A lipase and its application in synthesizing epoxy stearate methyl ester

Abstract

The present invention belongs to the field of bioengineering technology and relates to a lipase, a gene encoding the lipase, a recombinant expression vector and a recombinant expression transformant containing the lipase gene, a method for preparing the lipase, and a method for preparing methyl epoxy stearate using the lipase. Compared with the prior art, the lipase of the present invention has high activity and good stability. The enzyme is used to catalyze hydrogen peroxide and n-heptanoic acid to form peroxycarboxylic acid, which is then reacted with methyl oleate to generate methyl epoxy stearate. This avoids the large demand for strong acids and metal catalysts and the complex reaction apparatus in conventional chemical catalysis methods. The process is simple, the process is environmentally friendly, and there is good prospect in the industrial production of methyl epoxy stearate.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology and relates to a lipase, a coding gene thereof, a recombinant expression vector and a recombinant expression transformant containing the lipase gene, a method for preparing the lipase, and a method for preparing methyl epoxystearate using the lipase. Background Art

[0002] Epoxy fatty acid esters are a common plasticizer used in industry. They are typically produced by reacting unsaturated fatty acid esters with an epoxidizing agent. The epoxidizing agent adds to the double bonds of the unsaturated fatty acid ester to form epoxy groups, thus producing the epoxy fatty acid ester.

[0003] Epoxy fatty acid methyl esters (FAMs) are widely used in the manufacture of composite materials, castings, coatings, electrical insulation materials, and other fields. They can also be used as additives in biofuels to improve fuel performance. The raw materials for FAMs are primarily derived from various renewable plant oils and fats, including soybean oil and sunflower oil. Due to its wide range of applications and renewable raw material availability, FAMs are rapidly gaining popularity in various fields. Consequently, there is a growing demand for simple methods to synthesize sufficient quantities of FAMs.

[0004] Currently, the main industrial method for producing epoxy fatty acid esters is chemical synthesis, such as the strong acid synthesis method. Chemical synthesis of epoxy fatty acid esters involves reacting with hydrogen peroxide in an inorganic strong acid environment, utilizing the abundant free hydrogen ions. This reacts with hydrogen peroxide to generate a corresponding peroxy acid, which acts as an epoxidation reagent to oxidize the double bonds in the unsaturated fatty acid ester to form epoxides. While chemical synthesis of epoxy fatty acid esters is simple, it has significant drawbacks. First, the reaction involves the use of toxic and hazardous chemical reagents and catalysts, which can lead to environmental pollution and other problems if not handled properly. Second, the reaction conditions are harsh, requiring high reaction temperatures and reagent concentrations. These harsh reaction conditions can lead to decreased yields and increased production costs, which can be detrimental to large-scale industrial production. Furthermore, during the chemical synthesis of epoxy fatty acid esters, side reactions such as decomposition and dehydrogenation may occur, resulting in the formation of reaction byproducts and affecting the reaction efficiency. In addition to strong acids, phosphotungstic acid and methyltrioxorhenium can also be used as catalysts to catalyze the epoxidation of unsaturated fatty acid esters. However, these chemical reagents are generally toxic or expensive, making them unsuitable for large-scale industrial production.

[0005] Enzymatic synthesis, due to its eco-friendly and sustainable nature, has attracted widespread attention as a greener chemical synthesis method. Currently, a variety of epoxidases have been reported that catalyze the enzymatic synthesis of epoxy fatty acid esters, including fungal epoxidases, cytochrome P450 monooxygenases, and lipases. Compared with other enzymes, lipase synthesis of epoxy fatty acid esters offers advantages such as rapid reaction times and mild conditions, and has attracted widespread attention as a synthetic method with promising industrial applications. Lipase B (trade name Novozym 435) from Candida antarctica is the most widely studied lipase for the synthesis of epoxy fatty acid esters. Using sunflower oil as the reaction substrate, its reaction conversion rate can reach 88%. Despite this, Novozym 435 is expensive, making large-scale industrial application difficult. Therefore, there is still a need to develop efficient and inexpensive lipases for the enzymatic synthesis of epoxy fatty acid esters. Summary of the Invention

[0006] In view of the shortcomings of the existing technology of enzymatic synthesis of epoxy fatty acid esters catalyzed by lipase, the present invention provides a lipase with high catalytic activity, good thermal stability and good substrate tolerance, a gene encoding the lipase, a recombinant expression vector containing the lipase gene and a recombinant expression transformant, a method for preparing the lipase, and a method for synthesizing epoxy stearate methyl ester using the lipase.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] One of the technical solutions adopted in the present invention:

[0009] Provided is a lipase, which is a protein consisting of the amino acid sequence shown in SEQ ID No. 2, referred to as lipase TiL for short. The lipase is derived from Tilletia indica (Indian black powder fungus).

[0010] The present invention uses a bioinformatics-assisted method to screen enzymes. Using the amino acid sequence of Candida antarctica lipase, a lipase useful for epoxidation synthesis reported in the literature, as a probe, a BLAST analysis was performed against the NCBI database. Sequences with a similarity of less than 80% to the probe sequence were screened, and a phylogenetic tree was constructed after multiple sequence alignment. Twenty candidate enzymes were selected for gene synthesis, heterologously expressed in Escherichia coli, and subjected to a synthesis reaction for epoxy stearate methyl ester to verify their activity. Among these enzymes, the lipase TiL from Tilletia indica, numbered KAE8259452 in the database and having an amino acid sequence as shown in SEQ ID No. 2, exhibited high activity in synthesizing epoxy stearate methyl ester.

[0011] The second technical solution adopted by the present invention is:

[0012] Provided is a mutant of the TiL lipase as described in technical solution one.

[0013] Based on the discovery of a highly active lipase, TiL was subjected to directed evolution using site-directed saturation mutagenesis. AlphaFold was used to model TiL's amino acid sequence and dock the model with substrate molecules to identify the substrate binding site. Sites surrounding the substrate binding site were then selected for modification and screening, resulting in a series of mutants with enhanced activity. Specifically, their sequences are shown below:

[0014] (1) replacing proline at position 63 of the amino acid sequence shown in SEQ ID No. 2 with glutamine;

[0015] (2) replacing the leucine at position 131 of the amino acid sequence shown in SEQ ID No. 2 with serine;

[0016] (3) replacing tyrosine at position 265 of the amino acid sequence shown in SEQ ID No. 2 with glycine;

[0017] (4) replacing the proline at position 63 of the amino acid sequence shown in SEQ ID No. 2 with glutamine, and replacing the tyrosine at position 265 with glycine;

[0018] (5) The leucine at position 131 of the amino acid sequence shown in SEQ ID No. 2 was replaced by serine, and the tyrosine at position 265 was replaced by glycine.

[0019] The third technical solution adopted by the present invention is:

[0020] Provided is a nucleic acid encoding the lipase TiL and its mutants as described in technical solutions one and two.

[0021] The preparation method of the nucleic acid described in the present invention is a conventional preparation method in the art. The preparation method preferably includes: extracting a naturally occurring nucleic acid molecule encoding lipase TiL from the Indian smut fungus Tilletia indica; or obtaining a nucleic acid sequence encoding lipase TiL through gene cloning technology; or obtaining a nucleic acid molecule encoding lipase TiL and its mutants through artificial full sequence synthesis.

[0022] In one embodiment of the present invention, the nucleotide sequence of the nucleic acid molecule encoding lipase TiL is shown as SEQ ID NO.1.

[0023] The method of obtaining the nucleic acid molecule encoding lipase TiL by gene cloning technology of the present invention is as follows:

[0024] The forward primer was 5'-GGATCCGAATTCATGAGGTTACAC-3'.

[0025] Reverse primer 5'-TGGTGGTGCTCGAGTGCGGCCG-3',

[0026] The DNA sequences of the lipases obtained in technical solutions 1 and 2 were amplified using polymerase chain reaction technology:

[0027] PCR system (50 μL): 2x Prime Star Mix 20 μL, template plasmid approximately 100 ng, upstream and downstream primers 1.5 μL each, and ddH2O to make up to 50 μL.

[0028] PCR reaction procedure: (1) pre-denaturation at 95°C for 3 min; (2) denaturation at 98°C for 10 s; (3) annealing at 60°C for 15 s; (4) extension at 72°C for 1.5 min; (5) steps (2) to (4) were repeated 30 times, with a final extension at 72°C for 10 min and storage at 4°C.

[0029] The fourth technical solution adopted by the present invention is:

[0030] Provided is a recombinant expression vector comprising the lipase gene of the present invention.

[0031] The lipase gene nucleic acid sequence of the present invention can be linked to various suitable vectors by conventional methods in the art. The vector can be any conventional vector in the art, preferably a plasmid, more preferably plasmid pET-28a. The lipase gene can be operatively linked to any selected vector with a suitable expression regulatory sequence downstream to achieve constitutive or inducible expression of the lipase.

[0032] Preferably, as an example, the recombinant expression vector of the present invention can be prepared by the following method: the gene sequence DNA fragment of lipase TiL obtained by PCR amplification is double-digested with restriction endonucleases EcoR I and Xho I, and the empty plasmid pET-28a is also double-digested with restriction endonucleases EcoR I and Xho I. The above-digested gene DNA fragment and pET-28a plasmid are recovered by gel chromatography and ligated using T4 DNA ligase to obtain the recombinant expression plasmid pET-28a-TiL containing the lipase TiL gene.

[0033] The fifth technical solution adopted by the present invention is:

[0034] Provided is a recombinant expression transformant comprising the lipase gene of the present invention or its recombinant expression vector.

[0035] The recombinant expression transformant can be prepared by transforming the recombinant expression vector of the present invention into a host cell. The host cell can be any conventional host cell in the art, provided that the recombinant expression vector can stably replicate and the lipase gene carried by the recombinant expression vector can be effectively expressed. A preferred host cell of the present invention is Escherichia coli, more preferably E. coli BL21 (DE3).

[0036] The sixth technical solution adopted by the present invention is:

[0037] A method for preparing a lipase is provided, comprising the steps of culturing the recombinant expression transformant of the present invention to obtain the lipase. The culture medium used to culture the recombinant expression transformant can be selected from conventional culture media in the art, provided that the transformant can grow and produce the lipase of the present invention. The specific operations for culturing the transformant can be performed according to conventional procedures in the art.

[0038] As an example, 20 μL of the recombinant Escherichia coli constructed by the above technical solution was taken and inoculated into 4 mL of LB liquid medium (containing 50 μg mL -1 After culturing in a shaker at 37°C at 200 rpm for 12 h, 1 mL of the bacterial solution was transferred to 100 mL of LB liquid medium (containing 50 μg mL -1 The cells were cultured in a 500 mL shake flask containing kanamycin and shaken at 200 rpm in a 37°C shaker for 3-4 h until the OD 600 The target protein expression was induced by adding IPTG (isopropyl-β-D-thiogalactopyranoside) to a final concentration of 0.2 mM using a syringe. After induction, the cells were shaken at 200 rpm in a 16°C shaker for 24 hours and harvested by centrifugation (8000 × g, 5 minutes). The cells were resuspended in 10 mL of potassium phosphate buffer (KPB, 100 mM, pH 7.0) and sonicated at 30% power for 15 minutes in an ice-water bath to obtain a crude enzyme solution.

[0039] The protein in the present invention contains a histidine tag (His-Tag) at the N-terminus, so Ni NTABeads6FF nickel column can be used for protein purification. The enzyme protein purification buffers are: Solution A: 50mM NaH2PO4 (pH7.0), containing 300mM NaCl and 20mM imidazole; Solution B: 50mM NaH2PO4 (pH 7.0), containing 300mM NaCl and 500mM imidazole. Use five times the column volume of deionized water to rinse the nickel column, load the crude enzyme solution onto the nickel column, then use ten times the column volume of Solution A to rinse and then use fifteen to twenty times the column volume of Solution B to elute, and collect the eluate. Use SDS-PAGE protein electrophoresis to verify the purification of the purified protein, then use ultrafiltration tube centrifugation to remove imidazole, Nanodrop to determine the protein concentration, and store at -80°C for use after aliquoting.

[0040] The seventh technical solution adopted by the present invention is:

[0041] Provided is the application of the lipase in catalyzing the preparation of methyl epoxystearate from methyl oleate and hydrogen peroxide.

[0042] The lipase of the present invention is added to a toluene solution containing methyl oleate, saturated carboxylic acids of different chain lengths and hydrogen peroxide, and the fatty acid and hydrogen peroxide are catalyzed to react to form peroxy acid, thereby realizing spontaneous epoxidation of methyl oleate to synthesize epoxy stearate methyl ester.

[0043] The reaction temperature is 30-70°C, preferably 50°C. The molar ratio of saturated carboxylic acid to methyl oleate is 1:100-1:5, with n-heptanoic acid being preferred. The enzyme dosage is 1-50 g / L, and the amount of H2O2 (30%) added is 10-30 μL / mL. Other conditions can be selected according to conventional conditions for such reactions in the art.

[0044] Samples were taken intermittently during the reaction and analyzed by gas chromatography. An Rxi-5Sil MS (30.0 m × 0.25 mm, 0.25 μm) column was used for gas chromatography analysis. The carrier gas was nitrogen at a total flow rate of 14.4 mL / min and a pressure of 80.9 kPa. The column temperature (temperature program) was as follows: initial temperature 200°C, ramped to 250°C at a rate of 5°C / min, held for 10 min, and a total run time of 20 min. The injection port and detector temperatures were 280°C and 280°C, respectively. The split ratio was 20:1, and the injection volume was 1 μL.

[0045] Compared with the prior art, the beneficial technical effects of the present invention are:

[0046] The lipase described in the present invention has good activity, high thermal stability, and strong substrate tolerance. It can directly catalyze the reaction of n-heptanoic acid with hydrogen peroxide to form a peracid, which is then epoxidized to methyl oleate to synthesize methyl epoxystearate. This avoids the complex reaction system and expensive reagents required in chemical synthesis and is more environmentally friendly. Compared to other reported methods for synthesizing epoxidized fatty acid esters, the preparation of methyl epoxystearate using the present invention offers advantages such as mild conditions, no substrate pretreatment, environmental friendliness, and the potential for industrial scale-up, suggesting promising prospects for industrial application and development. DETAILED DESCRIPTION

[0047] The present invention is described in detail below with reference to specific embodiments.

[0048] Example 1 Screening of lipase

[0049] Using the amino acid sequence of the lipase Candida antarctica lipase (CaL, accession number: BBC47797) as a probe, a BLAST analysis was performed against the NCBI database. Sequences with less than 80% similarity to the probe sequence were screened and a phylogenetic tree constructed after multiple sequence alignment. Twenty candidate enzymes were selected. Recombinant plasmids encoding the corresponding lipases were obtained by PCR or synthetic synthesis and transformed into Escherichia coli to generate the corresponding recombinant strains. The strains were inoculated into test tubes containing 4 mL of LB medium and cultured in a shaker at 37°C at 200 rpm for 12 hours. Then, 1 mL of the culture was transferred to a shake flask containing 100 mL of LB medium for induction. After 24 hours, the cells were collected using a large centrifuge. The cells were resuspended in 10 mL of Tris-HCl buffer (100 mM, pH 8.0) and ultrasonically disrupted in an ice-water bath at 30% power for 15 min to obtain a crude enzyme solution, which was then freeze-dried in a -50°C freeze dryer for 72 h.

[0050] The activity of the lyophilized enzyme powder towards methyl oleate was verified by a biocatalytic reaction. A 0.5 mL reaction system contained methyl oleate at a final concentration of 10 mM, 0.05 mM stearic acid, 5 μL of a 30% H₂O₂ solution, and an appropriate concentration of lyophilized enzyme powder. The reaction was shaken at 30°C and 1000 rpm for 12 hours. After completion, the reaction was centrifuged at 10,000 × g for 2 minutes and analyzed by gas chromatography. The reaction results were used to determine whether the screened enzyme had epoxidation activity towards methyl oleate. The results are shown in Table 1.

[0051] Table 1 Comparison of carnosine hydrolysis activity of different strains

[0052]

[0053]

[0054] Note: CaL is the probe sequence; "++" indicates that the hydrolysis activity is higher than that of the probe; "+" indicates that the hydrolysis activity is lower than that of the probe, but there is epoxidation activity towards methyl oleate; "-" indicates that no epoxidation activity towards methyl oleate was detected.

[0055] Example 2 Preparation of recombinant lipase TiL

[0056] The gene encoding the lipase TiL screened in Example 1 was amplified using the polymerase chain reaction technique using the forward primer 5'-GGATCCGAATTCATGAGGTTACAC-3' and the reverse primer 5'-TGGTGGTGCTCGAGTGCGGCCG-3'. The obtained amplified coding DNA fragment was double-digested with restriction endonucleases EcoR I and Xho I and ligated with the pET-28a plasmid that had also been double-digested with EcoR I and Xho I to obtain the recombinant plasmid pET-28a-TiL.

[0057] The obtained recombinant plasmid was transformed into E. coli BL21, and the constructed recombinant strain was inoculated into a test tube containing 4 mL of culture medium. After shaking and culturing at 37°C for 12 hours, 1 mL of the bacterial solution was transferred to a shake flask containing 100 mL of LB medium. After culturing at 37°C for 3 hours, IPTG was added, and the culture was induced at 16°C for 24 hours. The cells were collected by centrifugation. The cells were resuspended in 10 mL of Tris-HCl buffer (100 mM, pH 8.0) and ultrasonically disrupted in an ice-water bath at 30% power for 15 minutes to obtain a crude enzyme solution. The crude enzyme solution was centrifuged and freeze-dried in a -50°C freeze dryer for 72 hours to obtain freeze-dried enzyme powder.

[0058] Example 3 Effects of different chain length saturated carboxylic acids on the activity of lipase TiL

[0059] Take 5mg of freeze-dried enzyme powder and add it into 500μL containing 1mM of different carbon chain lengths (C6-C 18 ) linear saturated carboxylic acid, 10 mM methyl oleate, and 5 μL of a 30% H₂O₂ solution in toluene were used for the synthesis reaction. The reaction was shaken at 30°C for 12 h, followed by GC analysis. The results are shown in Table 2. The enzyme exhibited the highest activity when using n-heptanoic acid as an oxygen carrier.

[0060] Table 2 Effects of different chain length fatty acids on the chemical-enzymatic synthesis of methyl epoxystearate

[0061]

[0062]

[0063] Example 4 Effect of n-heptanoic acid concentration on lipase TiL activity

[0064] The synthesis reaction was performed by adding 5 mg of lyophilized enzyme powder to 500 μL of a toluene solution containing varying concentrations of heptanoic acid (0.2 mM to 20 mM), 10 mM methyl oleate, and 5 μL of 30% H₂O₂. The reaction was shaken at 30°C for 12 hours and analyzed by GC. The results are shown in Table 3. The enzyme exhibited peak activity at a heptanoic acid concentration of 1 mM.

[0065] Table 3 Effect of different concentrations of n-heptanoic acid on conversion rate

[0066]

[0067] Example 5 Effect of Temperature on Lipase TiL Activity

[0068] At various temperatures (30-70°C), 5 mg of lyophilized enzyme powder was added to 500 μL of a toluene solution containing 10 mM methyl oleate, 1 mM heptanoic acid, and 5 μL of 30% H₂O₂. The reaction was shaken for 12 hours and analyzed by GC. The results are shown in Table 4. The enzyme exhibited maximum activity at 50°C. The activity under this oxygen carrier was defined as 100%, and relative activity under other oxygen carriers was calculated. Enzyme activity increased with increasing temperature below 50°C, but decreased above 50°C.

[0069] Table 4 Effect of reaction temperature on enzyme activity and conversion rate

[0070]

[0071] Example 6 Effect of Hydrogen Peroxide Amount on Reaction Conversion

[0072] The synthesis reaction was carried out by adding 5 mg of lyophilized enzyme powder to 500 μL of a toluene solution containing 10 mM methyl oleate, 1 mM n-heptanoic acid, and 2-40 μL of 30% H₂O₂. The reaction was shaken for 12 hours and analyzed by GC. The results are shown in Table 5. The highest conversion rate was achieved when the H₂O₂ dosage was 10 μL / mL. Further increases in the amount of hydrogen peroxide did not significantly increase the conversion rate.

[0073] Table 5 Effect of reaction temperature on enzyme activity and conversion rate

[0074]

[0075] Example 7: 10 mL scale-up reaction for the synthesis of methyl epoxystearate catalyzed by lipase TiL

[0076] The synthesis of methyl epoxystearate was carried out in a 50 mL Erlenmeyer flask containing 10 mM methyl oleate, 1 mM n-heptanoic acid, 50 μL of a 30% H₂O₂ solution in toluene, and 100 mg of lyophilized TiL lipase powder. The reaction was carried out at 50°C with shaking at 200°C, with samples taken intermittently during the reaction for GC analysis. After 12 hours of reaction, a conversion of 87.4% was achieved using TiL as the catalyst.

[0077] Example 8 Activity modification of lipase TiL

[0078] The structural model of lipase TiL was constructed using AlphaFold and docked with the substrate molecule. Five amino acid residues were selected within the range as targets for site-directed saturation mutagenesis. By designing a degenerate NNK codon, site-directed saturation mutagenesis was performed on the target site. Mutants were cultured in deep-well plates, shaken overnight at 37°C, and 50 μL was transferred to a secondary deep-well plate containing 600 μL. After shaking and incubating at 37°C for 3 hours, IPTG was added to induce the cells at a final concentration of 0.2 mM and cultured at 16°C for 24 hours. The cells were then harvested by centrifugation, broken up by the addition of lysozyme, and 10 μL of the enzyme solution was taken and mixed with 100 μL of a substrate solution containing 100 mM potassium phosphate buffer (pH 7.0) and 100 mM p-nitrophenolhexanoate for a synthesis reaction. Preliminary screening was performed by detecting the increase in absorbance at 405 nm using an ELISA plate. It was found that the activity of the eight mutants was increased compared to that of the parent TiL. These eight mutants were cultured, purified, and their catalytic activity in the synthesis of methyl epoxystearate was measured. Mutants at positions 63, 131, and 265 showed significant improvements in the activity of methyl epoxystearate. Combinations of these three mutation sites were performed, and the results are shown in Table 6. The sequence numbers in Table 6 correspond to the series of sequences following Table 6. In the activity column, a single plus sign ("+") indicates a 1.1- to 2-fold increase in activity compared to the parent TiL mutant; two plus signs ("++") indicate a 2- to 4-fold increase in activity.

[0079] Table 6 Lipase TiL mutant sequences and synthetic activity improvement list

[0080]

[0081] The amino acid sequences of the TiL mutants corresponding to the numbers in the table are as follows:

[0082] (1) replacing proline at position 63 of the amino acid sequence shown in SEQ ID No. 2 with glutamine;

[0083] (2) replacing the leucine at position 131 of the amino acid sequence shown in SEQ ID No. 2 with serine;

[0084] (3) replacing tyrosine at position 265 of the amino acid sequence shown in SEQ ID No. 2 with glycine;

[0085] (4) replacing the proline at position 63 of the amino acid sequence shown in SEQ ID No. 2 with glutamine, and replacing the tyrosine at position 265 with glycine;

[0086] (5) the leucine at position 131 of the amino acid sequence shown in SEQ ID No. 2 is replaced by serine, and the tyrosine at position 265 is replaced by glycine;

[0087] Example 9 Lipase TiL M5 Catalytic Amplification of the Synthesis of Methyl Epoxystearate

[0088] The synthesis of methyl epoxystearate was carried out in a 50 mL conical flask containing 20 mM methyl oleate, 1 mM heptanoic acid, 100 μL of a 30% H₂O₂ solution in toluene, and 100 mg of lyophilized TiL lipase powder. The reaction was carried out at 50°C and shaken at 200°C. Samples were taken intermittently during the reaction and analyzed by GC. The reaction lasted 12 h. TiL M5 When used as a catalyst, the conversion rate reached 92.3%.

[0089] The sequences involved in the present invention are as follows:

[0090] SEQ ID No.1

[0091] ATGAGGTTACACTTCCTATCATTTGCTACAGTGATCAGCGCGATTTCGATC

[0092] TCCGTCTCCCACGCCGCTGTGGTACCGGTTTCA

[0093] GCCCCACCGACAAGCGATCCGGCATTCGTTACCCCACAAGCGACCCTGG

[0094] ATGCTAATATTAAATGCCCGGGGACCAAAGGTGGTTATGCG

[0095] GCGGTGTCCAATCCGATTTTGTTGGTTCCAGGTACGGGCAACACCGGTA

[0096] GCGAATCGTTCGATTCCACGTACGTGATTCTGACTCGCAAC

[0097] CTGGGCTACCAGCCGTGTTATATCTCTCCGCCGCCGTTCATGCTGAACGA

[0098] TAGCCAAATCAACGCGGAGTATGTTGTAAACGCAGTTTCT

[0099] CGTTTAAATCAGGCAGCGGGCAAGAAAATCCCGGTTCTGGGCTGGTCGC

[0100] AAGGTAACCTGATCATTCAGTGGGCACTCACCTTTTTCCCG

[0101] AGCACCGTTCAAAAAACCGATCGTTTTGTTTCTTTCGCTGGCGACTTCCG

[0102] TGGTACGTTTCTGGCATACCTGCTGGACGCCCAGCCGCTG

[0103] GGTATTGCACCGTCCGTGTGGCAACAAAGCACCCTGAGCGCGTATCTGA

[0104] CTGCGCTGCGCAACGCTGGCGGTTTAACTGCCAAGGTGCCG

[0105] ACCACCTCTATTTATAGCGTGACGGACGAAATCGTGCAGCCGCAGATCGG

[0106] TGGCCCAGCGTTGGAGAGCTCCTACTTGTTCGGTGACATG

[0107] GCAATGAACGTGAAGGTGCAGGATTACTGCCCGTTATTGATCGTTGAGCA

[0108] TAGCCAACAGCTTTTCAATATCTTTACCTACAGCGTGGCA

[0109] AAAGCGGCGTTGCAATCCCCGACCGGTAAGGCGGAGGCGGGCAGCTTC

[0110] AGCTCGGCTAAGTGCAGCCTGGCGTTTCCGCCGGGTTTGGGC

[0111] CTGGGTGACCAGCTGGTCGCCCCTACCATTATTACCCAGGCGGCGGTGC

[0112] ACATTGTGGCCGGCCCGCGTGTTGCGTGTGAACCGCCTTTG

[0113] CTGCCGTATGCGGTTAAATACTACCCGTTTGCGAAGCAGGCGTGCAATCC

[0114] GCTGACGCAGGTTGTGGACGGCTTTGTCCCGCAAAACCCCG

[0115] GAACAGCTGAACAGCTTCGAGGCTATTACCGTTTATATCCTGACCAGAAGCCTGCGTAACATCCTTGGTACCGCTGGTAAGTAA

[0116] SEQ ID No.2

[0117] MRLHFLSFAT VISAISISVS HAAVVPVSAP PTSDPAFVTP QATLDANIKCPGTKGGYAAV

[0118] SNPILLVPGT GNTGSESFDS TYVILTRNLG YQPCYISPPP FMLNDSQINAEYVVNAVSRL

[0119] NQAAGKKIPV LGWSQGNLII QWALTFFPST VQKTDRFVSF AGDFRGTFLAYLLDAQPLGI

[0120] APSVWQQSTL SAYLTALRNA GGLTAKVPTT SIYSVTDEIV QPQIGGPALE SSYLFGDMAM

[0121] NVKVQDYCPL LIVEHSQQLF NIFTYSVAKA ALQSPTGKAE AGSFSSAKCS LAFPPGLGLG

[0122] DQLVAPTIIT QAAVHIVAGP RVACEPPLLP YAVKYYPFAK QACNPLTQVVDGFVPQTPEQ

[0123] LNSFEAITVY ILTRSLRNIL GTAGK

[0124] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.

Claims

1. A lipase mutant, characterized in that: The amino acid sequence of the lipase mutant is shown below: (1) replacing tyrosine at position 265 of the amino acid sequence shown in SEQ ID No. 2 with glycine; (2) The leucine at position 131 of the amino acid sequence shown in SEQ ID No. 2 was replaced by serine, and the tyrosine at position 265 was replaced by glycine.

2. An isolated nucleic acid, characterized in that The nucleic acid encodes the lipase mutant according to claim 1.

3. A recombinant expression vector, characterized in that: Comprising the nucleic acid according to claim 2.

4. A recombinant expression transformant, characterized in that: Comprising the recombinant expression vector according to claim 3.

5. A method for preparing the lipase mutant according to claim 1, characterized in that: The method comprises the following steps: culturing the recombinant expression transformant according to claim 4, and isolating and obtaining the recombinantly expressed lipase.

6. Use of lipase or the lipase mutant according to claim 1 to catalyze the preparation of methyl epoxystearate from methyl oleate and hydrogen peroxide, characterized in that: The amino acid sequence of the lipase is shown in SEQ ID No.

2.

7. The use according to claim 6, characterized in that The following steps are involved: (1) using the lipase or the lipase mutant according to claim 1 to catalyze the reaction of hydrogen peroxide and carboxylic acid to generate peroxycarboxylic acid; (2) Peroxycarboxylic acid reacts with methyl oleate to form methyl epoxy stearate.

8. The use according to claim 7, characterized in that The carbon chain length of the carboxylic acid is 4-18.

9. The use according to claim 7, characterized in that The reaction temperature is 30-70°C, the molar ratio of carboxylic acid to methyl oleate is 1:100-1:5, the enzyme dosage is 1-50 g / L, and the amount of H2O2 added is 10-30 μL / mL.

Images