A method of molecular detection
By manipulating tandem nucleic acid probes using multi-channel single-molecule mechanical techniques and utilizing probe length changes to detect analytes, the problems of low-concentration detection sensitivity and false positives in complex samples are solved, enabling efficient simultaneous detection of multiple analytes and identification of single-base mutations.
Patent Information
- Application Number
- CN202310992413.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-08
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2043-08-08
AI Technical Summary
Existing molecular detection technologies lack sensitivity and have limited binding speed when detecting low concentrations of analytes, making it difficult to distinguish between multiple analytes. They are also prone to false positives in complex samples, especially when detecting nucleic acid mutations, particularly single-base mutations.
This method employs multi-channel single-molecule mechanical technology to simultaneously manipulate multiple tandem nucleic acid probes. Probes are prepared through rolling circle amplification and rolling circle transcription. The difference in probe length or the length change curve is used as the signal intensity. Detection is performed using multi-channel single-molecule mechanical technology, including applying tension and detection force using a carrier and recording length changes to identify the analyte.
It improves detection sensitivity, enabling simultaneous detection of multiple analytes, differentiation of multiple bound analytes, and reduction of false positives, achieving accurate detection in complex samples and identification of single-base mutations.
Smart Images

Figure CN117126923B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and new medical technology, and in particular relates to a molecular detection method. Background Technology
[0002] Nucleic acid probes are a class of molecular probes composed of nucleic acid molecules or nucleic acid-like molecules. They can specifically sense the analyte in the test component through a specific molecular recognition mechanism and convert the molecular recognition event into a fluorescent signal or other electrochemical signal through a specific signal transduction method.
[0003] Single-molecule mechanical manipulation is a technique used to study the structure and interactions of biomolecules such as proteins and nucleic acids, and it can be used for molecular detection. Compared with traditional methods, single-molecule manipulation techniques, such as optical tweezers, acoustic tweezers, magnetic tweezers, and fluid manipulation, can use the magnitude of the applied pulling force or the extension length of the probe molecule as a recognition signal, thus eliminating the need for signal transduction methods such as quantitative fluorescence. This avoids the need for signal output structural domains in probe design and greatly reduces the complexity of probe design. On the other hand, measurements of a single molecule can theoretically achieve the detection of a single analyte, representing the ultimate solution to the insufficient sensitivity of classic nucleic acid probes.
[0004] However, due to limitations in molecular diffusion rates, the binding rate between the analyte and the single-molecule probe is restricted, resulting in lengthy detection times for very low concentrations of analytes, significantly reducing detection sensitivity. Furthermore, improving detection resolution, distinguishing between multiple analytes bound to nucleic acid probes, simultaneously detecting multiple analytes, detecting the binding rate, intensity, and concentration of analytes, correctly detecting analytes against the background signal of biological or clinical samples, avoiding false positives, and detecting mutations in the nucleic acid of analytes, especially single-base mutations, are all technical challenges that need to be addressed. Summary of the Invention
[0005] To address the aforementioned technical challenges, this invention provides a molecular detection method that uses multi-channel single-molecule mechanics to simultaneously manipulate multiple molecular probes to detect analytes, enabling the simultaneous detection of multiple analytes in complex samples.
[0006] The molecular detection method provided by this invention uses multi-channel single-molecule mechanics technology to simultaneously manipulate multiple molecular probes to detect analytes; the two ends of the molecular probes are connected to a carrier through labeled coupling functional groups; the carrier is used to apply tension to the molecular probes.
[0007] Based on the above technical solution, the molecular probe is a tandem nucleic acid probe, and the monomer of the tandem nucleic acid probe contains the target sequence. Under a certain range of tension, the target sequence can form a specific structure that binds to the analyte. The tandem nucleic acid probe is prepared by rolling circle amplification or rolling circle transcription. This method can detect the presence of the analyte, its concentration, and the binding rate and strength between the analyte and the specific structure by using the difference in molecular probe length or the difference in length change curves as signal intensity. The tandem nucleic acid probe increases the number of specific structures, thereby improving the detection sensitivity.
[0008] Based on the above technical solution, rolling circle amplification includes the following steps:
[0009] Initiation of rolling circle amplification (RoBAM): Requires RoBAM primers, DNA polymerase, and a RoBAM template; the RoBAM template contains complementary sequences to the initiation and target sequences; the initiation sequence can bind to the RoBAM primers;
[0010] Rolling circle amplification extension: using all the necessary nucleotides as substrates and continuously amplifying for a period of time according to the required degree of polymerization of the tandem nucleic acid probe.
[0011] Based on the above technical solution, rolling circle transcription includes the following steps:
[0012] Initiation of rolling circle transcription: requires RNA polymerase and a rolling circle transcription template; the rolling circle transcription template contains complementary sequences to the initiator and target sequences; the initiator sequence is the sequence that binds to RNA polymerase; in this step, the newly generated RNA transcripts are labeled with coupling functional groups;
[0013] Extended rolling circle transcription: Transcription continues for a period of time using all the necessary nucleotides as substrates and according to the required degree of polymerization of the tandem nucleic acid probes.
[0014] Based on the above technical solution, the extension steps are performed while the carrier is fixed.
[0015] Based on the above technical solutions, rolling circle amplification or rolling circle transcription includes a pause and restart process.
[0016] Based on the above technical solution, if the rolling circle amplification or rolling circle transcription reaction reagent lacks at least one of the necessary nucleotide substrates, the polymerase will pause when it needs to use the missing nucleotide substrate.
[0017] Based on the above technical solution, the detection process using multi-channel single-molecule mechanical technology includes binding force and detection force: under the binding force, the target sequence forms a specific structure that can bind to the analyte; under the detection force, the analyte is detected.
[0018] When the detection force is constant, the length of the tandem nucleic acid probe without analyte is recorded as the baseline length. After the binding force is changed to the detection force, the difference between the length of the tandem nucleic acid probe and the baseline length is calculated as the signal intensity.
[0019] When the detection force is gradually increased, the length change curve of the tandem nucleic acid probe without analyte is recorded as a baseline curve. During sample detection, the difference between the length change curve of the tandem nucleic acid probe and the baseline curve under the detection force is calculated as the signal intensity.
[0020] The presence of the analyte in the sample, the concentration of the analyte, the binding strength of the analyte with the specific structure, and the binding rate are all determined by the signal intensity.
[0021] Based on the above technical solution, the degree of polymerization of the multiple tandem nucleic acid probes is uniform; the uniformity standard is that the root mean square deviation of the degree of polymerization is less than 20% of the average degree of polymerization.
[0022] Based on the above technical solution, the molecular detection includes: simultaneously manipulating a group of multiple tandem nucleic acid probes, wherein the target sequence of each tandem nucleic acid probe in the group is a sequence for identifying sequence polymorphism.
[0023] Specific structures are defined by their ability to bind to the analyte, and include, but are not limited to, single-stranded DNA or single-stranded RNA, hairpin structures, double-stranded structures, nano-origami, aptamers, G4, i-motif, and triple-stranded nucleic acid structures. Specific structures may be unfolded structures formed by the target sequence under significant tension, or they may be folded structures formed by the target sequence under relatively small tension.
[0024] This invention combines tandem nucleic acid probes with multichannel single-molecule mechanics technology, simultaneously manipulating multiple tandem nucleic acid probes. Utilizing the differences in length or length change curves of the tandem nucleic acid probes under different binding conditions with the analyte, the following detection results are obtained: (i) the presence of the analyte; (ii) the concentration of the analyte; (iii) the binding strength between the analyte and the nucleic acid probe; (iv) the binding rate between the analyte and the nucleic acid probe; (v) improving the detection resolution of the analyte; (vi) distinguishing multiple analytes bound to the nucleic acid probe; (vii) simultaneously detecting multiple analytes; (viii) correctly detecting the analyte in the background signal of biological or clinical samples; (ix) avoiding false positives by using multiple probes as controls; and (x) detecting mutations in the nucleic acid analyte, especially single-base mutations.
[0025] The method for synthesizing multiple tandem nucleic acid probes according to the present invention is as follows:
[0026] Tandem nucleic acid probes can be synthesized via rolling circle amplification or rolling circle transcription. Both ends of the probe are coupled to a vector. The vector's role is to apply tension to the probe.
[0027] Preferably, the carrier can be a flow cell or microspheres.
[0028] Multiple probes can be manipulated simultaneously using multichannel single-molecule mechanics techniques.
[0029] Preferably, the multichannel single-molecule mechanical technique is magnetic tweezers.
[0030] The degree of aggregation of multiple tandem nucleic acid probes measured in parallel is uniform.
[0031] Preferably, the standard for uniformity is that the root mean square deviation of the degree of polymerization is less than 20% of the average degree of polymerization.
[0032] The degree of polymerization of the tandem nucleic acid probe is greater than 500.
[0033] The uniformity of tandem nucleic acid probe polymerization can be improved by pausing and restarting the reaction after initiation. This pausing and restarting process can be achieved by assembling rolling circle amplification or rolling circle transcription complexes at low temperatures, where polymerase activity is extremely low, allowing simultaneous initiation once the reaction system returns to the reaction temperature. Alternatively, polymerase inhibitors can be used to suppress amplification or transcription activity after rolling circle amplification or transcription initiation, allowing simultaneous initiation after inhibitor removal. In the embodiments of this invention, the pausing and restarting process is specifically implemented by depriving at least one essential nucleotide in the reaction substrate of the loop amplification or rolling circle transcription initiation step.
[0034] The monomer of the tandem nucleic acid probe contains a sequence forming a hairpin structure, with the target sequence located in the stem region of the hairpin structure. Under binding force, the hairpin structure opens into a single strand, exposing the target sequence. The single-stranded target sequence can bind to the analyte.
[0035] The specific preparation method of the tandem nucleic acid probe is as follows:
[0036] 1. Synthesis of tandem nucleic acid probes via rolling circle amplification
[0037] When synthesizing tandem nucleic acid probes via rolling circle amplification, the rolling circle amplification process can be performed in situ on a vector or in solution. Compared to solution-based synthesis, in-situ synthesis has the following advantages: firstly, it facilitates the replacement of reaction reagents; secondly, since there is no mutual interference between the rolling circle amplification complexes during the synthesis process, it can prevent entanglement between newly synthesized probe molecules, which would affect the structural integrity of the probe molecules, and it also helps to synthesize probes with higher degrees of polymerization.
[0038] The technical details of in situ synthesis of tandem nucleic acid probes via rolling circle amplification are as follows:
[0039] Technical detail one: Through a coupling reaction, the rolling circle amplification primers are coupled to the vector via coupling functional group 1.
[0040] Preferably, the carrier is a flow cell or microspheres.
[0041] The coupling of rolling circle amplification primers to flow cells or microspheres can be either covalent or affinity-linked.
[0042] Preferably, the coupling functional group 1 of the rolling circle amplification primer is a thiol group, and the modification is located at the 5' end of the primer sequence, which can be linked to the SMCC-modified flow cell or microsphere.
[0043] Preferably, the rolling circle amplification primers are attached to the surface of the flow cell modified with SMCC.
[0044] Rolling circle amplification primers can be designed based on probe sequences and can bind to the initiation sequence in the rolling circle amplification template.
[0045] Preferably, the rolling circle amplification primers used in the examples are all SH_hp.
[0046] Technical detail two: A closed-structure circular rolling circle amplification template is prepared through an enzyme ligation reaction.
[0047] The closed-structure circular amplification template contains complementary sequences to the initiator and target sequences. The initiator sequence is a sequence that can bind to rolling circle amplification primers; the target sequence can form a specific structure that binds to the analyte.
[0048] Preferably, the target sequence is located in the stem region of the probe hairpin structure.
[0049] The closed-structure circular rolling circle amplification template can be formed by linking two single-stranded nucleic acids with sticky ends using a ligase; or it can be formed by linking a single-stranded nucleic acid end-to-end using a ligase in the presence of bridging DNA.
[0050] Preferably, the rolling circle amplification templates in the embodiments are formed by linking two single-stranded DNA strands with sticky ends using a ligase.
[0051] Preferably, the ligase is a commercially available T4 DNA ligase.
[0052] Preferably, the sticky end has a length of 6 bases.
[0053] Preferably, the 5' ends of the sticky ends are all phosphorylated. The phosphorylation modification at the 5' ends can be added during artificial synthesis or by using a polynucleotide phosphorylase.
[0054] Preferably, the phosphorylation modification at the 5' end is added during artificial synthesis.
[0055] The sequence of the rolling circle amplification template can be designed based on the analyte.
[0056] Preferably, the two hairpin structures used in the embodiment are T1 and T2. Hairpin structure T1 contains a activation sequence, and hairpin structure T2 contains a target sequence complementary sequence.
[0057] Technical detail three: Synthesize tandem nucleic acid probes through rolling circle amplification.
[0058] Preferably, the DNA polymerase used in the rolling circle amplification process is an isothermal polymerase.
[0059] Preferably, the isothermal polymerase is a commercially available phi29 DNA polymerase.
[0060] Preferably, the reaction temperature during the rolling ring amplification is 30°C.
[0061] The nucleotide substrates used in the rolling circle amplification extension step can be modified nucleotide substrates, such as methylated dATP or dCTP, or unmodified nucleotide substrates.
[0062] Preferably, the nucleotide substrate used in the rolling circle amplification extension step is an unmodified dNTP.
[0063] In this invention, the tandem nucleic acid probe synthesized by rolling circle amplification has a coupling functional group 2 at its 3' end, and the labeling of the coupling functional group 2 can be achieved by DNA polymerase or terminal transferase.
[0064] Preferably, the labeling of the 3' end coupling functional group 2 is achieved by incorporating a certain proportion of a dNTP modified with coupling functional group 2 after rolling circle amplification extension.
[0065] Preferably, the dNTP modified with coupling functional group 2 is a biotin-labeled dUTP.
[0066] Preferably, the incorporation ratio of biotin-labeled dUTP is 1:9 of the ratio of biotin-labeled dUTP to unlabeled dTTP.
[0067] The 3' end of the probe is attached to the vector via coupling functional group 2.
[0068] Preferably, the carrier is a flow cell or a microsphere. Therefore, both ends of the probe are connected to the flow cell or the microsphere, respectively.
[0069] Technical detail four: By synchronizing the rolling circle amplification process, the degree of polymerization of the synthesized multiple tandem nucleic acid probes can be made relatively uniform.
[0070] Rolling circle amplification also includes the process of starting rolling circle amplification, pausing amplification, and then restarting it.
[0071] In this invention, the rolling circle amplification (RoBA) process is synchronized by adding a defective substrate to the reaction reagents in the initial step of the RoBA. The defective substrate lacks at least one of the nucleotide substrates essential for RoBA, thus causing the DNA polymerase to pause its activity when the missing nucleotide substrate is required.
[0072] Preferably, the defective substrate lacks a dNTP nucleotide substrate.
[0073] Preferably, the dNTP nucleotide substrate is dTTP.
[0074] When synthesizing tandem nucleic acid probes via rolling circle amplification, the rolling circle amplification process can also be performed in solution. The technical differences compared to in-situ rolling circle amplification on a vector surface are as follows:
[0075] One of the differences in technical details is that rolling circle amplification extension is not performed on a vector.
[0076] The second difference in technical details is that, during the synchronized rolling circle amplification process, the DNA polymerase needs to be paused to recover the rolling circle amplification complex.
[0077] 2. Synthesis of tandem nucleic acid probes via rolling circle transcription
[0078] When synthesizing tandem nucleic acid probes via rolling circle transcription, the rolling circle transcription process can be carried out in situ on a vector or in solution. Compared to solution-based synthesis, in situ synthesis has the following advantages: firstly, it facilitates the replacement of reaction reagents; secondly, since there is no mutual interference between the rolling circle transcription complexes during the synthesis process, it can prevent entanglement between newly synthesized probe molecules, which would affect the structural integrity of the probe molecules, and it also helps to synthesize probes with higher degrees of polymerization.
[0079] The technical details of in situ synthesis of tandem nucleic acid probes via rolling circle transcription are as follows:
[0080] Technical detail one: A closed-structure circular rolling-circle transcription template is synthesized through enzyme ligation and annealing reactions. This closed-structure circular rolling-circle transcription template contains complementary sequences to the promoter and target sequences. The promoter sequence is a double-stranded structure that can bind to RNA polymerase.
[0081] The enzyme ligation reaction can be formed by linking two single-stranded nucleic acids with sticky ends using a ligase, or it can be formed by linking a single-stranded nucleic acid end-to-end using a ligase in the presence of bridging DNA.
[0082] Preferably, in the embodiments, the rolling circle transcription template is formed by linking a single-stranded nucleic acid end-to-end with a ligase in the presence of bridging DNA.
[0083] Preferably, the bridging DNA is Bridge1, and the ligase is a commercially available T4 DNA ligase.
[0084] The annealing reaction involves annealing the complementary sequence of the initiating sequence on the ligated circular single-stranded template to form a circular rolling circle transcription template with a local double-stranded structure.
[0085] Preferably, the complementary sequence of the initiation sequence is T7_C.
[0086] The sequence of a closed-structure circular rolling loop transcription template can be designed based on the type of RNA polymerase and the analyte.
[0087] Preferably, in the embodiments, the promoter sequence of the rolling circle transcription template is a T7 promoter sequence, and the RNA polymerase is a T7 RNA polymerase.
[0088] The target sequence of a closed-structure circular rolling loop transcription template is a sequence that can fold into a hairpin structure, or a G-quadruplex structure, aptamer structure, nanoorigami structure, drug target-specific structure, etc.
[0089] The single-stranded nucleic acid is T3.
[0090] Preferably, T3 is T3_G4. The 5' end of T3_G4 is phosphorylated. The 5' end phosphorylation modification can be added during artificial synthesis or modified using a polynucleotide phosphorylase.
[0091] Preferably, the phosphorylation modification at the 5' end is added during artificial synthesis.
[0092] Technical detail 2: Multiple tandem nucleic acid probes with a certain degree of polymerization are synthesized through in-situ rolling circle transcription on a vector. The tandem nucleic acid probes have a coupling functional group 3 at the 5' end and a coupling functional group 4 at the 3' end.
[0093] In this invention, the tandem nucleic acid probe synthesized by rolling circle transcription has a 5' coupled functional group 3 that is labeled by introducing a substrate modified with the coupled functional group 3 during the initiation step of rolling circle transcription.
[0094] Preferably, the coupling functional group 3 is digoxigenin, and the substrate modified by the coupling functional group 3 is a digoxigenin-labeled UTP, which is introduced into the nascent transcript at the initiation step of rolling circle transcription, so that the 5' end of the tandem nucleic acid probe is labeled with digoxigenin.
[0095] Following rolling circle transcription initiation, the nascent digoxigenin-labeled RNA transcripts and the complex formed by the rolling circle transcription complex were purified. The purified complex was then coupled to a vector via a coupling reaction.
[0096] Preferably, the carrier is a flow cell, and the flow cell is modified with digoxin antibody.
[0097] The addition of various nucleotide substrates necessary for rolling circle transcription allows the transcription reaction to continue, and transcription continues for a period of time depending on the required degree of polymerization of the tandem nucleic acid probe. The various nucleotide substrates necessary for the elongation step of rolling circle transcription can be modified nucleotides, such as methylated ATP or methylated CTP, or unmodified nucleotides.
[0098] Preferably, the various nucleotide substrates required for the elongation step of the rolling circle transcription are unmodified nucleotides.
[0099] In this invention, the tandem nucleic acid probe synthesized by rolling circle transcription can have its 3' end coupled with functional group 4 modified by RNA polymerase or terminal transferase.
[0100] Preferably, the 3'-terminal coupling functional group 4 is achieved by incorporating a certain proportion of a nucleotide substrate modified with coupling functional group 4 after rolling circle transcription elongation.
[0101] Preferably, the nucleotide substrate modified with coupling functional group 4 is a biotin-labeled UTP.
[0102] Preferably, the incorporation ratio of the biotin-labeled UTP is 1:9 of the ratio of biotin-labeled UTP to unlabeled UTP.
[0103] Technical detail three: By synchronizing the rolling circle transcription process, the degree of polymerization of the synthesized multiple tandem nuclear probes is made relatively uniform.
[0104] Preferably, relatively uniform degree of polymerization means that the standard deviation of the degree of polymerization is less than 20% of the average degree of polymerization.
[0105] In this invention, the rolling circle transcription process is synchronized by adding a defective substrate to the reaction reagent in the rolling circle transcription initiation step. The defective substrate lacks at least one of the nucleotide substrates essential for rolling circle transcription; therefore, the RNA polymerase pauses its activity when it needs to use the missing nucleotide substrate.
[0106] Preferably, the defective substrate lacks one NTP nucleotide substrate.
[0107] Preferably, the missing NTP nucleotide substrate is GTP.
[0108] When synthesizing tandem nucleic acid probes via rolling circle transcription, all steps of the rolling circle transcription process can be performed in solution. The key difference in technical details compared to in situ rolling circle transcription on a vector lies in the fact that, prior to the extension step of rolling circle transcription, the nascent RNA transcript and the complex formed by the rolling circle transcription complex are purified and do not need to be pre-coupled to the vector.
[0109] Secondly, single-molecule mechanical testing.
[0110] This invention utilizes multiple tandemly prepared nucleic acid probes combined with multichannel single-molecule mechanical techniques for molecular detection. The multichannel single-molecule mechanical techniques that can be used include single-molecule magnetic tweezers, multichannel optical tweezers, single-molecule acoustic tweezers, hydrodynamic techniques, etc.
[0111] Preferably, the multi-channel single-molecule mechanical technique used is single-molecule magnetic tweezers. Its technical details are as follows:
[0112] Technical detail one: Through a coupling reaction, the two ends of the tandem nucleic acid probe are coupled to the flow cell and the microsphere, respectively.
[0113] Preferably, the coupling reaction refers to the coupling functional group 2 at the 3' end of a tandem nucleic acid probe synthesized by rolling circle amplification or the coupling functional group 4 at the 3' end of a tandem nucleic acid probe synthesized by rolling circle transcription being coupled to a flow cell or microsphere.
[0114] Preferably, the 3' end of the tandem nucleic acid probe is attached to the magnetic microsphere.
[0115] Preferably, the magnetic microspheres are commercially available superparamagnetic microspheres M-270 (Dynabeads) with a diameter of 2.8 micrometers, and the surface of the magnetic spheres is modified with streptavidin. The advantage of using these superparamagnetic microspheres M-270 is that they possess a uniform saturation magnetic moment, thus enabling the application of a uniform pulling force to the connected probes during simultaneous manipulation.
[0116] Technical detail two involves annealing and pairing the single strands with complementary spacer sequences to transform the non-functional spacer sequences in the tandem nucleic acid probe from single-stranded to double-stranded. These non-functional spacer sequences are those that do not participate in the detection of the analyte. The beneficial effect is increased overall rigidity of the probe molecule, reducing Brownian motion noise during the detection process.
[0117] Preferably, the tandem nucleic acid probe synthesized by rolling circle amplification has a single strand with complementary spacer sequence Flank1; the tandem nucleic acid probe synthesized by rolling circle transcription has a single strand with complementary spacer sequence Flank2.
[0118] Technical detail three: Setting up a mechanical tensile mode during the testing process. The mechanical tensile mode includes both the testing force and the bonding force.
[0119] The detection force can be constant. Under the detection force, the probe length when there is no analyte is recorded as the reference length. During sample detection, after the binding force changes to the detection force, the difference between the probe length and the reference length is calculated as the signal intensity. The presence of the analyte in the sample, the concentration of the analyte, and the binding rate and binding strength between the analyte and the specific structure are detected based on the signal intensity.
[0120] Preferably, when the signal strength is greater than 3 times the root mean square error of the background noise, it is determined that there is a test object.
[0121] Based on the above technical solution, the concentration of the analyte is calculated by pre-measuring a standard curve of the concentration of the analyte and the signal intensity, and then by using the signal intensity and the standard curve during detection.
[0122] Based on the above technical solution, different signal strengths can be obtained by using different detection forces. When the detection force is less than the binding force, the smaller the detection force when the signal strength decreases to more than three times the mean square error of the background noise, the stronger the binding. When the detection force is greater than the binding force, the larger the detection force when the signal strength decreases to more than three times the mean square error of the background noise, the stronger the binding.
[0123] The detection force can be a gradually increasing force. Under the detection force, the probe length change curve when there is no analyte is recorded as a baseline curve. During sample detection, the difference between the probe length change curve and the baseline curve under the detection force is calculated as the signal intensity. The presence of the analyte in the sample, the analyte concentration, and the binding rate and strength between the analyte and specific structures are detected based on the signal intensity.
[0124] Preferably, when the signal strength is greater than 3 times the root mean square error of the background noise, it is determined that there is a test object.
[0125] Based on the above technical solution, the concentration of the analyte is calculated by pre-measuring a standard curve of the concentration of the analyte and the signal intensity, and then by using the signal intensity and the standard curve during detection.
[0126] Based on the above technical solution, when the detection force is less than the binding force, the detection force gradually decreases. The smaller the detection force when the signal strength decreases to more than 3 times the mean square error of the background noise, the stronger the binding. When the detection force is greater than the binding force, the detection force gradually increases. The larger the detection force when the signal strength decreases to more than 3 times the mean square error of the background noise, the stronger the binding.
[0127] Based on the above technical solution, the time for maintaining the binding force, i.e., the binding time, can be changed. According to the relationship between signal intensity and binding time, the binding rate between the analyte and the specific structure can be measured under known analyte concentration conditions.
[0128] Based on the above technical solution, when using multiple probes containing different specific structures, the binding strength and binding speed between the analyte and different specific structures can be detected simultaneously.
[0129] After one round of testing is completed, a probe regeneration step can be added. In this step, the nucleic acid probe can be restored to a baseline state where it is not bound to the analyte, so that it can be used for the next round of testing.
[0130] Preferably, the tension force on the probe during the regeneration step is the regeneration force.
[0131] The force application steps in the detection process in this embodiment are as follows: detection force, recording the length or length curve of the probe when there is no analyte as a reference length or reference length curve; binding force, the target sequence on the probe forms a specific structure, identifies and binds to the analyte, the longer the time spent under the binding force, the more analytes bind to the probe, and the stronger the binding signal; detection force, recording the length or length curve of the probe after the analyte binds and calculating the difference between this length or length curve and the reference length or reference length curve as the signal intensity; regeneration force, the analyte bound to the probe is completely dissociated, and the probe returns to its initial unbound state.
[0132] III. Simultaneous measurement of multiple tandem nucleic acid probes
[0133] Multiple tandem nucleic acid probes can have identical sequences and be used to detect the same analyte. The benefits include a single measurement being equivalent to multiple measurements, saving detection time and reagents, and reducing false positives and false negatives. It also avoids parallel errors between multiple tests. Another benefit is an increased number of specific structures. For example, with a degree of polymerization of 1000, simultaneously detecting 100 probes is equivalent to increasing the number of specific structures by 100,000 times.
[0134] Multiple tandem nucleic acid probes can have different sequences. Therefore, multiple analytes can be detected simultaneously.
[0135] Preferably, the multiple tandem nucleic acid probes can simultaneously detect the nucleic acids of multiple pathogens that cause fever.
[0136] Multiple tandem nucleic acid probes can have different sequences. Therefore, it is possible to detect the binding strength and binding rate of the same analyte to different specific structures.
[0137] Multiple tandem nucleic acid probes can also have different sequences. Therefore, probes without the target sequence can be used as negative controls during the detection process. The advantage is that, when testing biological or clinical samples, negative control probes can remove background noise from irrelevant molecules in the sample.
[0138] It can simultaneously manipulate multiple nucleic acid probes in a group. The target sequences of the various nucleic acid probes within the group are sequences that identify sequence polymorphisms, and the length of the target sequences is 12-26 bases. Its advantage lies in its ability to detect base mutations in nucleic acid analytes. These mutations can be single-base mutations or multi-base mutations, and can be base transitions, base transversions, base deletions, or base insertions.
[0139] Preferably, the number of base mutations in the analyte is 1-2. The position of the mutated base on the analyte corresponds to the middle part of the probe target sequence. Attached Figure Description
[0140] Figure 1 The diagram illustrates the construction of a circular rolling circle amplification template using two single-stranded DNA strands with sticky ends via a ligation reaction. The template contains complementary sequences to the promoter and target sequences.
[0141] Figure 2 The schematic diagram illustrates the in-situ synchronized rolling circle amplification (RoBA) synthesis of tandem nucleic acid probes with uniform polymerization degree on the surface of a flow cell. ① Rolling circle amplification primers containing coupling functional group 1 are coupled to the surface of the flow cell; ② The Rolling Circle amplification template is annealed to the primers; ③ DNA polymerase and defective substrates are added to assemble the Rolling Circle amplification complex, initiating Rolling Circle amplification and then pausing; ④ The four nucleotide substrates (dNTP mix) required for Rolling Circle amplification are added, and Rolling Circle amplification is restarted and amplified for a period of time according to the required polymerization degree of the tandem nucleic acid probe; ⑤ Biotin-dUTP, a nucleotide substrate doped with coupling functional group 2, is added, and amplification continues, labeling the 3' end of the tandem nucleic acid probe with biotin; ⑥ The non-functional spacer sequence of the tandem nucleic acid probe is converted from single-stranded to double-stranded by annealing with single-stranded Flank1 complementary to the spacer sequence; ⑦ The 3' end of the tandem nucleic acid probe is attached to magnetic microspheres M-270 using biotin labeling.
[0142] Figure 3 Under a constant tensile force of 12 pN, the degree of polymerization and its uniformity of the tandem nucleic acid probe were detected, and the degree of polymerization was 1470 ± 154.
[0143] Figure 4 By repeatedly using the tandem nucleic acid probe specific to analyte N_20, the real-time length change curve of the tandem nucleic acid probe under binding force was measured in the measurement solution, 100 pM concentration of analyte N_20, and 10 nM concentration of Flank1, respectively.
[0144] Figure 5Using perfectly paired nucleic acid analytes and nucleic acid analytes with single-base mutations as examples, we verified that the binding strength between the analyte and the tandem nucleic acid probe can be measured by utilizing a gradually decreasing gradient force as the detection force. Analyte N-16 exhibits stronger binding strength compared to N-16-G9C.
[0145] Figure 6 The concentration of the analyte miR-122 in liver cancer and adjacent tissues was determined using a standard curve method. Figure A shows the relationship between the binding signal intensity of the analyte miR-122 and the specific probe and its concentration; Figure B shows the quantitative results of the analyte miR-122 in the sample.
[0146] Figure 7 The diagram illustrates how the type of each probe in a tandem nucleic acid probe set with uniform polymerization degree is determined sequentially using known analyte standards.
[0147] Figure 8 The diagram illustrates the principle of detecting base mutations in analytes using multiple tandem nucleic acid probes with uniform polymerization degree.
[0148] Figure 9 Multiple tandem nucleic acid probes with uniform polymerization degree can be used to detect and distinguish let-7 family members in serum whose sequences differ by only 1-2 bases: let-7a, let-7b, let-7c and let-7d.
[0149] Figure 10 Taking let-7b and let-7c as examples, this demonstrates that tandem nucleic acid probes and multichannel single-molecule mechanical techniques can detect rare mutations with a mutation probability as low as one in ten thousand.
[0150] Figure 11 Multiple tandem nucleic acid probes with uniform polymerization degree were used to detect novel coronavirus nucleic acid fragments in saliva and identify viral subtypes.
[0151] Figure 12 The diagram illustrates the process of using bridging DNA and ligation reactions to connect single-stranded linear DNA templates end-to-end and construct a circular rolling circle transcription template.
[0152] Figure 13The schematic diagram illustrates the in-situ synchronized rolling circle transcription synthesis of multiple tandem nucleic acid probes with uniform polymerization on the surface of a flow cell. ① A rolling circle transcription complex labeled with coupling functional group 3 and capable of synchronous extension is prepared; ② The rolling circle transcription complex is attached to the surface of the flow cell via coupling functional group 3; ③ Four nucleotide substrates NTPmix, necessary for rolling circle transcription amplification, are added, and rolling circle transcription is restarted and transcribed continuously for a period of time according to the required polymerization degree of the tandem nucleic acid probe; ④ Biotin-UTP, a nucleotide substrate doped with coupling functional group 4, is added, and transcription continues, labeling the 3' end of the tandem nucleic acid probe with biotin; ⑤ The non-functional spacer sequence in the tandem nucleic acid probe is converted from single-stranded to double-stranded by annealing with single-stranded Flank2, which is complementary to the spacer sequence; ⑥ The 3' end of the tandem nucleic acid probe is attached to magnetic microspheres M-270 via biotin labeling.
[0153] Figure 14 The schematic diagram illustrates the effect of using multiple tandem nucleic acid probes with uniform polymerization degree to measure the effect of small molecule analytes on the stability of G quadriplex structures.
[0154] Figure 15 Uniformly polymerized tandem nucleic acid probes were used to detect that the small molecule ligand PDS can significantly increase the stability of RNAG tetrad structures formed by human telomere repeat sequences. Detailed Implementation
[0155] This invention utilizes a method that can simultaneously synthesize multiple tandem nucleic acid probes to obtain multiple tandem nucleic acid probes with uniform polymerization degree, and uses these tandem nucleic acid probes combined with multi-channel single-molecule mechanical technology to design a nucleic acid detection device, which can perform multi-molecule detection simultaneously.
[0156] The features and advantages of the present invention will be further understood below through detailed description of the following embodiments in conjunction with the accompanying drawings. The provided embodiments are merely partial illustrations of the method of the present invention and do not limit the remaining content disclosed in the present invention in any way. Experimental procedures for which specific experimental conditions are not explicitly described in the embodiments shall be performed according to the operating steps in the corresponding product instructions. Unless otherwise specified, the reagents, consumables, and instruments used in the embodiments can be purchased from commercial companies.
[0157] Example 1: A circular rolling circle amplification template was constructed using two single-stranded DNA strands with sticky ends via a ligation reaction.
[0158] The specific steps are as follows:
[0159] Step 1: Design and synthesize hairpin structure templates T1 and T2_1, whose structures are as follows: Figure 1 As shown.
[0160] The sequence of template T1 is SEQ ID NO:1:
[0161] 5'-CTGGACGTCGATCGTTCGTGAAGTCAACATCGAACTCTCTTGCCAATCCTGGTCGTGATTCCATTCTATCGATGTTGACTTCACGAACGATCGAC-3';
[0162] Its ring-shaped portion after being folded into a hairpin structure contains a start-up sequence.
[0163] The sequence of template T2_1 is SEQ ID NO:2:
[0164] 5'-GTCCAGATGCATCTCAAGGTCTAGTGCTGCTTTTGCAGCACTAGACCTTGAGATGCAT-3';
[0165] The double-stranded portion after folding into a hairpin structure contains a target sequence complementary sequence.
[0166] Step 2: Folding of the hairpin structures in templates T1 and T2_1. Templates T1 and T2_1 at a concentration of 2 μM were incubated at 95 °C for 10 minutes and then rapidly cooled on ice.
[0167] Step 3: Synthesis of closed-structure single-stranded circular DNA via enzyme ligation. Equal amounts of templates T1 and T2_1, used to form the hairpin structure, are mixed and ligated using T4 DNA ligase at 4°C for 12 hours, followed by inactivation of the T4 DNA ligase at 65°C for 10 minutes.
[0168] Step four: Purify and recover the closed-structure single-stranded circular DNA. The ligation product from step three is recovered by ultrafiltration and then treated sequentially with DNA exonuclease III and DNA exonuclease I to eliminate all linear or nick-containing byproducts, obtaining a high-purity closed-structure single-stranded circular DNA as the template T_1 for rolling circle amplification.
[0169] Step 5: Polyacrylamide gel electrophoresis was performed to detect the products from steps 2, 3, and 4, respectively. The gel concentration was 8%, and electrophoresis was performed at 100V for 40 minutes. After that, the gels were soaked and stained with nucleic acid dye Gel-Red, and then imaged using the Bio-Rad gel imaging system.
[0170] Example 2: In-situ synchronized rolling circle amplification on the surface of a flow cell to synthesize tandem nucleic acid probes with uniform polymerization degree, such as... Figure 2 As shown. The specific steps are as follows:
[0171] Step one: Rolling circle amplification primers were coupled to the surface of the flow cell using thiol labeling. The preparation of the flow cell and the amination process on its surface followed classic single-molecule experimental procedures. Then, the amine-thiol crosslinking agent Sulfo-SMCC (Thermo Scientific) was added. TM The reaction was carried out under standard conditions for 30 minutes. The free amine-thiol crosslinking agent Sulfo-SMCC was removed, and 0.1 pM of rolling circle amplification primer SH_hp, dissolved in PBS buffer, was added. The reaction was carried out at room temperature for 1 hour. The sequence of the rolling circle amplification primer SH_hp is SEQ ID NO:3:
[0172] 5'-GCATTAGGAAGCAGCCCAGTAGTAGGATCACGACCAGGATTG-3'. Add BSA passivation solution to block the active functional groups of the unsuccessfully coupled rolling circle amplification primers on the surface of the flow cell.
[0173] Step 2: In-situ synchronized rolling circle amplification (RCA) on the flow cell surface synthesizes multiple tandem nucleic acid probes with biotinylated 3' ends and uniform polymerization. 1) Dilute the RCA template T_1 to 1 ng / μL with 3×PBS buffer, add it to the flow cell coupled with the RCA primers, and incubate at 37°C for 30 minutes to allow the initiating sequence on the RCA template to fully anneal to the RCA primers and form primer-template adapters. 2) Rinse off the free RCA template, add reaction buffer containing defective substrates (dATP, dCTP, and dGTP) and phi29 DNA polymerase, and incubate at 30°C for 5 minutes to allow phi29 DNA polymerase to fully recognize the primer-template adapters, form the RCA complex, initiate RCA amplification, and pause at the first A base on the template. 3) Rinse off the free phi29 DNA polymerase, add reaction buffer containing the complete reaction substrate dNTP mix, restart the RCA amplification process, and continue incubation at 30°C for 15 minutes. 4) Add the reaction substrate doped with biotin-labeled dUTP and incubate at 30°C for 1 minute to add biotin to the 3' end of the tandem nucleic acid probe. The ratio of biotin-labeled dUTP to dTTP is 1:9. 5) Add 30 mM EDTA to terminate the rolling circle amplification reaction. 6) Add 100 nM of the spacer sequence complement, Flank1, whose sequence is SEQ ID NO:4.
[0174] 5'-CTCTCTTGCCAATCCTGGTCGTGATTCCATTCT-3'. This transforms the single-stranded spacer sequence connecting adjacent hairpin structures in a tandem nucleic acid probe with uniform polymerization degree into a double-stranded sequence.
[0175] Step 3: The newly synthesized tandem nucleic acid probe with uniform polymerization degree is coupled to the magnetic microspheres. The magnetic microspheres M-270 are diluted 100-fold with 3×PBS buffer and added to the flow cell. The surface of the magnetic microspheres M-270 is modified with streptavidin, which can be coupled with biotin labeled at the 3' end of the tandem nucleic acid probe.
[0176] Step four: Under a constant tensile force of 12 pN, the molecular length of the tandem nucleic acid probes was determined by measuring the distance between the magnetic microspheres coupled with the tandem nucleic acid probes and the surface of the flow cell. Based on the elastic parameters of the probe molecules under the measurement solution and conditions, the degree of polymerization of the tandem nucleic acid probes was further calculated to be 1470 ± 154. Figure 3 As shown.
[0177] Example 3: Detection of artificial sequence N_20 using tandem nucleic acid probes with uniform polymerization degree. Specific steps are as follows:
[0178] Step 1: According to Example 1, a circular rolling circle amplification template T_1 targeting the artificial sequence N_20 is synthesized using hairpin sequences T1 and T2_1. The sequence of N_20 is SEQ ID NO:5: 5'-ATGCATCTCAAGGTCTAGTG-3'.
[0179] Step 2: In situ synchronized rolling circle amplification is performed according to the steps described in Example 2 to synthesize a tandem nucleic acid probe that can specifically recognize N_20 and has a uniform degree of polymerization.
[0180] Step 3: After connecting the tandem nucleic acid probe with uniform polymerization degree to magnetic microspheres, place it in a single-molecule magnetic tweezers device. Set the mechanical stretching mode of the detection process as follows: Detection force (F1 = 10 pN) for 5 seconds to determine the molecular extension length of the probe under the detection force before binding to the analyte, and record it as the baseline length; Binding force (F2 = 20 pN) for 20 seconds to expose the target sequence on the probe molecule under the binding force, identify and bind to the analyte; Detection force (F1 = 10 pN) for 5 seconds to record the change in probe molecular extension length under the detection force compared to the baseline length after binding to the analyte, denoted as LB, as the binding signal intensity of the analyte; Regeneration force (F3 = 1 pN) for 10 seconds to completely dissociate the analyte bound to the probe, and the probe returns to its initial state without analyte binding.
[0181] Step four: Repeat the mechanical stretching pattern in step three, using the measurement solution as a negative control, 100 pM of the artificial sequence N_20 as the experimental group, and 10 nM of Flank1 as a negative control. Record the real-time length change curves of the tandem nucleic acid probes with uniform polymerization degree under the binding force of each group of samples. The results show that the probe molecules only exhibit a significant binding signal in the presence of the analyte, such as... Figure 4 As shown.
[0182] Example 4: Using a gradually decreasing force as the detection force, the binding strength between the analyte and the tandem nucleic acid probe was measured. The specific steps are as follows:
[0183] Step 1: Following the steps described in Examples 1 and 2, a tandem nucleic acid probe with uniform polymerization degree is synthesized using hairpin templates T1 and T2_1 and in-situ synchronized rolling circle amplification. This probe can specifically recognize perfectly paired analyte N_16 and analyte N_16_G9C with a single-base mutation. The sequence of N_16 is SEQ ID NO:6: 5'-ATCTCAAGGTCTAGTG-3'; the sequence of N_16_G9C is SEQ ID NO:7: 5'-ATCTCAAGCTCTAGTG-3'.
[0184] Step 2: After connecting the tandem nucleic acid probe with uniform polymerization degree to magnetic microspheres, place it in a single-molecule magnetic tweezers device. Set the mechanical stretching mode of the detection process as follows: the detection force (F1) is gradually reduced from 13pN to 3pN to determine the molecular length change curve of the probe molecule under the detection force before binding to the analyte, and use it as the baseline curve; the binding force (F2 = 20pN) is held for 20 seconds to expose the target sequence on the probe molecule, identify and bind to the analyte; the detection force (F1) is gradually reduced from 13pN to 3pN, and the difference between the molecular length change curve of the probe molecule under the detection force and the baseline curve after binding to the analyte is recorded as the signal intensity LB of the analyte binding; the regeneration force (F3 = 1pN) is held for 10 seconds to completely dissociate the analyte bound to the probe, and the probe returns to its initial state without analyte binding.
[0185] Step 3: Repeat the mechanical stretching pattern in Step 2, using the measurement solution as a negative control, to measure the binding strength of perfectly paired analyte N_16 and analyte N_16_G9C with a single-base mutation to the tandem nucleic acid probe. The results showed that a single-base mutation in the analyte significantly reduced the binding strength between the analyte and the target sequence of the tandem nucleic acid probe. Figure 5 As shown.
[0186] Example 5: Detection of changes in microRNA (miR-122) expression levels in liver cancer tissues and adjacent normal tissues using tandem nucleic acid probes with uniform polymerization degree. The specific steps are as follows:
[0187] Step 1: According to Example 1, a circular rolling circle amplification template T_2 targeting miR-122 is synthesized using hairpin sequences T1 and T2_2.
[0188] The sequence of T2_2 is SEQ ID NO:8:
[0189] 5'-GTCCAGAGTGTGACAATGGTGTTTGCTGCTTTTGCAGCAAACACCATTGTCACAC T-3';
[0190] The sequence of miR-122 is SEQ ID NO:9:5'-UGGAGUGUGACAAUGGUGUUUG-3'(RNA).
[0191] Step 2: Synthesize in situ a tandem nucleic acid probe with uniform polymerization degree that can specifically recognize miR-122 according to the steps described in Example 2.
[0192] Step 3: After connecting the tandem nucleic acid probe with uniform polymerization degree to magnetic microspheres, place it in a single-molecule magnetic tweezers device. Set the mechanical stretching mode of the detection process as follows: Detection force (F1 = 9 pN) for 5 seconds to determine the molecular extension length of the probe under the detection force before binding miR-122, and record it as the baseline length; Binding force (F2 = 20 pN) for 3 minutes to expose the target sequence on the probe molecule under the binding force, identify and bind the analyte miR-122 in the sample; Detection force (F1 = 9 pN) for 5 seconds to record the change in probe molecular extension length under the detection force compared to the baseline length after binding miR-122, denoted as LB, as the binding signal intensity of miR-122; Regeneration force (F3 = 1 pN) for 10 seconds to completely dissociate the analyte miR-122 bound to the probe, and return the probe to its initial unbound state.
[0193] Step four: Repeat the mechanical stretching mode in step three to measure the signal intensity of miR-122 binding to the probe molecule in two samples: liver cancer tissue and adjacent tissue.
[0194] Step 5: Use the standard curve method to determine the concentration of the analyte miR-122 in the sample. Figure 6 The standard curve A shows that, within a specific concentration range, the binding signal intensity is proportional to the concentration of miR-122 molecules in the sample. Plotting the signal intensity measured in step four onto the standard curve yields the quantitative result of miR-122 in the sample, as shown below. Figure 6 As shown in B.
[0195] Example 6: Detection and differentiation of let-7 family members in serum with sequences differing by only 1-2 bases using tandem nucleic acid probes with uniform polymerization degree: let-7a, let-7b, let-7c and let-7d.
[0196] The sequence of let-7a is SEQ ID NO:10: 5'-UGAGGUAGUAGGUUGUAUAGUU-3'(RNA);
[0197] The sequence of let-7b is SEQ ID NO:11: 5'-UGAGGUAGUAGGUUGUGUGGUU-3'(RNA);
[0198] The sequence of let-7c is SEQ ID NO:12: 5'-UGAGGUAGUAGGUUGUAUGGUU-3'(RNA);
[0199] The sequence of let-7d is SEQ ID NO:13: 5'-AGAGGUAGUAGGUUGCAUAGUU-3'(RNA).
[0200] The specific steps are as follows:
[0201] Step 1: According to Example 1, four circular rolling circle amplification templates targeting let-7a, let-7b, let-7c and let-7d were synthesized using hairpin sequence T1 and T2_3, T2_4, T2_5 and T2_6 respectively.
[0202] The T2_3 sequence is SEQ ID NO:14:
[0203] 5'-GTCCAGTGCAAGTAGGTTGTATAGTTCTGCTTTTGCAGAACTATACAACCTACTTG CA-3';
[0204] The T2_4 sequence is SEQ ID NO:15:
[0205] 5'-GTCCAGTGCAAGTAGGTTGTGTGGTTCTGCTTTTGCAGAACCACACAACCTACTTGCA-3';
[0206] The T2_5 sequence is SEQ ID NO:16:
[0207] 5'-GTCCAGTGCAAGTAGGTTGTATGGTTCTGCTTTTGCAGAACCATACAACCTACTTGCA-3';
[0208] The T2_6 sequence is SEQ ID NO:17:5'-GTCCAGTGCAAGTAGGTTGCATAGTTCTGCTTTTGCAGAACTATGCAACCTACTTGCA-3'.
[0209] Step 2: Mix equal amounts of the four circular rolling circle amplification templates and dilute with 3×PBS buffer to a total concentration of 1 ng / μL. Following the steps described in Example 2, synthesize in situ a tandem nucleic acid probe set that simultaneously targets let-7a, let-7b, let-7c, and let-7d and has uniform polymerization.
[0210] Step 3: After linking the tandem nucleic acid probe assembly with uniform polymerization degree to magnetic microspheres, place it in a single-molecule magnetic tweezers device, and proceed according to... Figure 7 The method shown uses known analyte standards to sequentially determine the type of each probe in a tandem nucleic acid probe set with uniform polymerization degree.
[0211] Step four: Set the mechanical stretching mode of the detection process as follows: Detection force (F1 = 6.5 pN) is applied for 5 seconds to determine the molecular extension length of each probe molecule under the detection force before binding to the analyte, and this length is recorded as the baseline length; binding force (F2 = 20 pN) is applied for 3 minutes to expose the target sequence on the probe molecules, allowing for identification and binding of the analyte in the sample; detection force (F1 = 6.5 pN) is applied for 5 seconds to record the change in the extension length of each probe molecule under the detection force relative to the baseline length after binding to the analyte, denoted as LB, which serves as the binding signal intensity of the analyte. Since the stability of the analyte binding to non-specific probe molecules is much lower than its stability to specific probe molecules, under this detection force, the non-specifically bound analyte will rapidly dissociate, leaving only the specifically bound analyte. This process greatly increases the detection specificity of the method. Figure 8 As shown. The regeneration force (F3 = 1 pN) is applied for 10 seconds, causing all the analyte bound to the probe to dissociate, and the probe returns to its initial state without analyte.
[0212] Step 5: Repeat the mechanical tensile pattern in Step 4, changing the test samples one by one, and complete the testing of all test samples. The test results are as follows: Figure 9 As shown, the signal intensity generated by a specific probe is much greater than that generated by a non-specific probe.
[0213] Step Six: Add 0 pM, 1 pM, 10 pM, 100 pM, 1 nM, and 10 nM let-7c sequentially to samples containing 0 pM and 10 pM let-7b, respectively. Then repeat the mechanical tensile test in Step Three to verify the effect of the presence of let-7c on the specificity detection of let-7b. The test results are as follows: Figure 10 As shown, the presence of let-7c, which differs by only one base, does not affect the detection specificity of let-7b. However, when the concentration of let-7c is more than 100 times higher than that of let-7b, it will affect the detection sensitivity of let-7b to some extent.
[0214] Example 7: Detection of novel coronavirus nucleic acid fragments in saliva and identification of viral subtypes using tandem nucleic acid probes with uniform polymerization degree. Specific steps are as follows:
[0215] Step 1: According to Example 1, five circular single-stranded rolling circle amplification templates targeting the 614D, 614G, 679N / 681P, 679N / 681R and 679K / 681H sites of the novel coronavirus spike gene were synthesized using hairpin structure T1 and T2_7, T2_8, T2_9, T2_10 and T2_11 respectively.
[0216] The sequence of T2_7 is SEQ ID NO:18:
[0217] 5'-GTCCAGATGCTATCAGGATGTTAACTCTGGTTTTCCAGAGTTAACATCCTGATAGCAT-3';
[0218] The sequence of T2_8 is SEQ ID NO:19:
[0219] 5'-GTCCAGATGCTATCAGGGTGTTAACTCTGGTTTTTCCAGAGTTAACACCCTGATAGCAT-3';
[0220] The sequence of T2_9 is SEQ ID NO:20:
[0221] 5'-GTCCAGATGCACTAATTCTCCTCGGTCTGTTTTTCAGACCGAGGAGAATTAGTGCAT-3';
[0222] The sequence of T2_10 is SEQ ID NO:21:
[0223] 5'-GTCCAGATGCACTAATTCTCGTCGGTCTGTTTTTCAGACCGACGAGAATTAGTGCAT-3';
[0224] The sequence of T2_11 is SEQ ID NO:22:
[0225] 5'-GTCCAGATGCACTAAGTCTCATCGGTCTGTTTTCAGACCGATGAGACTTAGTGCAT-3'.
[0226] Step 2: Mix four circular single-stranded rolling circle amplification templates at equal concentrations and dilute to 1 ng / μL with 3×PBS buffer. Synthesize a tandem nucleic acid probe set that can simultaneously target five sites (614D, 614G, 679N / 681P, 679N / 681R, and 679K / 681H) and has uniform polymerization degree, following the steps described in Example 2.
[0227] Step 3: The RNA sample of the novel coronavirus was fragmented by reacting with fragmentation buffer (New England Biolabs) at 95°C for 10 minutes, and then diluted with a measurement solution containing 5% saliva to a concentration of 5 pg / μL.
[0228] Step four: After linking the tandem nucleic acid probe assembly with uniform polymerization degree to magnetic microspheres, place it in a single-molecule magnetic tweezers device, and proceed according to... Figure 7 The method shown uses known analyte standards to sequentially determine the type of each probe in a tandem nucleic acid probe set with uniform polymerization degree.
[0229] Step 5: Set the mechanical stretching mode of the detection process as follows: Detection force (F1 = 6 pN) is applied for 5 seconds to determine the molecular extension length of each probe molecule under the detection force before binding to the analyte, and this length is recorded as the baseline length. Binding force (F2 = 20 pN) is applied for 3 minutes to expose the target sequence on the probe molecules, allowing for the identification and binding of the analyte in the sample. Detection force (F1 = 6 pN) is applied for 5 seconds to record the change in the extension length of each probe molecule relative to the baseline length under the detection force after binding to the analyte, denoted as LB, which serves as the binding signal intensity of the analyte. Since the stability of analyte binding to non-specific probe molecules is much lower than that to specific probe molecules, under this detection force, non-specifically bound analytes will rapidly dissociate, leaving only specifically bound analytes. This process significantly increases the detection specificity of the method. Regeneration force (F3 = 1 pN) is applied for 10 seconds to completely dissociate the analyte bound to the probe, returning it to its initial unbound state.
[0230] Step Six: Measure all samples in sequence as in Step Three: the negative control containing only the measurement solution, the sample containing wild-type viral RNA fragments, the sample containing the B.1.617.2 subtype RNA fragment, and the sample containing the BA.1 subtype RNA fragment. Record the test results as follows: Figure 11 As shown.
[0231] Example 8: Using bridging DNA and T4 DNA ligase, single-stranded linear DNA template T3 was ligated end-to-end to construct a single-stranded circular rolling circle transcription template, as shown below. Figure 12 As shown. The specific steps are as follows:
[0232] Step 1: Design and synthesize single-stranded linear DNA template T3 and bridging DNA Bridge1.
[0233] The sequence of T3 is SEQ ID NO:23:
[0234] 5'-GTGAGTCGTATTAAGTCAAGTTAACCCTAACCCTAACCCTAACCCTAATCGAGCACGGCTCTACTCTACTCTACTCTACTCTCCTATA-3';
[0235] The sequence of Bridge1 is SEQ ID NO:24:5'-TAATACGACTCACTATAGGAGAG-3'.
[0236] The single-stranded linear DNA template has a phosphorylated modification at its 5' end, and its sequence contains a promoter sequence and a target sequence. The promoter sequence is the complementary sequence to the T7 promoter sequence, and the target sequence is the complementary sequence to the human telomeric G tetrad sequence. The 3' end sequence of the bridging DNA is complementary to the 5' end portion of the template T3; the 5' end sequence of the bridging DNA is complementary to the 3' end portion of the template T3.
[0237] Step 2: Template T3 and bridging DNA are annealed to form a circular structure with a nick. 2 μM template T3 and 2 μM bridging DNA Bridge1 are incubated in 10 mM Tris-HCl buffer at 75°C for 10 minutes, then cooled to 20°C at a rate of 1 degree Celsius per minute for annealing.
[0238] Step 3: Synthesize a closed circular rolling circle transcription template using an enzyme ligation reaction. Add T4 DNA ligase and reaction buffer to the annealing product from Step 2, incubate at 4°C for 12 hours to perform the enzyme ligation reaction, and then inactivate the T4 DNA ligase by reacting at 65°C for 10 minutes.
[0239] Step four: Purification and recovery of the closed-structure circular rolling transcription template. The ligation product from step three is recovered via ultrafiltration and then treated sequentially with DNA exonuclease III and DNA exonuclease I to eliminate all linear or nick-containing byproducts, obtaining a high-purity closed-structure circular rolling transcription template.
[0240] Step 5: Polyacrylamide gel electrophoresis was performed to detect the products from steps 2, 3, and 4, respectively. The gel concentration was 8%, and electrophoresis was performed at 100V for 40 minutes. After that, the gels were soaked and stained with nucleic acid dye Gel-Red, and then imaged using the Bio-Rad gel imaging system.
[0241] Example 9: In-situ synchronized rolling circle transcription synthesis of tandem nucleic acid probes with uniform polymerization degree on the surface of a flow cell, such as... Figure 13 As shown. The specific steps are as follows:
[0242] Step 1: Preparation of the flow cell with digoxigenin antibody coupled to its inner surface. The preparation of the flow cell and the modification of the inner surface with digoxigenin antibody were carried out according to the classic experimental procedures for single-molecule experiments.
[0243] Step 2: Anneal the complementary sequence T7_C of the promoter sequence to the circular single-stranded rolling circle transcription template to form a circular rolling circle transcription template in which the promoter sequence is double-stranded and the rest is single-stranded.
[0244] The sequence of the complementary sequence T7_C to the initiating sequence is SEQ ID NO:25: 5'-TAATACGACTCACTATAGG-3'.
[0245] Step 3: Formation of a synchronously initiated rolling circle transcription complex. Prepare a transcription system containing defective substrates (UTP, ATP, and CTP), where the UTP in the defective substrates is digoxigenin-modified UTP. The concentration of the circular rolling circle transcription template in the transcription system is 1 ng / μL. Incubate at 37°C for 5 minutes to allow T7 RNA polymerase to fully recognize the initiation sequence of the double-stranded structure, forming the rolling circle transcription complex and initiating transcription. Transcription then pauses upon first encountering the C-base site on the template. The paused rolling circle transcription complex is recovered using an ultrafiltration tube.
[0246] Step four: Add the recovered rolling circle transcription complex from step three to the flow cell whose inner surface is coupled with digoxigenin antibody, and react at room temperature for 10 minutes, so that the newly generated transcripts labeled with digoxigenin can be coupled to the inner surface of the flow cell by the affinity interaction between digoxigenin and digoxigenin antibody.
[0247] Step 5: Add the complete reaction substrate NTPmix, restart the transcription process, and incubate at 37°C for another 10 minutes.
[0248] Step 6: Prepare a reaction substrate containing biotin-labeled UTP at a ratio of 1:9 (biotin-labeled UTP to UTP). Add the substrate to a flow cell and incubate at 37°C for 1 minute to add biotin to the 3' end of the tandem nucleic acid probe synthesized by rolling circle transcription with uniform polymerization degree.
[0249] Step 7: Add 30mM EDTA to terminate the transcription reaction.
[0250] Step 8, Annealing interval sequence complementary sequence 2: Flank2.
[0251] The sequence of Flank2 is SEQ ID NO:26:
[0252] 5'-CTTGACTTAATACGACTCACTATAGGAGAGTAGAGTAGAGTAGAGTAGAGCCGTG CTCG-3'.
[0253] Adding 100 nM Flank2 causes the non-functional spacer sequence in the tandem nucleic acid probe with uniform polymerization to form a double-stranded structure.
[0254] Step nine involves the conjugation of newly synthesized tandem nucleic acid probes with uniform polymerization degree to magnetic microspheres. Magnetic microspheres M-270, diluted 100-fold with 3×PBS buffer, are added to the flow cell. The surface of magnetic microspheres M-270 is modified with streptavidin, which allows them to interact with biotin labeled at the 3' end of the tandem nucleic acid probes.
[0255] Example 10: Detection of the effect of small molecule ligand PDS on the structural stability of RNAG tetramers using uniformly polymerized tandem nucleic acid probes prepared by rolling circle transcription. Specific steps are as follows:
[0256] Step 1: Following the steps described in Example 8, a circular rolling circle transcription template containing a complementary sequence of the G tetrad-specific structural sequence is synthesized using the linear single-stranded DNA template T3 and the bridging DNA Bridge1.
[0257] Step 2: Synthesize in situ, according to the steps described in Example 9, a tandem nucleic acid probe that can form an RNAG tetrad-specific structure and has a uniform degree of polymerization.
[0258] Step 3: After attaching tandem nucleic acid probes with uniform polymerization degree to magnetic microspheres, place them in a single-molecule magnetic tweezers device and set the mechanical stretching mode for the detection process, such as... Figure 14 As shown: The regeneration force (F3 = 50 pN) is applied for 20 seconds, causing all G-quadruplex-specific structures on the probe to unfold; the detection force (F1 = 20 pN) is applied for 10 seconds to determine the molecular extension length of the probe under the detection force before the formation of the G-quadruplex structure, and this is recorded as the baseline length; the binding force (F2 = 2 pN) is applied for 60 seconds, causing all target sequences on the probe molecule to fold into the G-quadruplex-specific structure, while simultaneously recognizing and binding analytes in the sample, such as the small molecule ligand PDS; the detection force (F1 = 20 pN) is applied for 60 seconds, and the change in probe molecular extension length under the detection force compared to the baseline length after binding to the analyte is recorded as LB, which serves as the unfolding probability of the G-quadruplex-specific structure and determines the binding signal intensity of the analyte; the regeneration force (F3 = 50 pN) is applied for 20 seconds to cause all G-quadruplex-specific structures on the probe to unfold.
[0259] Step four: Repeat the mechanical stretching pattern in step three, using the measurement solution (100mM potassium chloride) as a control group. The results showed that the small molecule ligand PDS significantly increased the stability of the RNAG tetrad structure formed from human telomere repeat sequences. Figure 15 As shown.
Claims
1. A molecular detection method, wherein the method is for non-disease diagnostic purposes, characterized in that: Single-molecule magnetic tweezers technology is used to simultaneously manipulate multiple tandem nucleic acid probes with uniform degree of polymerization. The detection results are obtained by utilizing the length difference or length change curve difference of the tandem nucleic acid probes under different binding conditions with the analyte. The monomer of the tandem nucleic acid probe contains a target sequence. Under a certain range of tension, the target sequence can form a specific structure that binds to the analyte. This specific structure is defined by its ability to bind to the analyte. The non-functional spacer sequence in the tandem nucleic acid probe is changed from single-stranded to double-stranded. This non-functional spacer sequence is a sequence that does not participate in the detection of the analyte. The two ends of the tandem nucleic acid probe are connected to a carrier through labeled coupling functional groups. The carrier is used to apply tension to the tandem nucleic acid probe. The detection process includes bonding force and detection force: Under binding force, the target sequence forms the specific structure that can bind to the analyte; Detecting the analyte under a detection force: When the detection force is constant, the length of the tandem nucleic acid probe without analyte is recorded as the reference length. After the binding force is changed to the detection force, the difference between the length of the tandem nucleic acid probe and the reference length is calculated as the signal intensity. When the detection force is a gradual force, the length change curve of the tandem nucleic acid probe when there is no analyte is recorded as the baseline curve; During sample detection, the difference between the length change curve of the tandem nucleic acid probe and the baseline curve under detection force is used as the signal intensity. The presence of an analyte in a sample, the concentration of the analyte, the binding strength and rate of the analyte to a specific structure are detected based on signal intensity. The tandem nucleic acid probe is prepared by rolling circle amplification or rolling circle transcription. The template for rolling circle amplification is formed by connecting two single-stranded nucleic acids with sticky ends using a ligase. The target sequence is located in the stem region of the hairpin structure. The template for rolling circle transcription is formed by connecting one single-stranded nucleic acid end to end using a ligase. In this case, the target sequence can fold into a hairpin structure, a G-quadruplex structure, or a nano-origami structure.
2. The method according to claim 1, characterized in that: The rolling circle amplification includes the following steps: (i) Initiation of rolling circle amplification: requires rolling circle amplification primers, DNA polymerase, and rolling circle amplification template; the rolling circle amplification template contains complementary sequences to the initiation sequence and the target sequence; the initiation sequence can bind to the rolling circle amplification primers; (ii) Extension of rolling circle amplification: using all the necessary nucleotides as substrates and continuously amplifying for a period of time according to the required degree of polymerization of the tandem nucleic acid probe.
3. The method according to claim 1, characterized in that: The rolling circle transcription includes the following steps: (i) Initiation of rolling circle transcription: requires RNA polymerase and rolling circle transcription template; the rolling circle transcription template contains complementary sequences of the initiator sequence and the target sequence; the initiator sequence is the sequence that binds to RNA polymerase; in this step, the newly generated RNA transcript is labeled with a coupling functional group; (ii) Extension of rolling circle transcription: Transcription continues for a period of time using all the necessary nucleotides as substrates and according to the degree of polymerization required by the tandem nucleic acid probe.
4. The method according to claim 2 or 3, characterized in that: The extension step is performed while the device is fixed to the carrier.
5. The method according to claim 1, characterized in that: If the reaction reagents for rolling circle amplification or rolling circle transcription lack at least one of the essential nucleotide substrates, the polymerase will pause its work when it needs to use the missing essential nucleotide substrate.
6. The method according to claim 1, characterized in that: Simultaneously manipulate multiple tandem nucleic acid probes in a group, where the target sequences of each tandem nucleic acid probe within the group are sequences that identify sequence polymorphisms.
Citation Information
Patent Citations
Rca reporter probes and their use in detecting nucleic acid molecules
CN104955963A
Method for detecting nucleic acid terminal structure based on single-molecule force spectroscopy
CN109852667A