Integrated automatic analysis method and computer program product for miRNA targets

Abstract

The present invention belongs to the field of bioinformatics analysis, and specifically relates to the development and application of a target prediction program for microRNA (miRNA). The present invention provides an integrated automatic analysis method for miRNA targets, and the present invention also provides a computer program product TarPShell. The present invention realizes a graphical user interface by utilizing the Tkinter module and realizes a multi-task parallel operation mode by utilizing the Threading module. The target gene prediction tool of the present invention has the characteristics of simple configuration, friendly operation, convenience and flexibility, etc., which can save scientific research time, reduce experimental costs, and lower research thresholds for a large number of researchers who do miRNA target gene prediction. In addition, the present invention can also help researchers quickly and efficiently eliminate a large number of non-target genes and non-binding sites at low experimental costs, saving a lot of manpower and material resources.

Description

Technical Field

[0001] The present invention belongs to the field of bioinformatics analysis, and specifically relates to the development and application of a MicroRNA target prediction program. Background Art

[0002] MicroRNA (referred to as miRNA) is a class of non-coding small RNA molecules with a length of about 20-24 nt, originating from the organism itself, and mostly distributed in intergenic regions and introns. MiRNA plays an important role in post-transcriptional regulation in organisms. It is estimated that more than half of mammalian protein-coding genes are regulated by miRNA, and most human mRNAs have miRNA binding sites. MiRNA has been shown to be essential for most physiological processes, such as cell development, cell proliferation, and cell death. Downregulation of miRNA is associated with many diseases, such as cancer, cardiovascular and neurodegenerative diseases or metabolic disorders. Therefore, it is of great value to explore the specific functions of miRNA in various organisms and their corresponding expression analysis patterns. There are currently several types of miRNA target binding sites, which differ in the location and positioning of Watson-Crick pairing and mismatching, and have been separately distinguished. In order to explore the biological function of each miRNA, it is necessary to obtain all the targets of the miRNA. Due to the complexity of the interaction between miRNA and target genes and the limited understanding of the rules of these processes, it is still challenging to effectively predict miRNA-mRNA interactions in organisms. So far, the number of true miRNA targets that have been experimentally verified is still limited. Relying solely on biological experiments to obtain all the targets of miRNA is almost an unachievable huge project. In order to solve this problem, researchers have developed an effective target gene prediction program based on the biological principles of the interaction between miRNA and target genes.

[0003] Target gene prediction refers to the screening and prediction of potential target genes among many target genes of interest based on the gene expression pattern or the interaction pattern between genes. Target gene prediction is a necessary step in the preliminary research of studying the function of miRNA molecules or the regulatory mechanism of miRNA molecules. It can help researchers eliminate a large number of non-target genes and non-binding sites quickly, efficiently and at low experimental cost, saving a lot of manpower and material resources. Since the first miRNA target gene prediction software miRanda was put into use, the efficiency of obtaining target genes has been significantly improved, but it was soon discovered that there are a large number of unnecessary non-target gene results in the results predicted by a single tool, making it still very difficult to obtain real potential target genes. In order to solve this problem, researchers have successively developed a number of miRNA target prediction tools such as RNAhybrid, PITA, TargetScan, RNA22, PicTar, etc. based on different biological principles and algorithms.

[0004] The specific problems that exist in the use of current target gene prediction tools include: the current miRNA target gene prediction software can be roughly divided into two categories according to whether it relies on the Internet, online database type and local software type. Among them, online databases are often limited to the size of their own databases, and have restrictions on the species tested, and only provide a very small number of species for miRNA target gene prediction. Local software has the following problems: (1) downloading and installing and the environment configuration after installation, the corresponding dependent packages, and software package installation and management are quite cumbersome; (2) there is no visual output result, and most results need to be further extracted and formatted before they can be used; (3) all operations are performed in the command terminal, which requires a certain computer language foundation or related knowledge background; (4) the parameter settings of various prediction software are complicated and numerous, and there is no visual operation interface and result interface, which makes self-study costly and difficult.

[0005] It can be seen that the accuracy of existing prediction software is not high, and the operation of each software is cumbersome, and the threshold for using multiple software is relatively high for relevant researchers. How to quickly, efficiently, accurately, and at low cost obtain potential target genes of miRNA while reducing the operation threshold is a technical problem that needs to be solved urgently. Summary of the invention

[0006] The purpose of the present invention is to provide an efficient, accurate, low-cost, simple and convenient miRNA target analysis method.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a miRNA target integrated automatic analysis method, comprising the following steps:

[0009] Step 1: Download the whole genome sequence file (Fasta format) and genome annotation file (GFF / GTF format) of the target species from online databases such as NCBI and UCSC.

[0010] Step 2: Download the miRNA of the target species (Fasta format) from online databases such as miRbase, MicroRNAdb, and RNACentral.

[0011] Step 3: Use the genome annotation file to extract exons from the whole genome sequence file.

[0012] Step 4: Extract 5'UTR, 3'UTR and CDS from the exon file.

[0013] Step 5: Select one or more appropriate software from miRanda, PITA, RNAhybrid, TarP, and TargetScan as the core of automatic analysis of miRNA targets.

[0014] Step 6: Input the miRNA file downloaded in Step 2 and the 3'UTR / 5'UTR / CDS file extracted in Step 4 as input files, and set the corresponding parameters according to the software selected in Step 5 and run.

[0015] Step 7: After the program is finished, select the appropriate miRNA target gene as the candidate target gene according to the target site binding prediction map in the result interface to enter the next biological experiment verification, or obtain the potential target gene information file (xlsx / txt), potential target gene intersection file (xlsx / txt), Venn diagram (png / jpg) and target site binding prediction map (png / jpg) in the output folder for further analysis.

[0016] The miRNA target integrated automatic analysis method of the present invention can perform target gene prediction analysis on any species.

[0017] The present invention also provides a computer program product TarPShell, comprising a computer program, which implements the steps of the above-mentioned miRNA target integrated automatic analysis method when executed by a processor.

[0018] Preferably, the computer program product TarPShell encapsulates five target gene prediction software miRanda, RNAhybrid, PITA, TargetScan and TarP as core analysis modules.

[0019] Preferably, the computer program product TarPShell provides a visual operation interface and result interface, eliminating the need for operation in a command terminal.

[0020] Preferably, the computer program product TarPShell provides a target site binding map generation function based on the target gene prediction results and a Venn diagram drawing function based on the exogenous pyvenn package of Python language, thereby realizing a visual output result that can be directly used without the need for additional drawing and editing.

[0021] Preferably, the computer program product TarPShell uses Python as a development language, is applicable to the Linux operating system, and has no network requirements.

[0022] Preferably, the computer program product TarPShell uses the Tkinter module to implement the graphical user interface and the Threading module to implement the multi-task parallel operation mode.

[0023] The present invention also provides a computer system, comprising a memory, a processor and a computer program stored in the memory, wherein the processor executes the computer program product TarPShell.

[0024] Beneficial effects:

[0025] (1) The present invention conducts secondary development on the basis of existing target gene prediction tools, lowers the threshold for use and increases the efficiency of target gene prediction, improves its screening rate and accuracy, and can perform target gene prediction analysis on any species;

[0026] (2) The present invention provides a target gene prediction tool with simple configuration, user-friendly operation, convenience and flexibility for researchers without computer and related knowledge background, thus saving scientific research time, reducing experimental costs and lowering research thresholds for researchers who are engaged in a large number of miRNA target gene predictions.

[0027] (3) The present invention can help researchers eliminate a large number of non-target genes and non-binding sites quickly, efficiently and at a low experimental cost, saving a lot of manpower and material resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0029] Figure 1 Data preparation and usage process for TarPShell software;

[0030] Figure 2 It is the main interface of TarPShell software.

[0031] Figure 3 Exon extraction interface for TarPShell software

[0032] Figure 4 It is the UTR extraction interface of TarPShell software.

[0033] Figure 5 It is the execution control interface of TarPShell software.

[0034] Figure 6This is the result interface of the TarPShell software.

[0035] Figure 7 This is a Venn example diagram of the visualization output results of the TarPShell software.

[0036] Figure 8-10 This is a visualization output of the TarPShell software. Example of miRNA and target gene binding site prediction

[0037] Fig.11 TarP system architecture

[0038] Fig.12 TarP operation mechanism DETAILED DESCRIPTION

[0039] The present invention provides a miRNA target integrated automatic analysis method and a computer program product TarPShell, comprising a computer program, which implements the steps of the miRNA target integrated automatic analysis method when executed by a processor.

[0040] The computer program product TarPShell of the present invention is developed based on Python language, and all graphical user interfaces (GUIs) are designed based on the third-party library Tkinter library of Python language. The multi-task parallel operation mode is realized by utilizing the standard library Threading library of Python language.

[0041] In order to make the purpose, operation mode and advantages of the present invention more clearly understood, the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0042] Example 1

[0043] like Figure 1 As shown, the miRNA target prediction integrated automatic analysis software operation method provided by the embodiment of the present invention comprises the following steps:

[0044] Step 1: Download the whole genome sequence file (Fasta format) and genome annotation file (GFF / GTF format) of the target species from online databases such as NCBI and UCSC.

[0045] Step 2: Download the miRNA of the target species (Fasta format) from online databases such as miRbase, MicroRNAdb, and RNACentral.

[0046] Step 3: Use the genome annotation file to extract exons from the whole genome sequence file.

[0047] Step 4: Extract 5'UTR, 3'UTR and CDS from the exon file.

[0048] Step 5: Select one or more appropriate software from miRanda, PITA, RNAhybrid, TarP, and TargetScan as the core of automatic analysis of miRNA targets.

[0049] Step 6: Input the miRNA file downloaded in Step 2 and the 3'UTR / 5'UTR / CDS file extracted in Step 4 as input files, and set the corresponding parameters according to the software selected in Step 5 and run.

[0050] Step 7: After the program is finished, select the appropriate miRNA target gene as the candidate target gene according to the target site binding prediction map in the result interface to enter the next biological experiment verification, or obtain the potential target gene information file (xlsx / txt), potential target gene intersection file (xlsx / txt), Venn diagram (png / jpg) and target site binding prediction map (png / jpg) in the output folder for further analysis.

[0051] Example 2

[0052] Detailed explanation of each part of the computer program product TarPShell of the present invention:

[0053] 1) TarPShell main interface: Figure 2 As shown, the TarPShell main interface is mainly divided into three parts: the top menu bar, the header function area, and the middle operation area.

[0054] A. Top menu bar: The top menu bar is mainly an area reserved for this software, which is used to place some basic configurations (Configure), related packages (Packages) and corresponding help instructions (Help) and other settings for future software upgrades.

[0055] B. Header function area: The header function area is mainly divided into formatting tools (Format Tools) and extraction tools (Extract Tools).

[0056] The main formatting tools are:

[0057] ① Tool to convert table format into text format (Excel to Txt);

[0058] ② Tool to convert text format into table format (Txt to Excel);

[0059] ③ Tool to convert GFF3 format to GTF format (Gff3 to Gtf);

[0060] ④GTF to GFF3 format conversion tool (Gtfto Gff3)

[0061] ⑤Extract file list tool (Generate File List).

[0062] The main extraction tools are:

[0063] ①Extract Exon Tool;

[0064] ② Extract UTR tool (Extract UTR);

[0065] In order to facilitate user operation, the operation interface style of all tools of the present invention is the same. Figure 3 and Figure 4 As shown in the figure, the operation interface layout of the two extraction tools consists of four parts:

[0066] a. The upper part is the parameter setting area, which is mainly used to set input file parameters, output file parameters and other related parameters.

[0067] b. The middle part is the execution area, which only has a start execution button. Click the button to start the program execution.

[0068] c. The lower part is the control area, which mainly contains the interrupt program button, clear console button and console. The interrupt program button mainly interrupts the executing program and closes the execution window, the clear console button mainly clears the characters in the console, and the console mainly displays the output, error, exception and return value of the program during operation.

[0069] d. The bottom is the auxiliary area, which usually only contains the close window button, and a few contain the save button and apply button.

[0070] C. Main operation area: The main operation area is divided into three parts: the software area on the left, the parameter area in the middle, and the command area on the right.

[0071] a. Software area on the left: This area mainly contains five commonly used miRNA target gene prediction software packages: miRanda, PITA, RNAhybrid, TarP and TargetScan. In this area, users can select one or more suitable software for analysis according to their needs.

[0072] b. Middle parameter area: This area is mainly divided into three parts. The first part is parameter setting; the second part is parameter management; and the third part is program entry.

[0073] ①Parameter setting part: mainly used to set the basic parameters required by the left software area, including input, output parameters and other parameters. Other parameters can be set in detail by clicking the expansion button. Other parameters mainly include the detailed parameter queue automatically generated by the software selected by the user. In the detailed parameter area of ​​each software, relevant parameters can be set separately.

[0074] ②Parameter management section: mainly contains four buttons: Clear Parameters, Import Parameters, Save Parameters, and Parameter Description. Their functions are: Clear Parameters button clears all input and output parameters in the parameter setting section, and other parameters return to the default values; Import Parameters button imports previously saved parameter values ​​(previous parameters are saved in the parameter file); Save Parameters button saves the currently set parameters in the parameter file; Parameter Description button automatically generates the software description and detailed parameter introduction of the software according to the software selected by the user.

[0075] ③Program entry part: This part only places a program entry button. Click this button to enter the program execution interface.

[0076] c. Right command area: This area is mainly divided into two parts: editing area and control area.

[0077] ① Editing area: The editing box in the editing area is mainly used to input Linux operating system terminal commands, which is equivalent to the input panel of the Linux operating system terminal. Since this area is only used for command input, some functions of the actual terminal, such as interactive commands, cannot be realized. However, the existence of this section also has its practical significance. For example, if you need to know all the directories and subdirectories structure and directory permissions under the current directory, you can directly and effectively obtain them by entering the "tree-apP. / " command in this section, without having to query in the Linux terminal.

[0078] I. The edit box is in editable mode by default. Click " <read>" button to change to reading mode. In reading mode, you can only browse commands but not edit them, which can effectively prevent accidental touches.

[0079] II. The editing area provides<Open File> " button. Clicking this button can return the path of the file to the edit box after visually selecting the file, effectively improving the efficiency of path input and reducing the error input rate of file path.

[0080] III.Editorial area provides <clear>" button. Click this button to clear all command characters in the editing area with one click.

[0081] ②Control area: The console in the control area is mainly used to output the results of the edit box operation, including output, errors, exceptions during the operation, and return values ​​after the operation ends.

[0082] I. Controlled area provides <start>" button. Click this button to run all the commands entered in the editing area.

[0083] II. Controlled Area Provides" <break>" button. Clicking this button can interrupt the currently running process and return the corresponding exception information in the control area.

[0084] III. Controlled Area Provides" <clear>" button. Click this button to clear all the characters in the console with one click.

[0085] 2) TarPShell execution control interface: such as Figure 5 As shown, the execution control interface of TarPShell is mainly divided into the upper editing area, the middle timing area, the lower control area, and the bottom auxiliary area.

[0086] ①Editing area: The editing area of ​​the execution control interface is different from the editing area of ​​other execution interfaces. The editing box in this editing area is mainly used to display the Linux execution commands automatically generated by TarPShell's automatic command generation algorithm. The implementation principle of this automatic command generation algorithm is mainly based on the miRNA target gene software selected by the user in the main interface and the specific parameters set by it, and through a certain algorithm to achieve the purpose of automatically generating the corresponding Linux execution command. For users without relevant knowledge background, we generally do not recommend editing the command content in this editing box, and only recommend a simple check. For researchers with relevant professional backgrounds, they can edit it independently if necessary.

[0087] I. The edit box is in browse mode by default. Click " <edit>" button to change to edit mode. In edit mode, you can modify the content in the edit box at will. Non-professionals should click this button with caution to avoid accidentally touching the edit box and causing unnecessary command errors.

[0088] II. The editing area provides<Open File> " button. Clicking this button will pop up the file management window. Users can visually select the target file and its file path will be automatically entered into the edit box after returning, which effectively improves the input efficiency of the file path and reduces the error input rate of the file path.

[0089] III.Editorial area provides <clear>" button. Click this button to clear all command characters in the editing area with one click.

[0090] ② Timing area: The timing area is mainly composed of three parts: progress bar, timing board and pre-time board.

[0091] I. Progress bar: This is a status-type progress bar, which only displays the running status and does not reflect the running progress.

[0092] II. Timing board: This timing board measures time in seconds and displays the time the program has been executed in real time.

[0093] III. Prediction panel: This prediction panel is used to predict the total time that may be required to execute all commands in the edit box. The total time is calculated as follows:

[0094] Total time = ∑[(Number of target gene sequences in the input file * Number of miRNA sequences in the input file * Weight of the software used * Seconds]

[0095] The weight of the software used is the average value obtained from multiple experiments. It should be noted that the total time here is the predicted total time, not the actual total time required, and there may be a certain error with the final actual time of program execution.

[0096] ③Control area: The console in the control area is mainly used to output the results of the edit box operation, including output, errors, exceptions during the operation, and return values ​​after the operation ends.

[0097] I. Controlled area provides <start>" button. Click this button to run all commands entered in the editing area. (Same as other execution windows)

[0098] II. Controlled Area Provides" <break>" button. Click this button to interrupt the currently running process and return the corresponding exception information in the control area. (Same as other execution windows)

[0099] III. Controlled Area Provides" <clear>" button, click this button to clear all characters in the console with one click. (Same as other execution windows)

[0100] 3) TarPShell result interface: Figure 6 As shown, the result interface of TarPShell is mainly composed of three areas: the drawing area on the left, the prompt area on the upper right, and the list area on the lower right.

[0101] ① Drawing area: The drawing area mainly refers to the parameter setting area for drawing the Venn diagram. This area is set as the file group area, general parameter area and execution control area. Figure 1 It is generally only used for result files generated within this software; external files may contain text errors.

[0102] I. File group area: We regard each file containing a gene name as a file group. The format of the file is one gene name per line. Each file group needs a group name and the color of the area drawn on the Venn diagram. You can also use the default value without modification. The color parameters in this area are the three color channels r, g, and b and the transparency parameter (a). After the user has set them, click the "OK" button to browse the preset colors in the color preview box. File group area We usually recommend setting two or more file groups. If you only set one file group, no drawing will be done, and only the transferred files and related contents will be displayed in the list area.

[0103] II. General Parameters Area: The General Parameters Area is mainly used to set some general parameters for drawing Venn diagrams, including picture size (Figure Size), font size (Font Size), picture resolution (dpi) and the miRNA name (SouName) corresponding to the target gene file passed in. The width (Width) and height (Height) of the picture are set separately; the picture size, font size and picture resolution all have recommended default parameters.

[0104] III. Execution Control Area: The execution control area only places one program execution" <start>"Button, click this button to start the program.

[0105] ② Prompt area: The prompt area mainly contains three important prompts. The first prompt is the absolute path of the directory of all output results of target analysis performed by this software, and next to it is placed " <copy>" button, click this button to copy the path to the clipboard; the second prompt is the absolute path of the directory where the target analysis program or Venn diagram drawing program ends the generated Venn diagram; the third prompt is that users can click the " <look>" button to view the Venn diagram generated by this program.

[0106] ③ List area: The list area mainly displays the results of the target prediction program, that is, miRNA and its corresponding potential target genes. The list area is mainly divided into three parts: table header, data content, and page management area.

[0107] I. Header: The header is mainly set as the serial number (Number), target gene name (Target), miRNA name (Source) and the potential binding site (Combine Site) between miRNA and its target gene.

[0108] II. Data content: The data content is the data result corresponding to the table header after the program is executed. The column of potential binding sites of miRNA and its target gene is placed with " <read>" button. Click this button to browse the potential target site binding map predicted by the selected target prediction software.

[0109] III. Page management area: The page management area is mainly used for page turning and page jump. There are four buttons for page turning: Home, Up, Down, and Last. Click the corresponding button to turn the page. To jump to a page, enter the target page in the page input box in the middle of the page management area and click the Enter key on the keyboard.

[0110] 4) TarPShell picture display page: Figure 7 and Figure 8-10 As shown, the TarPShell image display page is mainly used to display the image results of the TarPShell software. By right-clicking the page, a hidden menu will pop up. The menu bar contains functions such as page turning, importing, saving, editing, and closing. Among them, the importing, saving, and editing functions are reserved functions.

[0111] ① Page turning: The page turning function is used to browse the previous and next pictures. The previous and next pictures here mainly refer to the pictures in the same picture group. If it is a Venn diagram, the page turning is the Venn diagram with different miRNAs as the main body in the same analysis; if it is a potential target site binding map, the page turning is the potential target site binding map predicted by different target analysis software.

[0112] ②Import: The import function is to import pictures from local to this page for browsing.

[0113] ③Save: The save function is to save the image currently displayed on this page to a local directory.

[0114] ④Edit: The editing function is to implement simple editing functions on the picture being displayed on this page.

[0115] ⑤Close: The close function is to close the hidden menu.

[0116] Example 3

[0117] The operation flow of the computer program product TarPShell of the present invention is as follows:

[0118] Step 1: Obtain the name and sequence of the target miRNA. Figure 1 As shown, miRNA sequences can be obtained from online databases such as miRBase, MicroRNAdb, and RNACentral. Copy and paste the obtained miRNA sequences and names into a new file. In this example, three miRNAs are selected as target miRNAs. Users can select one or more miRNAs as target miRNAs at will. The format is as follows:

[0119] >aae-miR-1174

[0120] UCAGAUCUACUUAAUACCCAU

[0121] >aae-miR-1175-5p

[0122] AAGUGGAGUAGUGGUCUCAUCG

[0123] >bmo-let-7

[0124] UGAGGUAGUAGGUUGUAUAGU

[0125] Save the new file and name it input_mir.fa. Move the input_mir.fa file to the TarPShell / User / INPUT directory of the TarPShell software.

[0126] Step 2: Obtain the whole genome file and genome annotation file of the research species. Figure 1 As shown in the figure, the whole genome file (Fna / Fa format) and genome annotation file (GFF format) can be obtained from online databases such as NCBI, UCSC, Vector Base, SilkDB, etc. Rename the obtained whole genome file and genome annotation file to input_geno.fna and input_geno.gff, respectively, and move the input_geno.fna and input_geno.gff files to the TarPShell / User / INPUT directory of the TarPShell software.

[0127] Step 3: Run TarPShell software. Open the Linux operating system command line terminal, and switch the current working path in the terminal to the path where the TarPShell.py file is located in the TarPShell software directory. Enter: python3TarPShell.py in the command line. Enter this command and press Enter to display the main interface of TarPShell, after which the user can directly operate in the graphical user interface of the TarPShell software. It is worth noting here that if it is the first time to run, you also need to download and install the corresponding python3 third-party library according to the dependency library requirements prompted by the README.txt file in the TarPShell directory.

[0128] Step 4: Extract the corresponding exons from the whole genome file according to the genome annotation file. Figure 2 As shown in the figure, find the first item "Extract Exon" in the extraction toolbar in the head tool area, click on it and the following will appear: Figure 3 The operation window for extracting exons is shown. In this window, "GffFile" refers to the input_geno.gff file in the second step, "Geno File" refers to the input_geno.fna file in the second step, and "Exon Fdir" refers to the path of the directory where the output exon file is located. The above three paths are absolute paths. It is recommended that users directly click the corresponding " <openfile>"or"<Open Fdir> " button to prevent input errors; "Exon Name" refers to the file name of the output exon file. After setting the parameters, click " <start>"Start the extraction process, and an Exon file will be generated after the process is completed.

[0129] Step 5: Extract the UTR file based on the exon file extracted in step 4. Same as step 4, in the second entry "Extract Utr" of the extraction tool, click on this entry and the following will appear: Figure 4 The operation window for extracting Utr is shown. In this window, "Exon File" refers to the absolute path of the exon file extracted in step 4, and "Utr Fdir" refers to the path of the directory where the output Utr file is located. As above, it is recommended that users directly click the corresponding "<Open File> "or" <openfdir>" button to prevent input errors; "Utr Prex" refers to the prefix of the output Utr file name. After setting the parameters, click " <start>"Start the extraction process. After the process is completed, 5'UTR, 3'UTR and CDS files will be generated.

[0130] Step 6: Select target prediction software. In the software area of ​​the TarPShell main interface, select the appropriate prediction software from the five miRNA target gene prediction software: miRanda, PITA, RNAhbrid, TarP and TargetScan.

[0131] Step 7: Set the execution parameters of the target prediction software. According to the prediction software selected in step 6, set the corresponding parameters in the parameter area of ​​the TarPShell main interface, click " <expand>" button to set the detailed execution parameters of the selected software. "prefile" refers to the input_mir.fa file in the first step; "tarfile" refers to the 5'UTR, 3'UTR or CDS file in the fifth step. Here we usually study the 3'UTR of the gene; "outfdir" refers to the absolute path of the output file directory. For the above three, we recommend that users directly click the corresponding "<Open File> "or"<Open Fdir> " button to prevent input errors. The specific execution parameters of each software have default values, and users with needs can set them by themselves. After the parameters are set, click " <enter>" button to enter the execution control interface of TarPShell.

[0132] Step 8: Check the command and execute it. Figure 5 As shown, check whether the automatically generated command has any errors in the edit box of the TarPShell execution control interface. If there are any errors, click " <edit>" button to modify. After checking, click the " <start>" button to start the program execution.

[0133] Step 9: Browse the results, select appropriate candidate target genes, and proceed to the next step of biological experiment verification. Figure 6 As shown, click " <look>” button to view Figure 7 The Venn diagram shown; in the list area, click " <read>” button to view Figure 8-10 As shown in the target site binding prediction diagram, it is worth mentioning that among the five miRNA target gene prediction software encapsulated by TarPShell software, only miRanda, RNAhybrid and TarP have target site binding prediction diagrams. Users can select the final miRNA candidate target genes by referring to the target site binding prediction diagram and proceed to the next step of biological experiment verification.

[0134] Example 4

[0135] TarP Software Architecture

[0136] The system architecture of the computer program TarP is as follows Fig.11 As shown, the operating mechanism is as follows Fig.12 shown.

[0137] 1. Input unit: Every two lines in the input file are used as an input unit, one line is the gene name starting with ">", and the other line is the corresponding base sequence; one is an input unit for miRNA and the other is an input unit for target gene.

[0138] 2. Prediction unit: A prediction unit is composed of a miRNA input unit and a target gene input unit.

[0139] 3. Alignment unit: When TarP program performs alignment, it splits the prediction unit into multiple base sequence fragments based on the set jump parameter and move parameter based on the principle of polymorphic structured base alignment, and then sequentially combines them into new miRNA sequences and target gene sequence fragments, which are called alignment units. The number of alignment units that can be formed by a prediction unit is equal to the length of the target gene sequence in the prediction unit divided by the movement amount, rounded to the integer. If the remainder is greater than 0, add 1, otherwise do not add; for example, the length of the target gene sequence in a prediction unit is 200, and the set movement amount is 3. Since 200 divided by 3 is equal to 66 with a remainder of 2, where 2>0; therefore, the number of alignment units generated in the end is 66+1=67.

[0140] 4. Output unit: Perform polymorphic structured base alignment on each alignment unit, and add blank bases "O" to the base sites that have not been successfully aligned within the allowed base shift range to form a new base sequence; each alignment unit will form a miRNA output unit and a target gene output unit after alignment by the alignment algorithm.

[0141] 5. Principles of polymorphic structured base matching:

[0142] (1) Polymorphic base combination: Polymorphic base combination refers to a variety of base matching form combinations summarized based on Francis Crick's central dogma and the biological principle of miRNA targeted binding to target genes. The main combinations are as follows:

[0143] Among them, 0 and 1 represent the matching status of the base, 0 represents no match, and 1 represents a match.

[0144] ①Group 1: 1+~, where ~ represents a continuous base sequence, and 1+ means that the alignment is confirmed when the first base of miRNA matches;

[0145] ②Group 2: ~+1, where ~ has the same meaning as above, and +1 means that the alignment is confirmed when the previous continuous base sequence matches;

[0146] ③Group 3: 11, indicating that the alignment is confirmed when there are two consecutive matching bases at the same time;

[0147] ④Group 4: 0111, indicating that the alignment is determined when the first base of four consecutive bases does not match and the last three consecutive bases match;

[0148] ⑤Group 5: 00111, indicating that the alignment is determined when the first two consecutive bases of the five consecutive bases do not match and the last three consecutive bases match;

[0149] ⑥Group 6: 000111, indicating that the alignment is determined when the first three consecutive bases of the six consecutive bases do not match and the last three consecutive bases match;

[0150] (2) Structured alignment method: The structured alignment method refers to a method based on the principle of polymorphic base combination and base complementary pairing, following a complete and fixed alignment procedure from extracting input units, combining prediction units, splitting alignment units to matching output units. It adopts the following scientific and professional scoring system and energy score system, and sets certain thresholds for sorting, integration, screening, etc., so as to efficiently and accurately obtain the target prediction method of miRNA candidate target genes.

[0151] 6. Rating system:

[0152] (1) Weight coefficient: used to measure the importance of each base site of miRNA

[0153] W1: the first base at the 5'->3' end of miRNA;

[0154] W2: the second to eighth seed sequence at the 5′->3′ end of the miRNA;

[0155] W3: three important bases from position 11 to 13 at the 5'->3' end of miRNA;

[0156] W4: other bases at the 5'->3' end of miRNA;

[0157] (2) Correction factor: W5, used to correct the quantitative relationship between the scores of matched and mismatched bases

[0158] (3) Proportional coefficient: W x , used to adjust the proportional relationship of each weight coefficient, the formula is as follows:

[0159]

[0160] (4) miRNA base sequence:

[0161] Mir Len : The total number of bases in the miRNA sequence, i.e., the total length;

[0162] (5) Matching base values:

[0163] Match A : The first base at the 5'->3' end of miRNA is an A base and the number of matches;

[0164] Match Seed : the number of seed sequence matches at the 5'->3' end of the miRNA;

[0165] Match 11to13 : The number of matches from the eleventh to thirteenth bases at the 5'->3' end of miRNA;

[0166] Match Other : The number of other base matches at the 5'->3' end of miRNA;

[0167] The formula is as follows:

[0168]

[0169] (6) Mismatched base values:

[0170] Loop A : The number of unmatched first bases at the 5'->3' end of miRNA;

[0171] Loop Seed : The number of unmatched seed sequences at the 5'->3' end of the miRNA;

[0172] Loop 11to13 : The number of mismatches from the eleventh to thirteenth bases at the 5'->3' end of the miRNA;

[0173] Loop Other : The number of other unmatched bases at the 5'->3' end of miRNA;

[0174] The formula is as follows:

[0175] Score Loop =W1×Loop A +W2×Loop Seed +W3×Loop 11to13 +W4×Loop Other

[0176] (7) Gap base value:

[0177] Gap Num : The number of bases forming a gap at the 5'->3' end of miRNA;

[0178] The formula is as follows:

[0179] Score Gap =Gap Num ×W5

[0180] (8) Scoring formula: as follows

[0181]

[0182] 7. Energy score system:

[0183] (1) A:T base pair value:

[0184] Match AT : indicates the number of A:T base pairs contained in the output unit;

[0185] (2) C:G base pair value:

[0186] Match CG : Indicates the number of C:G base pairs in the same alignment unit;

[0187] (3) U:G base pair value:

[0188] Match UG : Indicates the number of U:G base pairs in the same alignment unit;

[0189] (4) Total base pair values:

[0190] Match ALL : Indicates the number of all base pairs in the same alignment unit;

[0191] (5) Energy formula: as shown below

[0192]

[0193] 8. TarP parameter system:

[0194] -prefile<file path> : It is the abbreviation of prediction file, which is mainly an input file containing miRNA names and corresponding sequences, which can be in txt or fa format;

[0195] -tarfile<file path> : It is the abbreviation of target file, which is mainly an input file containing the target gene name and corresponding sequence, which can be in txt or fa format;

[0196] -outfdir<directory path> : is the folder path where the output results are located;

[0197] -outfpre<file name prefix> :(default:TarPPreResult) is the file name prefix of the output result file, the default is "TarPPreResult";

[0198] -weight <string>:(default:5,20,10,1,0.5) is the weight of bases at different positions in the miRNA sequence. The default is "5,20,10,1,0.5", where 5 indicates the importance of the first base at the 5' end of the miRNA, 20 indicates the importance of the miRNA seed sequence, 10 indicates the importance of bases at positions 11-13 at the 5' end of the miRNA, 1 indicates the importance of bases at positions other than the above sites, and 0.5 indicates the importance of non-matching bases.

[0199] -jump <value>:(default:3) indicates the maximum number of bases allowed to form a single loop when aligning miRNA with its target gene;

[0200] -move <value>:(default:14) indicates the base displacement of miRNA on its target gene when it is compared with its target gene;

[0201] -score <value>:(default:75) indicates screening candidate target genes with scores higher than the set threshold, as a percentage. The higher the value, the higher the possibility of screening candidate target genes;

[0202] -fe <value>:(default:50) means to screen candidate target genes whose energy scores are higher than the set threshold, as a percentage. The higher the value, the more stable the predicted candidate target gene is and the greater the possibility is.

[0203] -tarnum <value>:(default:1) indicates that when miRNA matches the same target gene, it outputs the best matching target binding sites. That is, the same prediction unit can predict the number of output units that can be screened;

[0204] -thread <value>:(default:1) Multi-threaded operation mode, used to liberate operation and improve operation efficiency. The host needs to meet the multi-threaded operation conditions. It is mainly used when the input file is very large. The default value is 1. When the input file is too large, the number of threads can be appropriately increased;

[0205] -ug<string:no|yes> :(default:no) indicates whether G:U base pairing is allowed;

[0206] -display<string:on|off> : (default: off) indicates whether the target prediction process is visible, that is, whether to print the output results of the prediction process;

[0207] -v, --version: print software version number;

[0208] -h, --help: Print the software help manual.

[0209] Although the above embodiment provides a detailed description of the present invention, it is only one embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the design ideas, code scripts, spirits and principles of the present invention should be included in the protection scope of the present invention.< / value> < / value> < / value> < / value> < / value> < / value> < / string> < / read> < / look> < / start> < / edit> < / enter> < / expand> < / start> < / openfdir> < / start> < / openfile> < / read> < / look> < / copy> < / start> < / clear> < / break> < / start> < / clear> < / edit> < / clear> < / break> < / start> < / clear> < / read>

Claims

1. A miRNA target integrated automatic analysis method, characterized in that: The following steps are involved: Step 1: Download the whole genome sequence file and genome annotation file of the target species from online databases such as NCBI and UCSC. The whole genome sequence file is in Fasta format, and the genome annotation file is in GFF / GTF format; Step 2: Download the miRNA of the target species from the online databases of miRbase, MicroRNAdb, and RNACentral. The files are in Fasta format. Step 3: Extract exons from the whole genome sequence file using the genome annotation file; Step 4: Extract 5'UTR, 3'UTR and CDS from the exon file; Step 5: Use miRanda, PITA, RNAhybrid, TarP, and TargetScan as the core of automatic analysis of miRNA targets; Step 6: Input the miRNA file downloaded in Step 2 and the 3'UTR / 5'UTR / CDS file extracted in Step 4 as input files, and set the corresponding parameters according to the software selected in Step 5 and run; Step 7: After the program is finished running, the potential target gene file, potential target gene intersection file, Venn diagram and target site binding prediction diagram are obtained in the output folder for further analysis; the user selects the miRNA candidate target gene and proceeds to the next step of biological experiment verification; The miRNA target integrated automatic analysis method can perform target gene prediction analysis on any species; The operation of the TarP system includes the following procedures: (1) The miRNA file and its potential target gene file are used as input units respectively; (2) extracting two input units from the miRNA file and the target gene file in step (1) to form a prediction unit; (3) Setting the shift amount and the number of skips, splitting into multiple alignment units based on the shift amount and the number of skips and based on the polymorphic base combinations, aligning and generating output units, using the scoring system and the energy score system to calculate and analyze the score and energy score of each output unit, screening suitable potential target genes based on the score and energy score, and formatting the output.

2. A computer program product TarPShell, comprising a computer program, characterized in that: When the computer program is executed by a processor, the steps of the miRNA target integrated automatic analysis method according to claim 1 are implemented.

3. The computer program product TarPShell according to claim 2, characterized in that: The computer program product TarPShell encapsulates five target gene prediction software miRanda, RNAhybrid, PITA, TargetScan and TarP as core analysis modules.

4. The computer program product TarPShell according to claim 2, characterized in that: The computer program product TarPShell provides a visual operation interface and result interface, and there is no need to operate in a command terminal.

5. The computer program product TarPShell according to claim 2, characterized in that: The computer program product TarPShell provides a target site binding map generation function based on the target gene prediction result and a Venn diagram drawing function based on the exogenous pyvenn package of Python language.

6. The computer program product TarPShell according to claim 2, characterized in that: The computer program product TarPShell uses Python as a development language, is applicable to the Linux operating system, and has no network requirements.

7. The computer program product TarPShell according to claim 2, characterized in that: The computer program product TarPShell uses the Tkinter module to implement a graphical user interface and uses the Threading module to implement a multi-task parallel operation mode.

Images