A lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor and its preparation method and application

Abstract

The present invention relates to the field of biomedicine technology, and specifically to a lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor, and a preparation method and application thereof. The lysosome-targeted chimera includes an aptamer targeting the endothelial vascular growth factor to be degraded and an aptamer of a lysosome-targeted receptor, wherein the aptamer targeting the endothelial vascular growth factor to be degraded can target and bind to the endothelial vascular growth factor, and the aptamer of the lysosome-targeted receptor can transport the bound endothelial vascular growth factor into the lysosome for specific degradation. The lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor provided by the present invention provides a new idea for the treatment of neovascular eye diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor, and a preparation method and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Neovascular eye diseases are a type of disease that causes visual impairment with a high incidence rate. With the increase of age, the aggravation of myopia or the development of related metabolic diseases, some unnecessary blood vessels will be formed in the fundus. These new blood vessels will invade the choroid, retinal photoreceptor layer and other normal fundus tissues, leading to the occurrence of fundus diseases such as age-related macular degeneration (AMD), pathological myopia (PM) or diabetic retinopathy (DR), which will impair visual function and even lead to blindness in severe cases. Among them, age-related macular degeneration and diabetic retinopathy are the two most common types of neovascular eye diseases. At present, the number of patients with neovascular eye diseases is more than 40 million, and as the aging of the population increases, the number of patients is still rising.

[0004] Studies have shown that the main signaling pathway responsible for physiological and pathological angiogenesis in the eye is the vascular endothelial growth factor (VEGF) pathway. Many studies have shown that the expression of VEGF and its receptors is significantly upregulated in human neovascular ocular tissue.

[0005] Therefore, currently, intravitreal injection of anti-VEGF drugs is the first-line treatment for neovascular eye diseases. Commonly used anti-VEGF drugs include ranibizumab, conbercept and aflibercept. Intravitreal injection of anti-VEGF drugs can improve the baseline vision of patients with wet AMD, reduce macular edema in patients with diabetic macular edema, inhibit neovascularization in patients with retinal vein occlusion, and inhibit choroidal neovascularization and leakage in patients with pathological myopia CNV, so as to achieve the effect of improving vision. However, due to their large molecular structure and strong hydrophilicity, these drugs have poor permeability in the blood-ocular barrier, which limits the therapeutic efficiency of the drugs. Therefore, clinical treatment usually requires injection once a month, and even so, its effective rate is only 40% to 60%. This treatment method not only increases the treatment cost of patients, but also may increase the risk of complications, including submacular hemorrhage, intraocular hypertension, endophthalmitis and retinal detachment. Therefore, a new drug for the treatment of neovascular eye diseases is urgently needed. Summary of the invention

[0006] In order to overcome the above problems, the present invention provides a lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor, and a preparation method and application thereof.

[0007] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides a lysosome targeting chimera for targeted degradation of endothelial vascular growth factor, comprising: an aptamer targeting the endothelial vascular growth factor to be degraded and an aptamer for a lysosome targeting receptor; the aptamer targeting the endothelial vascular growth factor to be degraded comprises a connection probe Linker1; the aptamer for the lysosome targeting receptor comprises a connection probe Linker2; the aptamer targeting the endothelial vascular growth factor to be degraded and the aptamer for the lysosome targeting receptor are connected by complementary base pairing of the connection probes Linker1 and Linker2.

[0009] In one or more embodiments, the nucleotide sequence of the aptamer targeting endothelial vascular growth factor to be degraded is shown in SEQ ID NO.1, including:

[0010] TATGACTGATTTACGTGTGGGGG TGTGGGGGTGGACGGGCCGGGTAGA;

[0011] The underlined portion in the sequence listing of SEQ ID NO.1 is the nucleotide sequence of the ligation probe Linker1.

[0012] In one or more embodiments, the nucleotide sequence of the aptamer of the lysosomal targeting receptor is as shown in SEQ ID NO.2, comprising:

[0013] CCCCCACACGTAAATCAGTCATA GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC;

[0014] The underlined portion in the sequence listing of SEQ ID NO.2 is the nucleotide sequence of the ligation probe Linker2.

[0015] The second aspect of the present invention provides a method for preparing the above-mentioned lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor, comprising:

[0016] The aptamer targeting endothelial vascular growth factor to be degraded and the aptamer targeting lysosome receptor are respectively subjected to high temperature annealing, and the aptamer targeting endothelial vascular growth factor to be degraded and the aptamer targeting lysosome receptor after high temperature annealing are added to a buffer solution, T4 ligase is added, and after incubation, a lysosome targeting chimera targeting endothelial vascular growth factor is obtained.

[0017] In one or more embodiments, the high temperature of the high temperature annealing is 90-100°C, preferably 95°C; and the annealing temperature of the high temperature annealing is 0°C.

[0018] In one or more embodiments, the buffer solution is a phosphate buffered saline (DPBS buffer solution).

[0019] In one or more embodiments, the incubation temperature is 30-40° C., preferably 37° C.; the incubation time is 0.5-2 h, preferably 1 h.

[0020] In one or more embodiments, the molar ratio of the aptamer targeting endothelial vascular growth factor to be degraded and the aptamer targeting the lysosome receptor is 1:1.

[0021] In one or more embodiments, based on 10 to 14 μM of the aptamer targeting endothelial vascular growth factor to be degraded, the amount of T4 ligase added is 0.8 to 1.2 μL, preferably 1 μL.

[0022] The third aspect of the present invention provides a pharmaceutical composition comprising the lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor described in the first aspect.

[0023] The fourth aspect of the present invention provides a pharmaceutical preparation comprising the lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor as described in the first aspect and at least one pharmaceutically acceptable excipient and / or carrier.

[0024] The excipients of the present invention refer to ingredients other than the active ingredients in a pharmaceutical composition or pharmaceutical preparation, which are non-toxic to the subject. Commonly used excipients in the art include buffers, stabilizers, preservatives or excipients, and commonly used excipients include binders, fillers, wetting agents, disintegrants, etc.

[0025] As an example, the excipients that can be used in the preparation of the present invention include but are not limited to: the excipient is selected from calcium phosphate, magnesium stearate, talc, dextrin, starch, gel cellulose, methyl cellulose, carboxymethyl cellulose sodium salt and polyvinyl pyrrolidone.

[0026] The drug carrier of the present invention can be a pharmaceutically acceptable solvent, suspending agent, vesicle, nanomaterial, etc., which is used to deliver the compound described in the first aspect of the present invention to an animal or human body. The carrier can be liquid or solid and is selected according to the planned administration method. Proteins and liposomes are also drug carriers.

[0027] Those skilled in the art can prepare the compounds of the present invention into pharmaceutical compositions or preparations using known techniques. For example, any compound (at least one compound) disclosed in the above-mentioned first aspect of the present invention is mixed with a pharmaceutical excipient, and then, if necessary, the resulting mixture is formed into a desired shape. Except for those mentioned in the present invention, pharmaceutical preparations can also be prepared according to known pharmaceutical preparations. And, except for those mentioned in the present invention, suitable pharmaceutical excipients are known in the art, for example, referring to the 2005 edition of the Handbook of Pharmaceutical Excipients (Original Fourth Edition).

[0028] The fifth aspect of the present invention provides the use of the lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor described in the first aspect and / or the pharmaceutical composition described in the third aspect in degrading endothelial vascular growth factor.

[0029] The sixth aspect of the present invention provides the use of the lysosomal targeting chimera for targeted degradation of endothelial vascular growth factor described in the first aspect and / or the pharmaceutical composition described in the third aspect in the preparation of a drug for treating or assisting in the treatment of diseases related to the degradation of endothelial vascular growth factor.

[0030] In one or more embodiments, the associated disease comprises a neovascular eye disease.

[0031] Preferably, the neovascular eye diseases include wet macular degeneration, diabetic macular edema, diabetic retinopathy, outer exudative retinopathy, retinal vein occlusion, corneal neovascularization, pathological myopic CNV, neovascular glaucoma, uveitis, polypoidal choroidal vasculopathy, and radiation optic neuropathy.

[0032] The beneficial effects of the present invention are:

[0033] (1) The present invention provides a lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor, including an aptamer targeting the endothelial vascular growth factor to be degraded and an aptamer of a lysosome-targeted receptor, wherein the aptamer targeting the endothelial vascular growth factor to be degraded can target and bind to the endothelial vascular growth factor, and the aptamer of the lysosome-targeted receptor can transport the bound endothelial vascular growth factor into the lysosome for specific degradation. The lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor provided by the present invention provides a new idea for the treatment of neovascular eye diseases.

[0034] (2) The present invention verifies that the lysosome-targeted chimera targeting the degradation of endothelial vascular growth factor can degrade VEGF well in vitro through enzyme-linked immunosorbent assay, and at the same time, in vitro, ex vivo and in vivo experiments in mice show that the lysosome-targeted chimera targeting the degradation of endothelial vascular growth factor can inhibit angiogenesis. This provides a basis for the lysosome-targeted chimera targeting the degradation of endothelial vascular growth factor to be used for the treatment of neovascular eye diseases. Further experiments on oxygen-induced retinopathy (OIR) mouse model and mouse DR model verify that it can be used for the treatment of neovascular eye diseases with significant effects.

[0035] (3) The lysosome-targeted chimera for degrading endothelial vascular growth factor provided by the present invention has a small molecular weight and can quickly penetrate tissues, so the treatment efficiency is high. At the same time, the preparation method is simple and the cost is low. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0037] Figure 1 For Example 1 Figure 1 The synthesis process of lysosomal targeting chimeras V1 to V6 for targeted degradation of endothelial vascular growth factor;

[0038] Figure 2 In Example 1, the synthesis results of V1 to V6 were verified by electrophoresis, a is the synthesis result of V1 to V3, and b is the synthesis result of V4 to V6;

[0039] Figure 3 The stability results of V1 to V6 analyzed by natural polyacrylamide gel in Example 1;

[0040] Figure 4 MST is used to analyze the binding affinity of the lysosome targeting chimera to VEGF or M6PR protein, a is the result diagram of the binding affinity to VEGF, and b is the result diagram of the binding affinity to M6PR protein;

[0041] Figure 5 The VEGF level in HUVECs was analyzed by ELSIA method in Example 2 after treatment with V4, V5 or V6 for 12 hours (n=3 independent experiments);

[0042] Figure 6 a is the VEGF level of HUVECs treated with the designated aptamer or V5 for 12 hours analyzed by ELSIA method in Example 2 (n=3 independent experiments)

[0043] Figure 7 This is a fluorescent image of lysosomal co-localization of HUVECs treated with a single aptamer or V5 labeled with cy5 in Example 2;

[0044] Figure 8 a is the immunoblot analysis of M6PR and β-actin in HUVECs transfected with control or M6PR siRNA and treated with different concentrations of V5 in Example 3; b is the ELSIA analysis of VEGF levels in HUVECs transfected with control siRNA or M6PR siRNA and treated with different concentrations of V5;

[0045] Fig. 9 The figures are the effects of V5 in inhibiting VEGF-dependent angiogenesis in vitro and in vitro in Example 4, wherein a is an image of the scratch migration test of HUVECs treated with different concentrations of V5; b is an image of the aortic ring sprouting test of mice treated with different concentrations of V5;

[0046] Fig.10 The figures are effect diagrams of the in vivo stability and effectiveness of V5 in mouse eye tissue in Example 5, and effect diagrams of V5 inhibiting VEGF-induced retinal neovascularization in mice, wherein a is an in vivo imaging system image of mice injected with 2 μM Cy5-V5 at a specified time (left side), and injected with different concentrations of Cy5-V5 for 48 hours (right side); b is an immunofluorescence image of anti-CD31 staining of retinal blood vessels after injection of VEGF or IgG (control group) and different concentrations of V5;

[0047] Fig.11 Figure 5 is a graph showing the effect of V5 on anti-angiogenesis in the OIR mouse model in Example 5, wherein a is a fluorescent image of the retina of OIR mice injected with different concentrations of V5 and in the control group with anti-CD31 staining; b is a fluorescent image of the retina of OIR mice injected with different concentrations of V5 and in the control group with anti-CD31 staining; -2 ERG measurements of retinal a-wave amplitudes in OIR mice injected with different concentrations of V5 and in the control group under flash intensity; c is at 3 cd sm -2 ERG measurement of retinal b-wave amplitude in OIR mice injected with different concentrations of V5 and in the control group under flash intensity;

[0048] Fig.12Figure 6 shows the effect of V5 on pathological retinal neovascularization in DR mice. a is a fluorescent image of the retina of diabetic mice injected with different concentrations of V5 and in the control group stained with anti-CD31; b is a fluorescent image of the retina of diabetic mice injected with different concentrations of V5 and in the control group stained with anti-CD31; -2 ERG statistics of the a-wave amplitude of the retina of diabetic mice injected with different concentrations of V5 and in the control group under flicker intensity; c is at 3 cds m -2 ERG statistics of b-wave amplitude in the retina of diabetic mice injected with different concentrations of V5 and in the control group under flicker intensities. DETAILED DESCRIPTION

[0049] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0050] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0051] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0052] Example 1 Construction of a lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor

[0053] (1) The lysosome-targeted chimera for targeted degradation of endothelial vascular growth factor is designed to contain three different modules, including an aptamer targeting the endothelial vascular growth factor to be degraded, which is used to target and bind to the endothelial vascular growth factor, namely, the VEGF binding module; an aptamer for the lysosome-targeted receptor, which is used to transport the bound endothelial vascular growth factor into the lysosome for specific degradation, namely, the M6PR binding module; and a connection module that stably connects the two aptamers.

[0054] Among them, the VEGF binding module screened out three aptamers with strong affinity, which were labeled as VEGF-A1, VEGF-A2 and VEGF-A3.

[0055] The nucleotide sequence of VEGF-A1 is shown in SEQ ID NO.3, comprising:

[0056] TGTGGGGGTGGACTGGGTGGGTACC;

[0057] The nucleotide sequence of VEGF-A2 is shown in SEQ ID NO.4, comprising:

[0058] TGTGGGGGTGGACGGGCCGGGTAGA;

[0059] The nucleotide sequence of VEGF-A3 is shown in SEQ ID NO.4, comprising:

[0060] GCCCGTCTTCCAGACAAGAGTGCAGGGC.

[0061] Among them, the M6PR binding module screened out an aptamer with strong affinity, M6PR-A*.

[0062] The nucleotide sequence of M6PR is shown in SEQ ID NO.5, comprising:

[0063] GGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC.

[0064] Since the type and length of the linker can affect the activity of the lysosomal targeting chimera for targeted degradation of endothelial vascular growth factor, two linkers of different lengths were designed, including 15 bp double-stranded DNA (LinkerA and LinkerB that is complementary to its base pairing) and 23 bp long double-stranded DNA (Linker1 and Linker2 that is complementary to its base pairing).

[0065] The nucleotide sequence of LinkerA is: TATGACTGATTTACG;

[0066] The nucleotide sequence of Linker1 is: TATGACTGATTTACGTGTGGGGG;

[0067] Therefore, VEGF-A1 is combined with LinkerA to obtain aptamer A1 targeting endothelial vascular growth factor to be degraded, and its nucleotide sequence is:

[0068] TATGACTGATTTACG TGTGGGGGTGGACTGGGTGGGTACCC.

[0069] VEGF-A2 binds to LinkerA to obtain aptamer A2 targeting endothelial vascular growth factor to be degraded, and its nucleotide sequence is:

[0070] TATGACTGATTTACGTGTGGGGGTGGACGGGCCGGGTAGA.

[0071] VEGF-A3 is combined with LinkerA to obtain aptamer A3 targeting endothelial vascular growth factor to be degraded, and its nucleotide sequence is:

[0072] TATGACTGATTTACG GCCCGTCTTCCAGACAAGAGTGCAGGGC.

[0073] The nucleotide sequence of M6PR (M6PR-1) containing Linker B that is complementary to Linker A in A1, A2 and A3 is:

[0074] TATGACTGATTTACGTGTGGGGG GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC.

[0075] VEGF-A1 binds to Linker1 to obtain aptamer A4 targeting endothelial vascular growth factor to be degraded, and its nucleotide sequence is:

[0076] TATGACTGATTTACGTGTGGGGG TGTGGGGGTGGACTGGGTGGGTACCC.

[0077] VEGF-A2 binds to Linker1 to obtain aptamer A5 targeting endothelial vascular growth factor to be degraded, and its nucleotide sequence is:

[0078] TATGACTGATTTACGTGTGGGGG TGTGGGGGTGGACGGGCCGGGTAGA.

[0079] VEGF-A3 binds to Linker1 to obtain aptamer A6 targeting endothelial vascular growth factor to be degraded, and its nucleotide sequence is:

[0080] TATGACTGATTTACGTGTGGGGG GCCCGTCTTCCAGACAAGAGTGCAGGGC.

[0081] The nucleotide sequence of M6PR (M6PR-2) containing Linker2 that is complementary to Linker1 in A4, A5, and A6 is:

[0082] CCCCCACACGTAAATCAGTCATA GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC.

[0083] Figure 1 This is the synthesis process of the lysosome-targeted chimeras V1 to V6 for targeted degradation of endothelial vascular growth factor in this example.

[0084] A1-A3 and M6PR-1 were placed in DPBS-Mg buffer (DPBS buffer solution includes 12.5mM Mg(Ac)2) and heated to 95°C, and then quickly cooled on ice. After high temperature annealing, A1-A3 and M6PR-1 were placed in 100μL DPBS buffer solution, and the concentrations of A1-A3 and M6PR-1 were 12μM, respectively. They were incubated at 4°C for 30min to obtain lysosomal targeting chimeras V1-V3 that target degradation of endothelial vascular growth factor.

[0085] A4-A6 and M6PR-2 were placed in DPBS-Mg buffer (DPBS buffer solution includes 12.5mM Mg(Ac)2) and heated to 95°C, and then quickly cooled on ice. After high temperature annealing, A4-A6 and M6PR-1 were placed in 100μL DPBS buffer solution, and the concentrations of A4-A6 and M6PR-2 were 12μM, respectively, and incubated at 4°C for 30min, and then 1μL T4 ligase was added to the mixture, followed by incubation at 37°C for 1h to complete the reaction, and lysosomal targeting chimeras V4-V6 that target degradation of endothelial vascular growth factor were obtained.

[0086] The synthesis results of V1 to V6 were verified by electrophoresis, such as Figure 2 As shown in a and b, it can be seen that V1 to V6 were successfully synthesized.

[0087] (2) Verify the stability of V1 to V6

[0088] The stability of the lysosome targeting chimeras V1-V6 was assessed by incubating them with 10% fetal bovine serum to simulate normal physiological conditions.

[0089] The specific process includes: incubating the lysosome targeting chimeras V1 to V6 in a culture medium containing 10% fetal bovine serum at 37°C. To evaluate the integrity of the lysosome targeting chimeras V1 to V6 after incubation, the samples were then electrophoresed using a 12% native polyacrylamide gel containing 1×TBE-Mg buffer. Gel electrophoresis was performed at a constant voltage of 120V for 90 minutes. Subsequently, the gel was stained with Gel Red staining solution before the imaging process to visualize the DNA structure. The results are shown in Figure 2. Figure 3 As shown in Figure 2, gel electrophoresis results showed that the lysosomal targeting chimeras connected to longer chains of V4, V5 and V6 had longer half-lives compared to the short-chain connected V1, V2 and V3. Therefore, the more stable V4, V5 and V6 were subsequently selected for subsequent analysis.

[0090] (3) In order to test the binding affinity of V4, V5 and V6 to M6PR and its target protein VEGF, microscale thermophoresis (MST) was used. The specific method includes: diluting the cy5-labeled lysosomal targeting chimera to a concentration of 5 nM, introducing different amounts of VEGF or purifying GST-M6PR protein from 293T cells, soaking in MST buffer containing 20 mM Tris-HCl (pH 8.5), 20 mM KCl, 20 mM CaCl2 and 0.1% Tween 20 for 10 min, and then adding the sample solution to the capillary for MST measurement. According to the binding curve and Kd value, the dissociation constant reflects the binding affinity between two molecules (the smaller the Kd value, the stronger the binding affinity). The results are shown in Figure 2. Figure 4 As shown, from Figure 4 It can be seen that V5 has the strongest affinity. In addition, although the three chimeras all show the ability to bind to M6PR, V5 and V6 show stronger binding affinity.

[0091] Example 2

[0092] To investigate the potential of using lysosome-targeting chimeras to reduce VEGF protein levels by internalizing them into lysosomes, an enzyme-linked immunosorbent assay (ELISA) was performed to detect VEGF secretion from human umbilical vein endothelial cells (HUVECs). The specific process involved: After HUVECs were treated with lysosome-targeting chimeras V4, V5, or V6 for 12 h, the cell culture medium was collected from the HUVECs and then briefly centrifuged at 1000 rpm for 3 min to discard cell debris. The supernatant was then tested with an ELISA kit to accurately detect and quantify VEGF protein levels. The results are shown in Figure 2. Figure 5 As shown, it was found that the VEGF protein level was significantly reduced after V5 treatment, and a concentration-dependent effect was shown. In contrast, V6 had a weaker ability to degrade VEGF. Therefore, V5 was selected as a lysosomal targeting chimera for targeted degradation of endothelial vascular growth factor in the present invention.

[0093] To further confirm the specific VEGF degradation potential of V5, HUVECs were treated with A5, M6PR-2, or V5, and their effects on VEGF levels were evaluated. Figure 6 As shown, the results showed that only V5 had the ability to effectively degrade VEGF, while the individual aptamers (A5 and M6PR-2) did not show the same degradation ability. This suggests that the binding of A5 to M6PR-A* in the V5 molecule is essential for its VEGF degradation activity.

[0094] To determine whether the reduction in VEGF levels was due to internalization into lysosomes along with the lysosomal targeting chimera, the intracellular localization of V5 and individual aptamers (A5, M6PR-2) was investigated. HUVECs were cultured on cell slides in each well of a 24-well plate, and then the medium was aspirated. After washing twice with PBS, the prepared cells were treated with 0.5 μM cy5-labeled aptamers (A5 and M6PR-2) and V5. The cy5-labeled aptamers and V5 were dispersed in a special binding buffer, the components of which included 4.5 g / L glucose, 5 mM MgCl2, 0.1 mg / mL yeast tRNA, and 1 mg / mL BSA, and the base of the buffer was PBS buffer. The cells were then incubated at 37°C for 30 min. Subsequently, the cells were washed twice with PBS washing buffer containing 4.5 g / L glucose and 5 mM MgCl2. Then, the cells were stained with the lysosomal red fluorescent probe (LysoTracker Red) at 37°C under optimal conditions. After using lysotracker Red, two subsequent washes were performed, and then the cells were fixed with 4% formaldehyde for 20 min at room temperature. The nuclei were stained with DAPI for 5 min. Finally, the cell slides were mounted under dark conditions and visualized using a confocal imaging system.

[0095] The results are as follows Figure 7 As shown, immunofluorescence microscopy showed that V5 and M6PR-2 were efficiently internalized into lysosomes and clearly colocalized with lysosomes stained with lysosomal tracker. In contrast, single A5 did not show specific cellular localization, indicating that M6P mediates lysosomal trafficking through M6P-M6PR interactions. In addition, using small interference technology, it was found that depletion of M6PR impaired the VEGF degradation ability of V5 ( Figure 8 a and b). The transfection mixture containing siRNAs and liposome RNAiMAX was added to the culture medium without FBS or antibiotics, and the culture medium was changed to fresh endothelial cell culture medium 12 hours after transfection. The silencing efficiency was detected by immunoblotting 48 hours after transfection, and the VEGF protein level in HUVECs transfected with control siRNA or M6PR siRNA and treated with different concentrations of V5 was analyzed by enzyme-linked immunosorbent assay (ELSIA). These results collectively indicate that V5 mediates the efficient transport of VEGF to lysosomes through M6P-dependent internalization.

[0096] Example 3

[0097] The effect of V5 on endothelial cell migration was studied. Endothelial cell migration is crucial for the formation of new blood vessels. 5cells), and when the cell confluence reached about 90%, a 200 μL sterile pipette was used to form a scratch in the middle of the HUVEC monolayer. After washing the cells twice with PBS, different concentrations of V5 were added to the wells and cultured in 2% FBS medium for 6, 12, 18 and 24 hours. Under normal circumstances, after scratching, endothelial cells will almost close these gaps within 24 hours. However, in the presence of V5, the wound healing rate of these cells was significantly slowed down and the cell migration rate was significantly reduced, indicating that V5 does inhibit the migration of endothelial cells ( Fig. 9 (a)

[0098] The mouse aortic ring assay evaluates angiogenesis in an ex vivo model that bridges the gap between in vitro and in vivo systems. The thoracic aorta was removed from adult mice, cleaned and treated with V5 for 12 hours. The aorta was embedded in 80 μL of matrix and embedded in a 96-well plate containing 500 μL of opti-MEM reduced serum culture and 2.5% FBS. Endothelial sprouts were grown in culture medium containing different concentrations of V5 for 5 days, which was replaced every other day. It was found that V5 had a strong inhibitory ability on the formation of aortic ring vascular networks, indicating that V5 inhibits angiogenesis ( Fig. 9 (b)

[0099] Example 4

[0100] To determine the in vivo stability and efficacy of V5 in mouse ocular tissue, intravitreal injections were first performed, followed by in vivo imaging. Notably, Cy5-labeled V5 molecules were still identifiable in the eye up to 48 h after injection ( Fig.10 (a)

[0101] In order to confirm the beneficial role of V5 in pathological angiogenesis, a mouse model was constructed. The specific methods included: simulating VEGF-induced retinal angiogenesis, 1μg VEGF was injected into the vitreous of 6-8 week-old mice, and a 33-gauge bevel needle was used to simulate the effects of VEGF overexpression. 24h after injection, the mice were further treated with different doses of V5 (3μM or 6μM) for 24h. Subsequently, the retinas were removed for subsequent analysis. This model reproduced retinal angiogenesis stimulated by VEGF overexpression, causing retinal vascular proliferation. After VEGF induction, evaluation of the vascular network 24h later showed obvious proliferation, confirming the role of VEGF in vasodilation. In sharp contrast, V5 can significantly inhibit this neovascularization ( Fig.10 (b)

[0102] Example 5

[0103] Inspired by the potent anti-angiogenic effects of V5 in vitro, ex vivo, and in vivo, we further investigated the potential therapeutic role of V5 in an oxygen-induced retinopathy (OIR) mouse model.

[0104] OIR model construction: Neonatal mice at P7 were housed in a controlled hyperoxic chamber, where they were exposed to air containing 75% oxygen for 5 consecutive days. After this hyperoxic exposure, mice were returned to a normal environment, equivalent to room air. For intravitreal treatment, 1 μL of V5 (2 μM or 6 μM) or an equivalent volume of control was precisely injected using a Hamilton syringe with a 33-gauge needle. These intravitreal injections began at P12 and were repeated every 3 days until the end time point of the experiment.

[0105] The results showed that compared with the control group, the retinal blood vessels of OIR mice that were not treated with V5 had obvious pathological phenomena, including the overgrowth of immature blood vessels and the formation of outer retinal blood vessel clusters. In the treated OIR mice, V5 largely improved the OIR-induced retinal neovascularization, indicating that V5 has an anti-angiogenic therapeutic effect in the OIR mouse model ( Fig.11 a)

[0106] In addition, full-field electroretinogram (ERG) was used to comprehensively evaluate the retinal response to light stimulation. The results showed that compared with the control group, the a-wave (representing the function of the outer retinal photoreceptor cells) and b-wave (representing the activity of bipolar cells and Müller cells in the inner and outer nuclear layers of the retina) of OIR mice were significantly reduced by more than 50% ( Fig.11 However, after treatment with V5, retinal function was significantly restored in the OIR model.

[0107] Experimental Example 6

[0108] To determine the role of V5 in pathological retinal neovascularization and vascular leakage, a streptozotocin (STZ)-induced mouse DR model was utilized.

[0109] DR model construction: 8-week-old male C57BL / 6 mice were fasted for 4h before STZ (dissolved in 0.1M citrate buffer, pH 4.5) treatment was started. Animals were intraperitoneally injected with 50mg / kg dose of STZ or an equal amount of citrate buffer (as control) every day for 5 consecutive days. 7 days after the last STZ injection, fasting blood glucose levels were measured with a glucometer to confirm the induction of diabetes. At the same time, in order to study the effects of treatment on diabetic mice, 1μLV5 (2μM or 6μM) or control was injected intravitreally in the STZ-induced diabetic model, and the injection frequency was once every 3 days for 1 week.

[0110] Subsequently, the efficacy of V5 as a therapeutic agent was evaluated by administering STZ-induced DR in mice. The results showed that V5 treatment significantly reduced the formation of diabetes-induced acellular capillaries ( Fig.12 (a). Full-field electroretinogram (ERG) data showed that V5 was able to significantly reduce retinal dysfunction (a direct consequence of the diabetic state) ( Fig.12 b and c).

[0111] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A lysosomal targeting chimera for targeted degradation of endothelial vascular growth factor, characterized in that: It is composed of an aptamer targeting endothelial vascular growth factor to be degraded and an aptamer targeting a lysosome receptor; the aptamer targeting endothelial vascular growth factor to be degraded includes a connection probe Linker1; the aptamer targeting the lysosome receptor includes a connection probe Linker2; the aptamer targeting endothelial vascular growth factor to be degraded and the aptamer targeting the lysosome receptor are connected through complementary base pairing of the connection probes Linker1 and Linker2; The nucleotide sequence of the aptamer targeting endothelial vascular growth factor to be degraded is shown in SEQ ID NO.1, TATGACTGATTTACGTGTGGGGG TGTGGGGGTGGACGGGCCGGTAGA; The underlined portion in SEQ ID NO.1 is the nucleotide sequence of the ligation probe Linker1; The nucleotide sequence of the aptamer of the lysosomal targeting receptor is shown in SEQ ID NO.

2. CCCCCACACGTAAATCAGTCATA GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC; The underlined portion in SEQ ID NO.2 is the nucleotide sequence of the ligation probe Linker2.

2. The method for preparing the lysosome targeting chimera according to claim 1, characterized in that: include: The aptamer targeting endothelial vascular growth factor to be degraded and the aptamer targeting lysosome receptor are respectively subjected to high temperature annealing, and the aptamer targeting endothelial vascular growth factor to be degraded and the aptamer targeting lysosome receptor after high temperature annealing are added to a buffer solution, T4 ligase is added, and after incubation, a lysosome targeting chimera targeting endothelial vascular growth factor is obtained.

3. The preparation method according to claim 2, characterized in that: The high temperature of high temperature annealing is 90~100 ℃; the annealing temperature of high temperature annealing is 0 ℃.

4. The preparation method according to claim 3, characterized in that: The high temperature of high temperature annealing is 95°C.

5. The preparation method according to claim 2, characterized in that: The molar ratio of the aptamer targeting the endothelial vascular growth factor to be degraded and the aptamer targeting the lysosome receptor is 1:

1.

6. The preparation method according to claim 5, characterized in that: Based on 10~14 μM of the aptamer targeting endothelial vascular growth factor to be degraded, the amount of T4 ligase added is 0.8~1.2 μL.

7. The preparation method according to claim 6, characterized in that: The amount of T4 ligase added was 1 μL.

8. A pharmaceutical preparation, characterized in that The invention comprises the lysosome targeting chimera according to claim 1 and at least one pharmaceutically acceptable excipient.

9. A pharmaceutical preparation according to claim 8, characterized in that The invention comprises the lysosomal targeting chimera according to claim 1 and at least one pharmaceutically acceptable carrier.

10. Use of the lysosome targeting chimera according to claim 1 in the preparation of a drug for treating or assisting in treating a disease related to endothelial vascular growth factor; the disease related to the disease is a neovascular eye disease; The neovascular eye diseases are wet macular degeneration, diabetic macular edema, diabetic retinopathy, outer exudative retinopathy, retinal vein occlusion, corneal neovascularization, pathological myopia CNV, neovascular glaucoma, polypoidal choroidal vasculopathy, and radiation optic neuropathy.

Images