Aspergillus aculeatus GA2-37 and its application in the extraction of polysaccharides from Morchella

Abstract

The present invention relates to the field of microbial fermentation technology, and discloses Aspergillus aculeatus GA2-37 and its application in Morchella polysaccharide extraction. The present invention provides a new microbial strain Aspergillus aculeatus GA2-37, and makes Aspergillus aculeatus GA2-37 grow appropriately in Morchella powder added with sucrose, produces multiple hydrolases, and then, the fermented Morchella powder is water-insulated, and substances such as cellulose in the cell wall are hydrolyzed, which helps the bound Morchella polysaccharide to be dissolved during ultrasonic water extraction, thereby significantly improving the extraction yield of polysaccharides. The present invention applies Aspergillus aculeatus GA2-37 to Morchella polysaccharide extraction, and the polysaccharide extraction yield can be increased by 36.4% compared with the conventional method of water extraction and alcohol precipitation.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial fermentation, in particular to Aspergillus aculeatus GA2-37 and application thereof in the extraction of Morchella polysaccharide. Background Art

[0002] Morels, also known as sheep's tripe, morel mushroom, sheep's bird mushroom, and corn mushroom, are the fruiting bodies of Morchella esculenta, Morchella angusticeps, Morchella conica, Morchella crassipes, and Morchella deliciosa, all members of the Morchellaceae family. Morels are commonly found in moist broadleaf forests. Their caps are nearly spherical, ovate, or elliptical, and they get their name from the irregular depressions and wrinkles on their surface, which resemble a sheep's tripe.

[0003] Morchella is one of my country's four most prized edible mushrooms. It boasts a unique flavor and is rich in a variety of nutrients, including protein, polysaccharides, folic acid, amino acids, polyphenols, triterpenes, and vitamins. It contains several essential amino acids, making it a dual-purpose food and medicine. As a medicinal fungus, Morchella was first recorded in the Compendium of Materia Medica. Traditional Chinese Medicine considers it neutral, sweet, and cold in nature, non-toxic, and beneficial for the stomach and intestines, aiding digestion, resolving phlegm and regulating qi, nourishing the brain, and refreshing the mind. Modern herbal monographs such as the Chinese Materia Medica and the Xinhua Compendium of Materia Medica describe Morchella as sweet, neutral in nature, soothing the stomach and promoting digestion, resolving phlegm and regulating qi, and useful for treating ailments such as indigestion, excessive phlegm, and shortness of breath. Recent studies have shown that Morchella exhibits excellent anti-tumor, antioxidant, anti-fatigue, antibacterial, lipid-lowering, liver-protecting, gastrointestinal motility-promoting, and immunity-boosting properties, making it highly valuable as a nutritional and medicinal herb. In the past, wild morels were scarce and considered a precious food. In recent years, as artificial cultivation technology has gradually matured, the supply of morels on the market has increased, and it has become a common dish on people's tables.

[0004] Among the nutrients contained in morels, soluble polysaccharides are of particular interest. Their potential for immunomodulatory, anti-tumor, anti-aging, and lipid-lowering effects make them one of the most promising edible fungi resources for development as both food and pharmaceutical products with health benefits. Numerous studies have been conducted on the extraction of morel polysaccharides, with the most common method being hot water extraction followed by ethanol precipitation (abbreviated as "water extraction and alcohol precipitation"). While conventional hot water extraction offers advantages of simplicity and low cost, it also suffers from drawbacks such as long extraction time, multiple extractions, and low efficiency.

[0005] In recent years, enzymatic hydrolysis technology has been widely used in the extraction of natural active substances. It has the advantages of mild conditions, minimal damage to the structure of active ingredients, and can significantly improve product extraction yield. Among enzymatic hydrolysis-assisted extraction methods, cellulase is the most commonly used, followed by pectinase and protease, or the simultaneous use of multiple enzymes. The cell walls of plants or edible fungi are composed of substances such as cellulose, hemicellulose, lignin, and pectin. Therefore, the use of a single enzyme has very limited effect on improving product extraction yield. Many studies have used multiple enzymes (complex enzymes) simultaneously. If the enzyme dosage is large, it will undoubtedly increase the extraction cost.

[0006] Natural substances in nature are decomposed and decayed by microorganisms. During their growth, these microorganisms produce a variety of enzymes that decompose plant or edible (or medicinal) fungal tissues, including cellulases, hemicellulases, ligninases, and pectinases. However, relying on microbial activity to increase the yield of polysaccharides extracted from Morchella has not yet been effectively applied. Summary of the Invention

[0007] Currently, the yield of polysaccharides extracted from Morchella is low. In order to solve the above technical problems, the present invention provides an Aspergillus aculeatus GA2-37 and its application in the extraction of polysaccharides from Morchella.

[0008] One of the purposes of the present invention is to provide a new microbial strain, Aspergillus aculeatus GA2-37, which is inoculated into Morchella for microbial fermentation, thereby greatly improving the extraction rate of polysaccharides from Morchella.

[0009] Another object of the present invention is to provide a method for using Aspergillus aculeatus GA2-37 in the extraction of morel polysaccharides - controlling the growth of Aspergillus aculeatus GA2-37 to produce enzymes that hydrolyze the cell walls of the morels without decomposing soluble polysaccharides, thereby promoting the dissolution of morel polysaccharides and ultimately improving the extraction yield.

[0010] The specific technical solutions of the present invention are:

[0011] In one aspect, the present invention provides an Aspergillus aculeatus GA2-37, whose deposit number is GDMCC No: 63390.

[0012] The present invention isolates strain GA2 from a microbial enrichment culture of morel powder, and after ultraviolet mutagenesis, screens and obtains strain GA2-37, namely Aspergillus aculeatus GA2-37. The strain is deposited in the Guangdong Provincial Microbiological Culture Collection Center with a deposit number of GDMCC No. 63390 and a deposit date of April 24, 2023. The address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province; Postal Code: 510070. The present invention provides a new microbial strain, Aspergillus aculeatus GA2-37, which is inoculated into morels for microbial fermentation, thereby greatly improving the extraction rate of polysaccharides in morels.

[0013] The nucleotide sequence of the ribosomal DNA internal transcribed spacer (rDNA-ITS) of Aspergillus aculeatus GA2-37 is shown in SEQ ID NO 1.

[0014] On the other hand, the present invention provides the use of the above-mentioned Aspergillus aculeatus GA2-37 in the extraction of Morchella polysaccharide.

[0015] The present invention provides a new microbial strain, Aspergillus aculeatus GA2-37, which was isolated and screened specifically for its ability to hydrolyze Morchella cell walls and obtained through mutagenesis. During its growth, Aspergillus aculeatus GA2-37 produces a variety of enzymes that decompose Morchella cell walls, including cellulases, hemicellulases, pectinases, and proteases. Therefore, after screening for a superior strain suitable for polysaccharide extraction from Morchella, this strain can be used to directly ferment and pretreat Morchella. By controlling the growth rate to produce enzymes capable of hydrolyzing the Morchella cell walls without decomposing soluble polysaccharides, the extraction yield of Morchella polysaccharides can be improved.

[0016] Specifically, the present invention also provides a method for the application, comprising the following steps:

[0017] (1) adding Aspergillus aculeatus GA2-37 spore liquid to Morchella powder, mixing and fermenting to obtain Morchella fermentation product;

[0018] (2) adding deionized water to the Morchella fermented product, stirring the product, performing heat preservation treatment, ultrasonic treatment, filtering and concentrating the product to obtain a Morchella water extract concentrate;

[0019] (3) adding ethanol to the Morchella edodes water extract concentrate to obtain a precipitate, and washing and drying the precipitate to obtain Morchella edodes polysaccharide.

[0020] After the above steps (1) to (3), the extraction rate of polysaccharides during ultrasonic water extraction of Morchella can be significantly improved. In step (1), Aspergillus aculeatus GA2-37 grows moderately in Morchella powder added with sucrose, producing a variety of hydrolytic enzymes; then, in step (2), the fermented Morchella powder is added with water and kept warm, and the cellulose and other substances in the cell wall are partially hydrolyzed, which helps the bound Morchella polysaccharides to be dissolved during ultrasonic water extraction, thereby significantly improving the extraction rate of polysaccharides. Specifically:

[0021] In step (1), after the spore liquid of Aspergillus aculeatus GA2-37 is inoculated into the morel powder, fermentation is performed to allow the growth of Aspergillus aculeatus GA2-37 to just reach a suitable level for enzyme production.

[0022] In step (2), deionized water is added to the Morchella fermentation product, followed by heat preservation and ultrasonic treatment, to a degree that just hydrolyzes cellulose and other substances in the Morchella cell wall without decomposing soluble polysaccharides.

[0023] As a preferred embodiment of the above technical solution of the present invention, in step (1), the fermentation temperature is 28-32° C. and the fermentation time is 42-54 h.

[0024] After inoculating the spore liquid of Aspergillus aculeatus GA2-37 into the morel powder, fermenting it at 28-32° C. for 42-54 hours can make the growth of Aspergillus aculeatus GA2-37 just reach a suitable level for enzyme production.

[0025] As a preferred embodiment of the above technical solution of the present invention, in step (2), the temperature of the heat preservation treatment is 30-34° C. and the time is 4-6 hours.

[0026] After adding deionized water to the fermented morel and keeping it warm at 30-34°C for 4-6 hours, the cellulose and other substances in the cell wall of the morel can be hydrolyzed to a degree that does not decompose the soluble polysaccharides.

[0027] As a preferred embodiment of the above technical solution of the present invention, based on the mass of Morchella powder, in step (1), the volume of the Aspergillus aculeatus GA2-37 spore solution added is 4 to 6 mL / g. The concentration of the Aspergillus aculeatus GA2-37 spore solution is preferably 1×10 7 ~2×10 7 pieces / mL.

[0028] As a preferred embodiment of the above technical solution of the present invention, based on the mass of the morel powder, in step (2), the amount of deionized water added is 20 to 30 mL / g.

[0029] As a preferred embodiment of the above technical solution of the present invention, the preparation method of the Aspergillus aculeatus GA2-37 spore liquid is as follows: Aspergillus aculeatus GA2-37 spores are inoculated on a potato dextrose agar plate culture medium, cultured at a constant temperature of 28 to 30° C. for 50 to 72 hours to obtain a culture, and then a sterile sucrose aqueous solution is added to the culture, stirred to suspend the spores, and a spore liquid is obtained.

[0030] As a preferred embodiment of the above technical solution of the present invention, in step (2), the temperature of the ultrasound is 80-90°C, the power is 150-200W, and the time is 50-70min.

[0031] As a preferred embodiment of the above technical solution of the present invention, in step (2), the concentration condition is: concentrating under reduced pressure to 1 / 30 to 1 / 20 of the original volume.

[0032] As a preferred embodiment of the above technical solution of the present invention, step (3) is: adding 4 to 5 times the volume of anhydrous ethanol to the Morchella water extract concentrate to make the ethanol volume fraction of the system 80% to 83.3%, and then standing at 4 to 6°C for 14 to 18 hours to obtain a precipitate, and then washing the precipitate with anhydrous ethanol, and finally vacuum drying to constant weight to obtain Morchella polysaccharide.

[0033] Compared with the prior art, the present invention has the following technical effects:

[0034] The invention provides a new microbial strain Aspergillus aculeatus GA2-37, which is purposefully isolated and screened for its ability to hydrolyze Morchella cell walls and obtained through mutagenesis. The strain is applied to improve the extraction yield of Morchella polysaccharides with significant effect.

[0035] The present invention also provides a method for using Aspergillus aculeatus GA2-37 in the extraction of polysaccharides from Morchella. By optimizing fermentation conditions in Morchella powder supplemented with sucrose, the Aspergillus aculeatus GA2-37 is allowed to grow appropriately, producing multiple hydrolases. These enzymes hydrolyze the cell walls of the Morchella without degrading soluble polysaccharides, ultimately significantly improving the polysaccharide extraction yield. This method can increase the polysaccharide extraction yield from Morchella by 36.4% compared to conventional ultrasonic extraction methods that do not use Aspergillus aculeatus GA2-37 fermentation pretreatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The standard curve for the determination of polysaccharides using the phenol-sulfuric acid method with glucose as the standard.

[0037] Figure 2 This is the standard curve for determining glucose by the DNS method in Example 2 of the present invention.

[0038] Figure 3This is a photograph of the colony morphology of Aspergillus aculeatus GA2-37 cultured on PDA at 28° C. for 3 days in Example 3 of the present invention. DETAILED DESCRIPTION

[0039] The present invention will be further described below with reference to the following embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only a portion of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments derived by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0040] The morels used in the embodiment of the present invention are the fruiting bodies of the fungus Morchella esculenta of the Morchellaceae family; the morel powder is the fine powder obtained by drying the morels at 85° C. and then crushing them through a 60-mesh sieve.

[0041] In the examples and comparative examples of the present invention, the polysaccharide content of Morchella is determined by the phenol-sulfuric acid method. The specific method is as follows: the sample solution to be tested is diluted with deionized water by an appropriate multiple (the concentration of polysaccharides in the sample is estimated to be within the determination range of the standard curve); the solid Morchella polysaccharide extract is prepared with deionized water to a concentration of 0.1 mg / mL as the sample. 1 mL of the sample solution is drawn into a 10 mL stoppered tube, and 1 mL of a phenol aqueous solution with a volume concentration of 5% is added. After shaking, 5 mL of concentrated sulfuric acid (mass concentration of 98%) is quickly added. After shaking, heat in a boiling water bath for 15 minutes and cool to room temperature. The absorbance at a wavelength of 490 nm is measured using 1 mL of deionized water as a blank control for the same treatment. 490 The A of glucose samples with different concentrations was determined by the same method. 490 , plot glucose concentration—A 490 Standard curve, such as Figure 1 As shown, the regression equation is y=0.0124x+0.0057(R 2 =0.9990), and the polysaccharide content in the Morchella polysaccharide sample was determined by calculation using the regression equation.

[0042] The extraction rate of Morchella polysaccharide is calculated as follows:

[0043]

[0044] Example 1 Isolation and screening of microbial strains for fermenting Morchella

[0045] The microbial strain for fermenting Morchella oleracea was isolated and screened according to the following steps:

[0046] (1) Add 5 g of Morchella powder to a 250 mL triangular flask, then add 20 mL of sterile saline to moisten it, and incubate at 28 °C for 72 h. Dilute the enriched culture full of mold with sterile saline to 1 × 10 -5 , 1×10 -6 , 1×10 -7 , 1×10 -8 After folding, 0.1 mL of the dilution was respectively applied to potato dextrose agar (PDA) plates and incubated at 28°C for 60 h. During this period, mold colonies with different colors and morphologies were picked and transferred to fresh PDA plates and incubated at 28°C for 72 h. Seven pure culture strains were obtained, and the numbers of each strain are shown in Table 1. Among them, PDA plates are finished potato dextrose agar (Qingdao Haibo Biotechnology Co., Ltd.), prepared with tap water at a concentration of 46 g / L, with a natural pH, in a triangular flask, tied with 8 layers of gauze, sterilized by high-pressure steam at 121°C for 20 min, and poured into sterile culture dishes with a diameter of 9 cm before solidification, with 20 mL per dish;

[0047] (2) Add 10 mL of sterile sucrose aqueous solution to the fresh plate culture of 7 strains respectively, stir with an inoculating loop to suspend the spores, transfer the spore solution to a sterile test tube, and adjust the spore concentration with sterile sucrose aqueous solution so that the spore concentration of different strains is between 1×10 7 ~2×10 7 The concentration of the sterile sucrose aqueous solution was 12 g / L and sterilized by high pressure steam at 115°C for 20 min.

[0048] (3) 2 g of Morchella powder was added to 7 100 mL Erlenmeyer flasks sterilized by dry heat at 160° C. for 2 h, and then 8 mL of each mold spore solution prepared in step (2) was added (the volume dosage was 4 mL / g based on the mass of Morchella powder). After stirring evenly, the flasks were sealed with 8 layers of gauze and cultured at 28° C. for 54 h to obtain Morchella fermentation products;

[0049] (4) 40 mL of deionized water (material-liquid ratio of 1 g:20 mL) was added to all the Morchella powder fermented by each strain in step (3), stirred evenly, and kept warm in a 30°C water bath for 6 h. Then, the mixture was transferred to an ultrasonic cleaner at 80°C and ultrasonically extracted at 200W for 50 min. After the ultrasonic water extraction, the mixture was filtered with a hot Buchner funnel, 1 mL of the filtrate was taken into a 10 mL centrifuge tube, and 5 mL of anhydrous ethanol (the ethanol volume fraction of the solution was 83.3%) was added. After sufficient shaking, the mixture was allowed to stand at 4°C for 14 h, and then centrifuged at 4°C and 8000 r / min for 5 min. The supernatant was discarded, and 5 mL of deionized water was added for dissolution. The soluble polysaccharide content in the aqueous solution was determined by the phenol-sulfuric acid method.

[0050] Following the methods of steps (3) and (4) above, 8 mL of sterile sucrose solution (12 g / L) was added to 2 g of Morchella powder to serve as a blank fermentation control without mold inoculation. Following the method of step (4) above, polysaccharides were directly extracted from 2 g of Morchella by adding 40 mL of deionized water to serve as a non-fermented extraction control. The polysaccharide extraction yields of Morchella fermented with different strains and the control are shown in Table 1.

[0051] Table 1 Extraction rate of polysaccharides from Morchella fermented by different strains and the control

[0052] Serial number Strain number and control Polysaccharide extraction rate (%) Improvement rate (%) 1 GA1 6.49 1.88 2 GA2 7.78 2.21 3 GA3 682 7.06 4 GA4 6.16 -3.30 5 GA5 7.13 11.9 6 GA6 6.35 -0.314 7 GA7 6.14 -3.61 8 Blank fermentation control 6.56 2.98 9 Unfermented control 6.37 /

[0053] As can be seen from the data in Table 1, the blank fermentation control, in which a sterile sucrose solution was added but no mold was inoculated, showed no significant difference in polysaccharide extraction yield compared to the unfermented control due to almost no mold growth. The polysaccharide extraction yield of Morchella edulis fermented with most strains did not significantly increase, and even decreased. The polysaccharide extraction yield of Morchella edulis fermented with the GA2 strain was 7.78%, a 22.1% increase compared to the 6.37% of the unfermented control. Therefore, the present invention selected the GA2 strain as the microbial strain for fermenting Morchella edulis, allowing for subsequent mutagenesis and breeding to improve polysaccharide extraction yield.

[0054] Example 2 Mutagenesis and Breeding of Microbial Strains for Fermentation of Morchella

[0055] The strain GA2 was subjected to mutation breeding to screen strains with better fermentation performance. The specific method is as follows:

[0056] (1) Preparation of spore liquid: strain GA2 was activated and cultured on PDA plate medium at 30℃ for 48h, 5mL of sterile saline was added, and the spores were suspended by stirring with an inoculating loop. 1mL of spore liquid was transferred to a triangular flask containing 50mL of sterile saline (with 20-30 glass beads) and shaken at room temperature for 15min. The mycelium was removed by filtering the spore liquid (a small ball of fluffy cotton was plugged at the bottom of the triangular funnel), and the spores in the spore liquid were counted under a microscope using a hemocytometer. The spores were appropriately diluted with sterile saline to adjust the spore concentration to 1.18×10 7 / mL;

[0057] (2) Mutagenesis: Under red light illumination, take 1.5 mL of the above spore solution and a sterile paper clip and place them in 6 culture dishes with a diameter of 6 cm. The culture dishes are placed on magnetic stirrers and irradiated at a distance of 30 cm from a 15W ultraviolet lamp that has been preheated for 30 minutes for 1, 2, 3, 4, 5, and 6 minutes. Take 0.5 mL of the spore solution after the above irradiation treatment, dilute it appropriately, and transfer 0.1 mL to spread on PDA plate culture medium. Use the same operation to make a dilution of the spore solution that has not been irradiated by ultraviolet light and spread it on the plate as a control to calculate the lethality. The inoculated PDA plate is wrapped with black cloth, inverted and cultured at 28℃ for 48 hours, and the colonies on the plate are counted to calculate the lethality;

[0058] (3) Screening: The colonies on the PDA plate with a lethality rate of more than 90% were picked and transferred to fresh PDA plate culture medium, and cultured at 28°C for 72 hours to obtain 40 strains. 10 mL of sterile physiological saline was added to the fresh plate culture of each strain, and the spores were suspended by stirring with an inoculating loop to obtain the spore liquid of each strain. 2.5 mL of the spore liquid of each strain was taken and inoculated into 50 mL of enzyme production culture medium. After shaking culture at 30°C and 200 r / min for 72 hours, the fermentation liquid was filtered with a Buchner funnel, and the filtrate (i.e., crude enzyme liquid) was collected to determine the cellulase activity of the crude enzyme liquid of each strain. 10 strains with enzyme production activity that was significantly improved compared to the original strain GA2 were selected, and then the spore liquid of these strains was inoculated with Morchella powder for fermentation according to the method of Example 1. Polysaccharides were extracted by water extraction and alcohol precipitation. The polysaccharide extraction yields of Morchella fermented by the mutant strains and the control are shown in Table 2.

[0059] The enzyme production culture medium is composed of: 50 g / L wheat bran, 6 g / L (NH4)2SO4, 4 g / L peptone, 2 g / L KH2PO4, 1 g / L MgSO4·7H2O, and 0.5 g / L CaCl2. The solvent is tap water, and the pH is 6.0. 50 mL of enzyme production culture medium is placed in a 250 mL Erlenmeyer flask, tied with 8 layers of gauze, and sterilized with high-pressure steam at 121°C for 20 min.

[0060] Table 2 Extraction rate of polysaccharides from Morchella fermented by mutant strains and controls

[0061]

[0062] As can be seen from the data in Table 2, among the 10 strains screened, the strain numbered GA2-37 had a fermentation cellulase activity of 73.4 U / mL, a 36.7% increase over the 53.7 U / mL of the wild strain GA2. After fermenting Morchella with this strain, the polysaccharide extraction yield was 8.62%, a 10.8% increase over the 7.78% of the wild strain GA2 and a 35.3% increase over the 6.37% of the unfermented control. Therefore, the present invention selected the GA2-37 strain as the microbial strain for fermenting Morchella and optimized the extraction conditions to increase the polysaccharide extraction yield.

[0063] The cellulase activity assay method is as follows: 1.5 mL of 10 g / L sodium carboxymethyl cellulose solution (pH 6.0, 0.2 mol / L phosphate buffer) and 0.5 mL of crude enzyme solution were added to a 10 mL graduated test tube, respectively, and the mixture was kept warm in a 50°C water bath for 30 min. Then, 3 mL of DNS reagent was added and boiled for 5 min. After cooling with running water, the volume was made up to 10 mL with deionized water and stirred evenly. The crude enzyme solution inactivated by boiling at 100°C for 10 min was used as a reference and the absorbance at a wavelength of 540 nm (A) was measured using a spectrophotometer. 540 ), by glucose standard curve (such as Figure 2 Calculate the glucose concentration in the sample (as shown) and then calculate the cellulase activity (U / mL). Definition of cellulase activity: 1 enzyme activity unit (U) is the amount of enzyme required to hydrolyze sodium carboxymethyl cellulose to produce 1 μmol of glucose per minute at pH 6.0 and 50°C.

[0064] The formula for calculating cellulase activity is: U = (CV1) / (TV2). Where C is the glucose concentration (μmol / mL) calculated from the standard curve; V1 is the volume of the enzyme reaction system, i.e., 2 mL; T is the reaction time, i.e., 30 min; and V2 is the volume of the crude enzyme solution, i.e., 0.5 mL.

[0065] Among them, the glucose standard curve was drawn as follows: 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mL of a standard glucose aqueous solution with a concentration of 5 μmol / mL was added to 7 10 mL graduated test tubes, respectively. Then, 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, and 0.8 mL of pH 6.0, 0.2 mol / L phosphate buffer were added to each tube, and then 3.0 mL of DNS solution was added to each tube. The mixture was boiled in a boiling water bath for 5 minutes, cooled in running water, and then diluted to 10 mL with deionized water. The mixture was stirred evenly, and the color solution in the test tube without glucose was used as a reference. The A value was measured on a spectrophotometer. 540 , with glucose concentration as the horizontal axis, A 540 Draw a standard curve for the ordinate, such as Figure 2 As shown, the regression equation is y = 0.25246x + 0.01487 (R2 =0.9995).

[0066] The preparation method of DNS reagent is as follows: 6.3g of 3,5-dinitrosalicylic acid and 262mL of 2mol / L NaOH aqueous solution are added to 500mL of hot aqueous solution containing 182g of sodium tartrate, and then 5g of redistilled phenol and 5g of sodium sulfite are added, stirred to dissolve, cooled, and deionized water is added to make up to 1L, stored in a brown bottle, and used after 7 days.

[0067] Example 3 Classification and Identification of Strain GA2-37

[0068] Strain GA2-37 was streaked onto a PDA plate and incubated at 28°C for 1 day. Off-white hyphae grew on both sides of the inoculation line. Two days later, a large number of brown conidia formed on the surface of the colony. The conidiophores were erect or slightly curved, and the conidial heads were spherical or nearly spherical, with a single layer of peduncles. The conidia were approximately spherical or elliptical, with a diameter of 4 to 5 μm and radial spines on the surface. The colony morphology of Aspergillus aculeatus GA2-37 cultured on PDA at 28°C for 3 days is shown in the following figure. Figure 3 ; Among them, the components and preparation method of PDA plate culture medium are the same as those in Example 1.

[0069] The nucleotide sequence of the ribosomal DNA internal transcribed spacer (rDNA-ITS) of strain GA2-37 was measured as shown in SEQ ID NO. 1. The sequence was compared by BLAST at NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov) and had greater than 99.6% homology with the rDNA-ITS sequences of two known typical strains of Aspergillus aculeatus CBS121060 and CBS172.66. The colony morphology of strain GA2-37 also conforms to that of Aspergillus aculeatus. Therefore, the biological classification position of strain GA2-37 can be determined as follows (refer to Mycobank, http: / / www.Mycobank.org): Fungi, Ascomycota, Pezizomycotina, Eurotiomycetes, Eurotiomycetidae, Eurotiales, Aspergillaceae, Aspergillus, Aspergillus aculeatus.

[0070] The rDNA-ITS nucleotide sequence of the strain GA2-37 is shown in SEQ ID NO. 1. The rDNA-ITS nucleotide sequence of the strain GA2-37 is as follows:

[0071] AACCTCCCACCCGTGCTTACCGTACCCTGTTGCTTCGGCGGGCCCGCCTTCGGGCGGCC

[0072] CGGGGCCTGCCCCCGGGACCGCGCCCGCCGGAGACCCCAATGGAACACTGTCTGAAAG

[0073] CGTGCAGTCTGAGTCGATTGATACCAATCAGTCAAAACTTTCAACAATGGATCTCTTGGT

[0074] TCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAG

[0075] TGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGT

[0076] CCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGGTTGTTGGGCCGCGCCCCCCCGGGGGC

[0077] GGGCCTCGAGAGAAACGGCGGCACCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACC

[0078] CGCTCTATGGGCCCGGCCGGGGCTTGCCTCGACCCCCAATCTTTCAGATTGACCTCGGA

[0079] TCAGGTAGGGATACCCGCTGAACTT.

[0080] In summary, strain GA2 was isolated from the microbial enrichment culture of morel powder, and after ultraviolet mutagenesis, strain GA2-37 was screened and obtained, namely Aspergillus aculeatus GA2-37. The strain was deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 63390 and the deposit date of April 24, 2023. The address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province; Postal Code 510070.

[0081] Example 4 Application of Aspergillus aculeatus GA2-37 in the Extraction of Morchella Polysaccharide

[0082] Aspergillus aculeatus GA2-37 was used to extract polysaccharides from Morchella. The following steps were followed:

[0083] (1) Spores from a PDA plate colony of Aspergillus aculeatus GA2-37 stored at 4°C were inoculated onto fresh PDA plate culture medium and cultured at 28°C for 60 h. 10 mL of sterile sucrose aqueous solution was added to the culture dish and stirred with an inoculating loop to suspend the spores. The spore solution was transferred to a sterile test tube and the spore concentration was adjusted to 1.83 × 10 7 / mL, and obtain the Aspergillus aculeatus GA2-37 spore liquid. Wherein, the components and preparation method of the PDA plate culture medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 12g / L, and it is sterilized by high-pressure steam at 115°C for 20min;

[0084] (2) 10g of Morchella powder was sterilized by dry heat at 160°C for 2h in a 250mL Erlenmeyer flask, and 40mL of the Aspergillus aculeatus GA2-37 spore solution prepared in step (1) was added (the volume dosage was 4mL / g based on the mass of Morchella powder) and stirred evenly. The flask was sealed with 8 layers of gauze and cultured at 28°C for 54h to obtain the Morchella fermentation product;

[0085] (3) All the fermented Morchella oleracea from step (2) were transferred to a 500 mL beaker, and 200 mL of deionized water (material-liquid ratio of 1 g:20 mL) was added. After stirring evenly, the mixture was kept warm in a 30°C water bath for 6 h. Afterwards, the beaker was transferred to an ultrasonic cleaner at 80°C, and ultrasonic extraction was performed at 200W for 50 min. The mixture was filtered through a hot Buchner funnel, and the entire filtrate was concentrated under reduced pressure at 60°C and -0.1 MPa to 10 mL (1 / 20 of the original filtrate volume) to obtain a Morchella oleracea water extract concentrate.

[0086] (4) To the entire Morchella water extract concentrate obtained in step (3), 40 mL of anhydrous ethanol (4 times the volume of the concentrate, the ethanol volume fraction of the system is 80%) was added, and the mixture was allowed to stand for 14 h at 4 ° C., and then centrifuged at 4 ° C. and 8000 r / min for 10 min. The supernatant was discarded, and the precipitate was washed once with 20 mL of anhydrous ethanol (based on the mass of Morchella powder, the volume dosage was 2 mL / g), and centrifuged again. The precipitate was dried in a vacuum at 65 ° C. and -0.1 MPa to constant weight to obtain a Morchella polysaccharide extract.

[0087] Example 5 Application of Aspergillus aculeatus GA2-37 in the Extraction of Morchella Polysaccharide

[0088] Aspergillus aculeatus GA2-37 was used to extract polysaccharides from Morchella. The following steps were followed:

[0089] (1) PDA plate spores of Aspergillus aculeatus GA2-37 stored at 4°C were inoculated onto fresh PDA plate medium and cultured at 30°C for 55 h. 10 mL of sterile sucrose aqueous solution was added to the culture dish and stirred with an inoculating loop to suspend the spores. The spore solution was transferred to a sterile test tube and the spore concentration was adjusted to 1.70 × 10 7 / mL, and obtain the Aspergillus aculeatus GA2-37 spore liquid. Wherein, the components and preparation method of the PDA plate culture medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 14g / L, and it is sterilized by high-pressure steam at 115°C for 20min;

[0090] (2) 10g of Morchella powder was sterilized by dry heat at 160℃ for 2h in a 250mL Erlenmeyer flask, and 50mL of Aspergillus aculeatus GA2-37 spore solution prepared in step (1) was added (the volume dosage was 5mL / g based on the mass of Morchella powder) and stirred evenly. The flask was sealed with 8 layers of gauze and cultured at 30℃ for 48h to obtain Morchella fermentation product;

[0091] (3) All the fermented Morchella oleracea from step (2) were transferred to a 500 mL beaker, 250 mL of deionized water (material-liquid ratio of 1 g:25 mL) was added, stirred evenly, and kept warm in a 32 ° C water bath for 5 h. Afterwards, the beaker was transferred to an ultrasonic cleaner at a water temperature of 85 ° C, ultrasonically extracted at 175W for 60 min, and filtered through a hot Buchner funnel. The entire filtrate was concentrated under reduced pressure at 60 ° C and -0.1 MPa to 10 mL (1 / 25 of the original filtrate volume) to obtain a Morchella oleracea water extract concentrate;

[0092] (4) To the entire Morchella water extract concentrate obtained in step (3), 40 mL of anhydrous ethanol (4 times the volume of the concentrate, the ethanol volume fraction of the system is 80%) was added, and after standing at 5 ° C for 16 h, the mixture was centrifuged at 4 ° C and 8000 r / min for 10 min, the supernatant was discarded, and the precipitate was washed once by adding 2.5 mL of anhydrous ethanol (based on the mass of Morchella powder, the volume dosage is 25 mL / g), and centrifuged again. The precipitate was dried in a vacuum at 65 ° C and -0.1 MPa to constant weight to obtain a Morchella polysaccharide extract.

[0093] Example 6 Application of Aspergillus aculeatus GA2-37 in the Extraction of Morchella Polysaccharide

[0094] Aspergillus aculeatus GA2-37 was used to extract polysaccharides from Morchella. The following steps were followed:

[0095] (1) PDA plate spores of Aspergillus aculeatus GA2-37 stored at 4°C were inoculated onto fresh PDA plate medium and cultured at 30°C for 50 h. 10 mL of sterile sucrose aqueous solution was added to the culture dish and stirred with an inoculating loop to suspend the spores. The spore solution was transferred to a sterile test tube and the spore concentration was adjusted to 1.48 × 10 7 / mL, and obtain the Aspergillus aculeatus GA2-37 spore liquid. Wherein, the components and preparation method of the PDA plate culture medium are the same as those in Example 1; the concentration of the sterile sucrose aqueous solution is 16g / L, and it is sterilized by high-pressure steam at 115°C for 20min;

[0096] (2) 10g of Morchella powder was sterilized by dry heat at 160°C for 2h in a 250mL Erlenmeyer flask, and 60mL of Aspergillus aculeatus GA2-37 spore solution prepared in step (1) (the volume dosage was 6mL / g based on the mass of Morchella powder) was added and stirred evenly. The flask was sealed with 8 layers of gauze and cultured at 32°C for 42h to obtain Morchella fermentation product;

[0097] (3) All the fermented Morchella oleracea from step (2) were transferred to a 500 mL beaker, 300 mL of deionized water (material-liquid ratio of 1 g:30 mL) was added, stirred evenly, and kept warm in a 34 ° C water bath for 4 h. Afterwards, the beaker was transferred to an ultrasonic cleaner at a water temperature of 90 ° C, ultrasonically extracted at 150W for 70 min, and filtered through a hot Buchner funnel. The entire filtrate was concentrated under reduced pressure to 10 mL (1 / 30 of the original filtrate volume) at 60 ° C and -0.1 MPa to obtain a Morchella oleracea water extract concentrate;

[0098] (4) To the entire Morchella water extract concentrate obtained in step (3), 40 mL of anhydrous ethanol (4 times the volume of the concentrate, the ethanol volume fraction of the system is 80%) was added, and the mixture was allowed to stand for 18 h at 4 ° C., and then centrifuged at 4 ° C. and 8000 r / min for 10 min. The supernatant was discarded, and the precipitate was washed once with 30 mL of anhydrous ethanol (based on the mass of Morchella powder, the volume dosage was 3 mL / g), and centrifuged again. The precipitate was dried in a vacuum at 65 ° C. and -0.1 MPa to constant weight to obtain a Morchella polysaccharide extract.

[0099] Comparative Example 1

[0100] The main difference from Example 5 is that the Aspergillus aculeatus GA2-37 fermentation pretreatment was not performed before water extraction and alcohol precipitation, and the following steps were followed:

[0101] (1) 10g of Morchella powder was placed in a 500mL beaker, and 250mL of deionized water (the material-liquid ratio was 1g:25mL) was added. After stirring evenly, the mixture was kept warm in a 32℃ water bath for 5h. Afterwards, the beaker was transferred to an ultrasonic cleaner at 85℃, and ultrasonic extraction was performed at 175W for 60min. The mixture was filtered through a hot Buchner funnel, and the filtrate was concentrated to 10mL (1 / 25 of the original filtrate volume) under reduced pressure at 60℃ and -0.1MPa to obtain a Morchella water extract concentrate.

[0102] (2) To the entire Morchella water extract concentrate obtained in step (1), 40 mL of anhydrous ethanol (4 times the volume of the concentrate, the ethanol volume fraction of the system is 80%) was added, and the mixture was allowed to stand for 16 h at 5 ° C., and then centrifuged at 4 ° C. and 8000 r / min for 10 min. The supernatant was discarded, and the precipitate was washed once with 25 mL of anhydrous ethanol (based on the mass of Morchella powder, the volume dosage was 2.5 mL / g), and centrifuged again. The precipitate was dried in a vacuum at 65 ° C. and -0.1 MPa to constant weight to obtain a Morchella polysaccharide extract.

[0103] Comparative Example 2

[0104] The main difference from Example 5 is that the fermentation temperature in step (2) is 25°C. The other steps are the same as in Example 5, and step (2) is performed as follows:

[0105] To a 250 mL Erlenmeyer flask sterilized by dry heat at 160°C for 2 h, add 50 mL of the Aspergillus aculeatus GA2-37 spore solution prepared in step (1) (5 mL / g by volume based on the mass of the Morel powder) and stir evenly. The flask is sealed with 8 layers of gauze and incubated at 25°C for 48 h to obtain a fermented Morel product.

[0106] Comparative Example 3

[0107] The main difference from Example 5 is that the fermentation temperature in step (2) is 35°C. The other steps are the same as those in Example 5, and step (2) is performed as follows:

[0108] To a 250 mL Erlenmeyer flask sterilized by dry heat at 160°C for 2 h, add 50 mL of the Aspergillus aculeatus GA2-37 spore solution prepared in step (1) (5 mL / g by volume based on the mass of the Morel powder) and stir evenly. The flask is sealed with 8 layers of gauze and incubated at 35°C for 48 h to obtain a fermented Morel product.

[0109] Comparative Example 4

[0110] The main difference from Example 5 is that the fermentation time in step (2) is 36 hours. The other steps are the same as those in Example 5, and step (2) is performed as follows: 10g of Morchella powder is sterilized by dry heat at 160°C for 2 hours in a 250mL Erlenmeyer flask, 50mL of the Aspergillus aculeatus GA2-37 spore solution prepared in step (1) is added (the volume amount is 5mL / g based on the mass of Morchella powder), and stirred evenly. The flask is sealed with 8 layers of gauze and cultured at 30°C for 36 hours to obtain a Morchella fermentation product.

[0111] Comparative Example 5

[0112] The main difference from Example 5 is that the fermentation time in step (2) is 60 hours. The other steps are the same as those in Example 5, and step (2) is performed as follows: 10g of Morchella powder is sterilized by dry heat at 160°C for 2 hours in a 250mL Erlenmeyer flask, 50mL of the Aspergillus aculeatus GA2-37 spore solution prepared in step (1) is added (the volume amount is 5mL / g based on the mass of Morchella powder), and stirred evenly. The flask is sealed with 8 layers of gauze and cultured at 30°C for 60 hours to obtain a Morchella fermentation product.

[0113] Comparative Example 6

[0114] The main difference from Example 5 is that the holding temperature in step (3) is 28° C. The other steps are the same as those in Example 5, and step (3) is performed as follows:

[0115] The entire Morchella fermented product of step (2) was transferred to a 500 mL beaker, 250 mL of deionized water (solid-liquid ratio of 1 g:25 mL) was added, stirred evenly, and kept warm in a 28°C water bath for 5 h. Afterwards, the beaker was transferred to an ultrasonic cleaner at a water temperature of 85°C, ultrasonically extracted at 175W for 60 min, and filtered through a hot Buchner funnel. The entire filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60°C and -0.1 MPa to obtain a Morchella water extract concentrate.

[0116] Comparative Example 7

[0117] The main difference from Example 5 is that the holding temperature in step (3) is 36° C. The other steps are the same as those in Example 5, and step (3) is performed as follows:

[0118] The entire Morchella fermented product of step (2) was transferred to a 500 mL beaker, 250 mL of deionized water (solid-liquid ratio of 1 g:25 mL) was added, stirred evenly, and kept warm in a 36°C water bath for 5 h. Afterwards, the beaker was transferred to an ultrasonic cleaner at a water temperature of 85°C, ultrasonically extracted at 175W for 60 min, and filtered through a hot Buchner funnel. The entire filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60°C and -0.1 MPa to obtain a Morchella water extract concentrate.

[0119] Comparative Example 8

[0120] The main difference from Example 5 is that the holding time in step (3) is 3 hours. The other steps are the same as in Example 5, and step (3) is performed as follows:

[0121] All the Morchella fermented product from step (2) was transferred to a 500 mL beaker, 250 mL of deionized water (solid-liquid ratio of 1 g:25 mL) was added, stirred evenly, and kept warm in a 32°C water bath for 3 h. Afterwards, the beaker was transferred to an ultrasonic cleaner at a water temperature of 85°C, ultrasonically extracted at 175W for 60 min, and filtered through a hot Buchner funnel. The entire filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60°C and -0.1 MPa to obtain a Morchella water extract concentrate.

[0122] Comparative Example 9

[0123] The main difference from Example 5 is that the holding time in step (3) is 7 hours. The other steps are the same as in Example 5, and step (3) is performed as follows:

[0124] All the Morchella fermented product from step (2) was transferred to a 500 mL beaker, 250 mL of deionized water (solid-liquid ratio of 1 g:25 mL) was added, stirred evenly, and kept warm in a 32°C water bath for 7 h. Afterwards, the beaker was transferred to an ultrasonic cleaner at a water temperature of 85°C, ultrasonically extracted at 175W for 60 min, and filtered through a hot Buchner funnel. The entire filtrate was concentrated under reduced pressure to 10 mL (1 / 25 of the original filtrate volume) at 60°C and -0.1 MPa to obtain a Morchella water extract concentrate.

[0125] Fermentation result evaluation

[0126] In Examples 4 to 6 and Comparative Examples 1 to 9, the mass of the polysaccharide extract obtained from 10 g of Morchella, the mass of Morchella polysaccharide, the percentage of Morchella polysaccharide, and the extraction yield of Morchella polysaccharide are shown in Table 3. The percentage of Morchella polysaccharide is the percentage of the mass of Morchella polysaccharide in the mass of the obtained polysaccharide extract.

[0127] Table 3 Yields of Morchella polysaccharides extracted from Examples 4 to 6 and Comparative Examples 1 to 9

[0128]

[0129] From the data in Table 3, we can see that:

[0130] ① Comparing Comparative Example 1 with Example 5, the polysaccharide extraction yield was greatly improved when Aspergillus aculeatus GA2-37 fermentation pretreatment was performed before conventional water extraction and alcohol precipitation, indicating the excellent effect of Aspergillus aculeatus GA2-37 fermentation pretreatment on improving the polysaccharide extraction yield before water extraction and alcohol precipitation. Analysis of the reason is that Aspergillus aculeatus GA2-37 can produce multiple hydrolases that hydrolyze the cell wall of Morchella, ultimately significantly improving the polysaccharide extraction yield. The extraction yield of Example 5, which was pretreated with Aspergillus aculeatus GA2-37, was 8.91%, an increase of 36.4% compared to 6.53% in Comparative Example 1 without treatment.

[0131] ② From the comparative analysis of Comparative Examples 2 to 5 and Example 5, it can be seen that the fermentation temperature or time of Comparative Examples 2 to 5 is different from that of the Examples, and the polysaccharide extraction yield is reduced, indicating that when Aspergillus aculeatus GA2-37 is applied to the polysaccharide extraction of Morchella, adding Aspergillus aculeatus GA2-37 spore liquid to Morchella powder and fermenting at 28 to 32 ° C for 42 to 54 hours has a better effect on improving the polysaccharide extraction of Morchella. The reason for this is that after adding Aspergillus aculeatus GA2-37 spore liquid to Morchella powder and fermenting at 28 to 32 ° C for 42 to 54 hours, the growth of Aspergillus aculeatus GA2-37 can just reach a suitable level for enzyme production, and the polysaccharide extraction effect is better.

[0132] ③ Comparative analysis of Comparative Examples 6-9 and Example 5 shows that the water extraction temperature or time in Comparative Examples 6-9 differs from that in Example 4, resulting in a lower polysaccharide extraction yield. This indicates that when Aspergillus aculeatus GA2-37 is used in the polysaccharide extraction of Morchella, adding deionized water to the Morchella fermentation product and then maintaining it at 30-34°C for 4-6 hours before water extraction is more effective in improving polysaccharide extraction from Morchella. This may be because adding deionized water to the Morchella fermentation product and then maintaining it at 30-34°C for 4-6 hours before water extraction allows for the hydrolysis of substances such as cellulose in the Morchella cell wall without decomposing soluble polysaccharides, resulting in a better polysaccharide extraction effect.

[0133] Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.

[0134] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A strain of Aspergillus aculeatus ( Aspergillus aculeatus ) GA2-37, characterized by: It is deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No: 63390, the deposit date is April 24, 2023, and the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

2. Use of Aspergillus aculeatus GA2-37 as claimed in claim 1 in the extraction of Morchella polysaccharide.

3. The use according to claim 2, characterized in that: The method of application comprises the following steps: (1) adding Aspergillus aculeatus GA2-37 spore liquid to Morchella powder, mixing and then fermenting to obtain Morchella fermentation product; (2) adding deionized water to the fermented morel, stirring well, performing heat preservation treatment, ultrasonic treatment, filtering, and concentrating to obtain a morel water extract concentrate; (3) Adding ethanol to the concentrated extract of Morchella oleracea to obtain a precipitate, and washing and drying the precipitate to obtain Morchella oleracea polysaccharide.

4. The use according to claim 3, characterized in that: Based on the mass of Morchella powder, in step (1), the amount of Aspergillus aculeatus GA2-37 spore solution added is 4-6 mL / g, and the concentration of the spore solution is 1×10 7 ~2×10 7 pieces / mL.

5. The use according to claim 3, characterized in that: In step (1), the fermentation temperature is 28-32° C., and the fermentation time is 42-54 h.

6. The use according to claim 3, characterized in that: Based on the mass of the morel powder, in step (2), the amount of deionized water added is 20 to 30 mL / g.

7. The use according to claim 3, characterized in that: In step (2), the temperature of the heat preservation treatment is 30 to 34° C., and the time of the heat preservation treatment is 4 to 6 hours.

8. The use according to claim 3, characterized in that: In step (2), the temperature of the ultrasound is 80-90°C, the power is 150-200 W, and the time is 50-70 min.

9. The use according to claim 3, characterized in that: In step (2), the volume is concentrated to 1 / 30 to 1 / 20 of the original volume, and the concentration method is reduced pressure concentration.

Images