and used for qRT-PCR to identify transgenic lines. The forward primer for detecting the StHY5 gene was 5'-CTGGAAGCAAGGGTGAAGGA-3', and the reverse primer was 5'-ACAATTCCCCCAAGCAAATAGG -3'. A total of eight transgenic lines were obtained.
[0033] 4. Overexpression StHY5 Analysis of expression patterns of genes related to anthocyanin synthesis in potato tubers
[0034] Overexpression transgenic lines OE-4, OE-6, OE-12, and OE-14 were planted, and transgenic potatoes were harvested. The peel and flesh were sampled, and total RNA was extracted. Real-time PCR was used to detect the expression of anthocyanin synthesis-related genes. StHY5, StCHS, StCHI, StF3H, StF3’H, StF3’5’H, StANS, StDFR, StGST, StMYB113, StAN1, StAN2, StJAF13, StMYBA1 The expression levels of 14 genes were measured. PCR reactions were performed on a Bio-Rad iCycler iQ5 Real-time PCR instrument. -△△Ct The relative expression levels of genes in different samples were normalized.
[0035] 5. Determination of anthocyanin content in transgenic tuber epidermis
[0036] Anthocyanin content was determined using the spectrophotometric pH differential method (Zhang et al., 2009). Anthocyanins were extracted from 0.5 g of tubers using a methanol-hydrochloric acid solution (methanol and 0.05 mol L−1 HCl in a ratio of 85:15). The absorbance of the extract was measured at 530 nm and 700 nm using a spectrophotometer (UV-2550, Shimadzu, Japan). Absorbance (Abs) s = (A530 nm–A700 nm) pH 1.0 – (A530 nm–A700 nm) pH 4.5. Total anthocyanin content (TAC) was calculated using the formula described previously (Liu et al., 2016). Three biological replicates were performed for each sample.
[0037] 6. Activation of anthocyanin synthesis-related genes by StHY5 protein
[0038] The dual luciferase assay was used to detect the activation effect of StHY5 protein on the promoter of anthocyanin synthesis-related genes: the target gene promoter was loaded into the 0800-LUC vector, StHY5 The gene was loaded into the pSAK-277 vector with a 35S promoter and transformed into Nicotiana benthamiana plants grown for 4-6 weeks using the Agrobacterium transient injection method. Samples were taken three days later to determine the LUC and REN values.
[0039] Sequence Listing SEQ ID NO: 1 is the isolated clone of the present invention StHY5 The nucleotide coding sequence of the gene is 558 bp in length and encodes a total of 185 amino acids. StHY5 The protein sequence of a gene.
[0040] (1) StHY5DNA sequence of the gene (SEQ ID NO: 1)
[0041] ATGCAAGAGCAAGCGACAAGTTCTATTGCCGCTAGTTCACTACCTTCAAGTAGTGAGAGATCTTCTAGTTCAGCTTTACATCTTGAACTCAAAGAAGGTATGGAGAGTGATGATGAGATCAGAAGAGTACCGGAGATGGGCGGAGAAGCGACGGGAACGATGTCAGCTTCTGGCAGAGATGGAGCTTCGGCCGCCGGTCAAGCTCAACCATCAGCTGGGACTCAGAGGAAGAGAGGAAGAAGCCCAGCTGACAAAGAAAACAAAAGGTTAAAAAGGTTGTTGAGAAATAGAGTGTCAGCACAGCAAGCAAGGGAGAGGAAGAAAGCATATTTGATAGATCTGGAAGCAAGGGTGAAGGAATTGGAAACAAAGAATGCAGAACTTGAAGAGAGGTTGTCTACTTTGCAAAATGAGAACCAAATGCTTAGACATGTAAACATTCTTTTCACTCCTACTACTTCTATTTTTGCAAAAGAATTACTCATGTATATATCCTATTTGCTTGGGGGAATTGTATTTGAACACATGCTATTGAATCACAGGCATTGTTTAATTTGA。
[0042] (2) StHY5 Protein sequence of the gene (SEQ ID NO: 2)
[0043] MQEQATSSIAASSLPSSSERSSSSALHLELKEGMESDDEIRRVPEMGGEATGTMSASGRDGASAAGQAQPSAGTQRKRGRSPADKENKRLKRLLRNRVSAQQARERKKAYLIDLEARVKELETKNAELEERLSTLQNENQMLRHVNILFTPTTSIFAKELLMYISYLLGGIVFEHMLLNHRHCLI-
[0044] (3) StHY5 Analysis of the expression pattern of the gene in FT033 - 5 tubers
[0045] The tubers of FT033-5 were treated with light for 0h, 2h, 6h, 12h, 24h and 48h, and the cDNA of the tuber epidermis samples in these treatments was used as template. StHY5 Gene expression analysis ( Figure 1 ). The results show StHY5 The gene expression level showed a trend of increasing first and then decreasing with the illumination time, and the expression level was the highest at 2 hours. StHY5 The gene may play a role in the early stages of anthocyanin synthesis.
[0046] (4) StHY5 Promoting effect on anthocyanin synthesis in potato tubers
[0047] The transgenic plants were grown in a greenhouse and harvested after about 90 days. The skin color of the harvested transgenic tubers was compared with that of the control group, Desiree, and it was found that the overexpression StHY5 The epidermis of the tubers of the transgenic lines OE-4, OE-6, OE-12, and OE-14 of the gene turned red significantly ( Figure 2 ). The anthocyanin content of the transgenic tuber epidermis was determined, and the results showed that the overexpression StHY5 The anthocyanin content of transgenic tubers of the gene was significantly higher than that of Desiree ( Figure 3 ). This indicates that overexpression of the StHY5 gene enhanced the accumulation of anthocyanins.
[0048] (5) StHY5 Analysis of the mechanism of gene regulation of anthocyanin synthesis in potato
[0049] Total RNA was extracted from the epidermis of the tubers of the transgenic lines and reverse transcribed into cDNA for detection. StHY5 The results showed that compared with the control group Desiree, the transgenic lines OE-4, OE-6, OE-12, and OE-14 had StHY5 The expression of genes was significantly increased ( Figure 4 The results of analysis on the expression of anthocyanin synthesis-related genes in the tuber epidermis of transgenic lines showed that compared with the control group Desiree, the anthocyanin synthesis structural genes in the tuber epidermis of transgenic lines OE-4, OE-6, OE-12, and OE-14 were significantly higher than those in the control group Desiree. StCHI, StF3’H, StDFR The expression of MYB transcription factor StMYBA1, StAN2, StMYB113 The expression level of Figure 5This suggests that the transcription factor StHY5 may regulate the synthesis and accumulation of anthocyanins by regulating the transcriptional expression of these genes. The promoters of anthocyanin synthesis-related genes were transferred into the 0800-LUC vector and co-transfected with the pSAK-HY5 vector into Nicotiana benthamiana plants grown for 4-6 weeks for transient expression. The results of dual luciferase activity assays showed that the StHY5 protein can activate the structural gene StCHI, StF3’5’H and transcription factors StAN2, StMYBA1, StAN1 Transcriptional expression ( Figure 6 These results suggest that StHY5 can regulate the synthesis of anthocyanins in potato tubers by directly activating the promoter activity of structural genes and key transcription factors.
[0050] It should be noted that the above-described embodiments are to be understood as illustrative and not limiting of the scope of protection of the present invention, which is subject to the claims. It will be apparent to those skilled in the art that non-essential improvements and adjustments to the present invention, without departing from the spirit and scope of the present invention, still fall within the scope of protection of the present invention.
Claims
1. StHY5 Application of gene in regulating the synthesis of anthocyanins in potato, the StHY5 The gene is 558 bp long and encodes 185 amino acids; StHY5 The nucleotide sequence of the gene is shown in SEQ ID NO: 01, and the encoded amino acid sequence is shown in SEQ ID NO:
02.
2. A method for increasing anthocyanin content in potato tubers, characterized in that: The method is to overexpress in potato plants StHY5 gene; StHY5 The gene is 558 bp long and encodes 185 amino acids; StHY5 The nucleotide sequence of the gene is shown in SEQ ID NO: 01, and the encoded amino acid sequence is shown in SEQ ID NO:
02.
3. The method according to claim 2, wherein: The method comprises the following steps: Step 1: Amplify using potato tuber epidermal cDNA as template StHY5 Gene, the amplification primers are as follows: The forward primer was 5'-TAGTGGATCCAAAGAATTCATGCAAGAGCAAGCGACAAG -3', The reverse primer was 5′- CGAGAAGCTTTTTGAATTCTCAAATTAAACAATGCCTGTGATTC -3′; Step 2: Take the result from step 1 StHY5 The gene was connected to the plant expression vector pSAK-277 to construct the recombinant expression vector pSAK- StHY5 ; Then the recombinant expression vector pSAK- StHY5 Transform Agrobacterium and obtain positive Agrobacterium after screening; Step 3: Cut the test tube potatoes grown for 8-12 weeks into 1-2 mm slices, soak them in the positive Agrobacterium solution for 5-10 minutes, and then perform tissue culture to obtain transgenic strains; Step 4: Plant the transgenic strain obtained in step 3 and harvest the transgenic potatoes.
4. StHY5 Application of the gene in activating anthocyanin synthesis-related structural genes and key transcription factor promoter activities, the StHY5 The gene is 558 bp long and encodes 185 amino acids; StHY5 The nucleotide sequence of the gene is shown in SEQ ID NO: 01, and the encoded amino acid sequence is shown in SEQ ID NO: 02; the structural gene is StCHI or StF3'5' H , the key transcription factor is StAN2、StMYBA1 or StAN1 .