Micro-fluidic chip as well as preparation method and application thereof

Abstract

The invention provides a micro-fluidic chip and a preparation method and application thereof, and belongs to the field of in vitro diagnose.The micro-fluidic chip comprises aptamer magnetic beads, a reactor and multivalent DNA nanowire reaction liquid, the aptamer magnetic beads comprise aptamer magnetic beads labeled by biotinylated staphylococcus aureus aptamers and aptamer magnetic beads labeled by biotinylated escherichia coli aptamers; the aptamer magnetic beads comprise aptamer magnetic beads labeled by biotinylated staphylococcus aureus aptamers and aptamer magnetic beads labeled by biotinylated escherichia coli aptamers; the reactor comprises two sample micro-chambers, two magnetic suction chambers, two snakelike mixing channels, two detection chambers and a sample outlet; the multivalent DNA nanowire reaction solution is a mixed solution comprising a multivalent DNA nanowire, heme and Tris-HCl. The micro-fluidic chip provided by the invention has the advantages of high sensitivity, strong specificity, low cost and simplicity in operation.

Description

Technical Field

[0001] The present invention relates to the field of in vitro diagnostic technology, and in particular to a microfluidic chip and a preparation method and application thereof, and more particularly to a microfluidic chip for simultaneously detecting Escherichia coli and Staphylococcus aureus and a preparation method and application thereof. Background Art

[0002] Early diagnosis of intracranial infection is crucial to improving clinical outcomes. Patients with suspected intracranial infection should undergo lumbar puncture and cerebrospinal fluid for pathogenic examination as soon as possible. If the bacterial culture is positive, the diagnosis can be confirmed, so as to carry out precise treatment. According to statistics, the main pathogens of patients with intracranial infection in neurosurgery in my country are Staphylococcus aureus, Escherichia coli, coagulase-negative Staphylococci, Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa, etc. The culture of these pathogens generally takes 5-7 days, which is too long to meet the needs of clinical diagnosis. The currently popular second-generation sequencing technology (NGS) does not rely on bacterial culture, has the advantages of unbiased, wide coverage, and rapidity, and is widely used in clinical practice. However, this method is expensive and many patients cannot afford it. Therefore, the development of a rapid detection method with high sensitivity and low price is crucial for the treatment of postoperative intracranial infection. Summary of the invention

[0003] The purpose of the present invention is to provide a bacteria detection method with low cost, high sensitivity and rapid detection.

[0004] To achieve the above-mentioned object, the first aspect of the present invention provides a microfluidic chip, the microfluidic chip comprising aptamer magnetic beads, a reactor and a multivalent DNA nanowire reaction solution, the aptamer magnetic beads comprising aptamer magnetic beads labeled with biotinylated Staphylococcus aureus aptamer and aptamer magnetic beads labeled with biotinylated Escherichia coli aptamer, the magnetic beads in the aptamer magnetic beads labeled with biotinylated Staphylococcus aureus aptamer are streptavidin magnetic beads, the magnetic beads in the aptamer magnetic beads labeled with biotinylated Escherichia coli aptamer are streptavidin magnetic beads, in the biotinylated Staphylococcus aureus aptamer, biotin is connected to the 5' end of SEQ ID No.1, and in the biotinylated Escherichia coli aptamer, biotin is connected to the 5' end of SEQ ID No. At the 5' end of No.2, the reactor includes two sample microchambers, two magnetic suction chambers, two serpentine mixing channels, two detection chambers and a sample outlet, wherein the sample microchamber and the magnetic suction chamber are connected by a swimming lane, the magnetic suction chamber and the detection chamber are connected by a serpentine mixing channel, and the detection chamber and the sample outlet are connected by a swimming lane; the polyvalent DNA nanowire reaction solution is a mixed solution including polyvalent DNA nanowires, hemoglobin, and Tris-HCl.

[0005] Preferably, the multivalent DNA nanowire is obtained by incubating the HCR initiator chain, the hairpin DNA H1, and the hairpin DNA H2 with the Escherichia coli aptamer, the Staphylococcus aureus aptamer, and the G-quadruplex.

[0006] The nucleotide sequence of the HCR priming chain is shown in SEQ ID No. 3;

[0007] The nucleotide sequence of the hairpin DNA H1 is shown in SEQ ID No.4;

[0008] The nucleotide sequence of the hairpin DNA H2 is shown in SEQ ID No.5;

[0009] The nucleotide sequence of the Escherichia coli aptamer is shown in SEQ ID No.6;

[0010] The nucleotide sequence of the Staphylococcus aureus aptamer is shown in SEQ ID No.7;

[0011] The nucleotide sequence of the G-quadruplex is shown in SEQ ID No.8.

[0012] Preferably, in the polyvalent DNA nanowire reaction solution, the volume ratio of the polyvalent DNA nanowire to heme is 5:(1-3).

[0013] The microfluidic chip provided by the present invention is a microfluidic platform of DNA nanowires assembled based on novel multivalent aptamers and G-quadruplexes, which can simultaneously detect two pathogens of Escherichia coli and Staphylococcus aureus, not only giving play to the bifunctionality of the HCR skeleton, but also using microfluidic chips to realize simultaneous detection of multiple foodborne pathogens. On the one hand, the present invention uses HCR products as a scaffold for the assembly of multivalent aptamers, enhances the binding affinity of aptamers to pathogens, utilizes the programmability of DNA, uses HCR as a scaffold of signal carriers, and further improves the detection sensitivity by the peroxidase-like effect of G-quadruplexes / heme, and improves the sensitivity of detection by a one-step double signal amplification, and realizes visual detection; On the other hand, the present invention uses microfluidic chips to detect multiple pathogens at the same time, greatly shortening the detection time, improving the detection efficiency and due to the high specificity of multivalent aptamers, also showing good detection performance in actual samples. In addition, the method also has broad prospects in other pathogen detection. At the same time, the invention combines nucleic acid aptamers with microfluidic chips. When in use, the above-mentioned microfluidic chip can integrate multiple test steps such as sample pretreatment, reaction, and result reading into a tiny chip, which has the advantages of low sample consumption, high accuracy, high throughput, intelligence, miniaturization and integration.

[0014] Furthermore, the second aspect of the present invention provides a method for preparing the microfluidic chip according to the first aspect, which specifically comprises the following steps:

[0015] S1: Preparation of aptamer magnetic beads;

[0016] S2: Preparation of multivalent DNA nanowires;

[0017] S3: Preparing a reactor by a mold.

[0018] Preferably, the step S1 comprises the following steps:

[0019] S11: mixing the streptavidin magnetic bead solution and the biotinylated Staphylococcus aureus aptamer solution and incubating them, adding the D-biotin solution to the reaction system after the incubation, incubating and blocking, washing the magnetic beads with phosphate buffer, and resuspending them with phosphate buffer to obtain biotinylated Staphylococcus aureus aptamer-labeled aptamer magnetic beads;

[0020] S12: The streptavidin magnetic bead solution and the biotinylated Escherichia coli aptamer solution are mixed and incubated, and the D-biotin solution is added to the reaction system after the incubation is completed, and the magnetic beads are washed with phosphate buffer after incubation and resuspended with phosphate buffer to obtain biotinylated Escherichia coli aptamer-labeled aptamer magnetic beads.

[0021] Preferably, step S2 comprises the following steps:

[0022] S21: All DNA sequences were centrifuged and dissolved separately, and the concentration of all DNA solutions was controlled to be 50 μM;

[0023] S22: pre-annealing treatment was performed on HCR priming strand, hairpin DNA H1, hairpin DNA H2, G-quadruplex, Staphylococcus aureus aptamer, and Escherichia coli aptamer respectively;

[0024] S23: mixing the hairpin DNA H1 treated in step S22, the hairpin DNA H2 treated in step S22, and the HCR priming chain treated in step S22, and incubating at 37° C. to form an HCR product;

[0025] S24: Mix the Escherichia coli aptamer treated in step S22, the Staphylococcus aureus aptamer treated in step S22, the G-quadruplex treated in step S22, and the HCR product obtained in step S23, and incubate at 37° C. to form a multivalent DNA nanowire assembled with multivalent aptamers and G-quadruplexes.

[0026] Preferably, in step S22, the pre-annealing treatment includes the following steps: the G-quadruplex is denatured at 95°C for 5 minutes and then shaken at room temperature for 2 hours; the hairpin DNA H1 is denatured at 95°C for 5 minutes and then placed on ice; the hairpin DNA H2 is denatured at 95°C for 5 minutes and then placed on ice, the Escherichia coli aptamer is denatured at 95°C for 5 minutes and then placed on ice; the Staphylococcus aureus aptamer is denatured at 95°C for 5 minutes and then placed on ice.

[0027] Furthermore, the third aspect of the present invention provides an application of the microfluidic chip described in the first aspect, wherein the application is to use the microfluidic chip for simultaneous quantitative detection of Escherichia coli and Staphylococcus aureus.

[0028] Preferably, the microfluidic chip is used to simultaneously and quantitatively detect Escherichia coli and Staphylococcus aureus by the following steps:

[0029] Step 1: inject the aptamer magnetic beads labeled with Staphylococcus aureus and the aptamer magnetic beads labeled with Escherichia coli into different magnetic suction chambers on the reactor respectively, and then inject the sample into the two magnetic suction chambers through the sample microchamber;

[0030] Step 2: Mix the sample and magnetic beads and continue to pump the mixture into the downstream serpentine mixing channel for full capture, and place a magnet under the reactor to fix the magnetic beads to capture pathogens;

[0031] Step 3: Slowly pump in the multivalent DNA nanowires to react to form a sandwich structure of "magnetic beads-pathogens-nanowires", then fix the sandwich structure with a magnet, wash it, and then pump the two sandwich products into the detection chamber with PBS respectively;

[0032] Step 4: Add ABTS to the test chamber 2- The sample was fully reacted with hydrogen peroxide and Tris-HCL Buffer for colorimetric analysis.

[0033] The detection principle of the microfluidic chip provided by the present invention is: using the HCR product as a long double-stranded DNA and the programmability of DNA, designing an extension sequence at the 5' end of the hairpin DNA H1 to complement the extension sequence at the 5' end of the target adapter, and connecting the target adapter to the HCR skeleton by base complementary pairing to obtain a multivalent adapter in a high valence state for capturing target bacteria. In order to detect the output of the signal, the G-quadruplex is modified at the 3' end of the hairpin DNA H2, combined with heme, and finally a substrate is added to realize visual color development. During detection, the corresponding aptamer magnetic bead solution is first injected into the sample chamber, and then the corresponding Staphylococcus aureus and Escherichia coli are added, because its multivalent aptamer has a high affinity for the target bacteria, so it will specifically bind to the corresponding target bacteria. Subsequently, by the peroxidase-like activity of G-quadruplex / heme, the substrate is finally added for color development, and simultaneous detection of two pathogens can be achieved. The absorbance value is linearly related to the concentration of target bacteria. The higher the concentration of target bacteria added, the more multivalent aptamers are specifically bound, the higher the peroxidase-like activity of the bound G-quadruplex / heme, the better the final color development effect, and the higher the absorbance value.

[0034] Compared with the prior art, the present invention has the following beneficial effects: the detection principle of the microfluidic chip provided by the present invention is HCR detection, which is an enzyme-free isothermal amplification technology, and the product has the characteristics of large molecular weight. The aptamer can be assembled on the HCR product through simple base complementary pairing through sequence design to obtain a high-valent multivalent aptamer; the present invention utilizes the programmability of DNA to modify two hairpin DNAs in HCR amplification, and the obtained HCR product is used as the skeleton of the multivalent aptamer and the signal carrier (G-quadruplex / heme), realizing the dual functions of multivalent enhanced high-affinity binding and signal, greatly improving the simplicity and sensitivity of the detection method, and finally 10 cfu / mL of Staphylococcus aureus and 8 cfu / mL of Escherichia coli can be detected simultaneously; the microfluidic chip designed in the present invention can realize the simultaneous detection of two pathogens, which greatly saves time. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 A physical picture and a design schematic diagram of a microfluidic chip provided for a specific embodiment of the present invention;

[0036] Figure 2 A diagram showing the preparation and working principle of multivalent DNA nanowires provided in a specific embodiment of the present invention;

[0037] Figure 3 A schematic diagram of the microfluidic chip provided in a specific embodiment of the present invention;

[0038] Figure 4This is an agarose gel electrophoresis diagram of the multivalent DNA nanowires in Example 2 of the specific embodiment of the present invention;

[0039] Figure 5 This is an atomic force microscope image of a DNA nanowire in Example 2 of a specific embodiment of the present invention;

[0040] Figure 6 This is a fluorescence microscope image of the multivalent aptamer and the monovalent aptamer binding to Staphylococcus aureus and Escherichia coli in Example 3 of the specific embodiment of the present invention;

[0041] Figure 7 A microfluidics physical image in Example 4 of a specific embodiment of the present invention and a linear relationship diagram of the colorimetric signals and their intensities and the corresponding bacterial concentrations for simultaneously detecting different concentrations of Staphylococcus aureus and Escherichia coli in a solution;

[0042] Figure 8 This is a linear relationship diagram between the colorimetric signal intensity and the bacterial concentration for simultaneously detecting different concentrations of Escherichia coli and Staphylococcus aureus in cerebrospinal fluid in Example 5 of the specific implementation mode of the present invention;

[0043] Fig. 9 This is a colorimetric signal diagram of detecting different pathogens in Example 6 of the specific implementation method of the present invention.

[0044] Description of reference numerals:

[0045] 1. Sample microchamber; 2. Magnetic suction chamber; 3. Serpentine mixing channel; 4. Detection chamber; 5. Sample outlet. DETAILED DESCRIPTION

[0046] In order to make the above-mentioned purposes, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation method and typical parameters of the present invention, and are not used to limit the parameter range described in the present invention. Reasonable changes derived therefrom are still within the scope of protection of the claims of the present invention.

[0047] It should be noted that the endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed in this article.

[0048] In the description of the present invention, it should be noted that the terms "left", "right", "inside", "outside", "front", "back", "head", "tail", etc. indicate directions or positional relationships based on the directions or positional relationships shown in the accompanying drawings, or are the directions or positional relationships in which the inventive product is usually placed when used. They are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operated in a specific direction, and therefore should not be understood as a limitation on the present invention.

[0049] As described in the background art, the method for detecting pathogens in the prior art is the second generation sequencing, which is expensive. Based on this, the specific implementation of the present invention provides a high-sensitivity, low-cost pathogen detection method and microfluidic chip.

[0050] The microfluidic chip provided in a specific embodiment of the present invention comprises aptamer magnetic beads, a reactor and a multivalent DNA nanowire reaction solution.

[0051] See also Figure 1 , Figure 1 The reactor photo and structural schematic diagram of the microfluidic chip in the specific implementation mode of the present invention, the reactor includes two sample microchambers 1, two magnetic suction chambers 2, two serpentine mixing channels 3 and two detection chambers 4 and a sample outlet 5, wherein the sample microchamber 1 and the magnetic suction chamber 2 are connected by a swimming lane, and the magnetic suction chamber 2 and the detection chamber 4 are connected by a serpentine mixing channel 3.

[0052] In the above embodiment, the reactor is prepared by the following steps: a mold for preparing the bottom PDMS layer is carved on an acrylic plate using a fine carving instrument. Then a mixture of PDMS prepolymer and curing agent is poured into the mold to cast the bottom layer, poured into a monomer resin frame to cast the top layer, and then cured after degassing in a vacuum. Finally, the top and bottom layers of PDMS are combined by surface plasma to prepare a reactor.

[0053] In the above embodiment, the aptamer magnetic beads include aptamer magnetic beads labeled with biotinylated Staphylococcus aureus aptamer and aptamer magnetic beads labeled with biotinylated Escherichia coli aptamer, and the magnetic beads in the aptamer magnetic beads are streptavidin magnetic beads, wherein in the biotinylated Staphylococcus aureus aptamer, biotin is connected to the 5' end of SEQ ID No.1, and in the biotinylated Escherichia coli aptamer, biotin is connected to the 5' end of SEQ ID No.2.

[0054] In the above embodiment, the preparation method of aptamer magnetic beads includes the following steps: S11: mixing and incubating a streptavidin magnetic bead solution with a biotinylated Staphylococcus aureus aptamer solution, adding a D-biotin solution to the reaction system after the incubation, incubating and blocking, washing the magnetic beads with a phosphate buffer, and resuspending with a phosphate buffer to obtain biotinylated Staphylococcus aureus aptamer-labeled aptamer magnetic beads; S12: mixing and incubating a streptavidin magnetic bead solution with a biotinylated Escherichia coli aptamer solution, adding a D-biotin solution to the reaction system after the incubation, incubating and blocking, washing the magnetic beads with a phosphate buffer, and resuspending with a phosphate buffer to obtain biotinylated Escherichia coli aptamer-labeled aptamer magnetic beads.

[0055] In the above embodiment, the multivalent DNA nanowire reaction solution is a mixture of multivalent DNA nanowires, heme, and Tris-HCl. The multivalent DNA nanowires are obtained by HCR initiation chain, hairpin DNA H1, and hairpin DNA H2 through HCR reaction and incubation with Escherichia coli aptamer, Staphylococcus aureus aptamer, and G-quadruplex, wherein the nucleotide sequence of the HCR initiation chain is shown in SEQ ID No.3; the nucleotide sequence of the hairpin DNA H1 is shown in SEQ ID No.4; the nucleotide sequence of the hairpin DNA H2 is shown in SEQ ID No.5; the nucleotide sequence of the Escherichia coli aptamer is shown in SEQ ID No.6; the nucleotide sequence of the Staphylococcus aureus aptamer is shown in SEQ ID No.7; and the nucleotide sequence of the G-quadruplex is shown in SEQ ID No.8.

[0056] In the above embodiment, the preparation process and working principle of the multivalent DNA nanowire are as follows: Figure 2 As shown, the preparation process specifically includes the following steps: S21: all DNA sequences are centrifuged and dissolved separately, and the concentration of all DNA solutions is controlled to be 50 μM; S22: the hairpin DNA H1, the hairpin DNA H2, the G-quadruplex, the Staphylococcus aureus aptamer, and the Escherichia coli aptamer are respectively subjected to annealing pre-treatment; S23: the hairpin DNA H1 treated in step S22, the hairpin DNA H2 treated in step S22, and the HCR initiation chain treated in step S22 are mixed, and incubated at 37° C. to form an HCR product; S24: the Escherichia coli aptamer treated in step S22, the Staphylococcus aureus aptamer treated in step S22, the G-quadruplex treated in step S22, and the HCR product obtained in step S23 are mixed, and incubated at 37° C. to form a multivalent DNA nanowire assembled by multivalent aptamers and G-quadruplexes.

[0057] See also Figure 3 , Figure 3The schematic diagram of the principle of using a microfluidic chip to quantitatively detect Escherichia coli and Staphylococcus aureus in a specific embodiment of the present invention. Using the HCR product as a long double-stranded DNA and the programmability of DNA, a section of extension sequence is designed at the 5' end of the hairpin DNA H1 to complement the extension sequence at the 5' end of the target adapter, and the target adapter is connected to the HCR skeleton by base complementary pairing to obtain a high-valent multivalent adapter for capturing target bacteria. In order to detect the output of the signal, the G-quadruplex is modified at the 3' end of the hairpin DNA H2, combined with heme, and finally a substrate is added to realize visual color development. During detection, the corresponding aptamer magnetic bead solution is first injected into the sample chamber, and then the corresponding Staphylococcus aureus and Escherichia coli are added. Because its multivalent aptamer has a high affinity for the target bacteria, it will specifically bind to the corresponding target bacteria. Subsequently, the peroxidase-like activity of the G-quadruplex / heme is used, and finally the substrate is added for color development, which can realize the simultaneous detection of two pathogens. The absorbance value is linearly related to the concentration of target bacteria. The higher the concentration of target bacteria added, the more multivalent aptamers are specifically bound, the higher the peroxidase-like activity of the bound G-quadruplex / heme, the better the final color development effect, and the higher the absorbance value.

[0058] The technical scheme of the present invention is further described below by specific examples. Unless otherwise defined, all terms, symbols and other scientific terms used herein are intended to have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. In some cases, the terms with conventional understandings are defined herein for the purpose of explanation or convenience of reference, and such definitions herein should not be understood to represent significant differences from conventional understandings in the art. The technical methods described or cited herein are generally well understood by those skilled in the art and are adopted by conventional methods. Unless otherwise stated, the use of commercially available kits, reagents and instruments is carried out according to the schemes and parameters given by the manufacturer.

[0059] Example 1

[0060] Aptamer magnetic bead preparation

[0061] 200 μL of 1 μM biotin-modified aptamer (biotin-Apt) was incubated with 200 μL of 1 mg / mL streptavidin-modified magnetic beads (SA-MNBs) at room temperature for 30 minutes. Subsequently, 40 μL of 40 μM D-biotin was added and incubated at room temperature for 30 minutes to block the excess binding sites of SA-MNPs. Next, the supernatant was removed by magnetic separation, and the precipitate was washed three times with PBST (0.01 M PBS containing 0.01% Tween-20) and then suspended in 200 μL PBS to form aptamer magnetic beads (MNBs-Apt), and finally stored at 4 ° C for the next step. The nucleotide sequence of the biotinylated Escherichia coli aptamer is as follows: Biotin-TTTTTTTTTTTTTT CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGT AGT; the nucleotide sequence of the biotinylated Staphylococcus aureus aptamer is as follows: Biotin-GAGAGAGAATATA AGGGAAAAACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG.

[0062] Example 2

[0063] Preparation and performance verification of multivalent DNA nanowires

[0064] The long double-stranded DNA obtained by hybridization chain reaction (HCR) and the aptamer are connected together through complementary pairing to obtain a multivalent aptamer structure. The principle diagram is shown in Figure 2 As shown. The specific experimental steps are as follows: First, all DNA sequences were dissolved in PBS after centrifugation at 13400g for 1 minute to a final concentration of 50μM. Subsequently, the G-quadruplex sequence was heated at 95°C for 5 minutes and then slowly shaken at room temperature for 2 hours. Hairpin DNA H1, hairpin DNA H2, Escherichia coli aptamer, and Staphylococcus aureus aptamer were denatured at 95°C for 5 minutes and then immediately placed on ice. The treated HCR initiator chain (0.02μM), treated hairpin DNAH1 (1μM), and treated hairpin DNAH2 (1μM) were mixed and incubated overnight in PBS at 37°C to form HCR products.

[0065] The treated Staphylococcus aureus aptamer (0.75 μM), the treated Escherichia coli aptamer (0.75 μM) and the treated G-quadruplex (1.5 μM) were mixed and then added to the HCR product, incubated at 37°C for 2 hours to form a multivalent DNA nanowire structure assembled by multivalent aptamers and G-quadruplexes, and stored at 4°C.

[0066] Before the test, the total volume of the reaction system containing 5 μL of multivalent DNA nanowires, 2 μL of hemin and Tris-HCL buffer (0.05% Triton X-100, 0.1% DMSO, 100mM K+, 0.001% Tris, 0.012757% KCl, pH 7) was 100 μL, incubated at 37°C for 2 hours to obtain a multivalent DNA nanowire composite structure containing Hemin, and finally stored at -20°C for the next step. The nucleotide sequence of the HCR initiating chain DNA is as follows: GTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGG; the nucleotide sequence of the hairpin DNA H1 is as follows: TTTCCCTTATATTCTC TCTCTCTCCTGCGGGTTTGACTAGGTGATTGAGTGGTGTGTTATCCCACTCAATCACCTAGACCATTCCGCAACAACATAC (the underlined part is the complementary part to the aptamer); the nucleotide sequence of the hairpin DNAH2 is as follows: GATAACACACCACTCAATCACCTAGACATTCCCGCAGTATGTTGTTGCGGAATGGTCTAGGTGATTGAGTGGCCTCT AAATTTAATTTATTAT (The underlined part is the part complementary to the G-quadruplex); the nucleotide sequence of the Escherichia coli aptamer is as follows GAGAGAGA ATATAAGGGAAAA AAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT (the underlined portion is the complementary portion to H1); the nucleotide sequence of the Staphylococcus aureus aptamer is as follows: GAGAGAGA ATATAAGGGAAAA ACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG (the underlined part is the complementary part to H1); the nucleotide sequence of the G-quadruplex is as follows GGGTGGGTGGGTGGGCCCAAAAA ATAATAAATTAAATTT (The underlined part is the part complementary to H2).

[0067] To verify the construction of the multivalent DNA nanowires in the embodiments of the present invention, annealed DNA H1, annealed DNA H2, initiator strand stock solution, annealed DNA H1 and annealed DNA H2 mixed solution, HCR backbone, aptamer, annealed G-quadruplex, aptamer + HCR, G-quadruplex + HCR, G-quadruplex + HCR + aptamer were sequentially added to 1% agarose gel electrophoresis for separation (GelRed nucleic acid dye staining, electrophoresis buffer 1×TAE, 130V constant voltage for 30 minutes) and imaged on a gel imager. The results are shown in Figure 2. Figure 4 As shown, in the absence of initiator T, the migration rate of the mixture of H1 and H2 (lane 4) is almost the same as that of only H1 (lane 2) and H2 (lane 3). In the presence of initiator, the migration speed of HCR product (lane 5) is significantly slower than that of lanes 1-4, confirming the generation of HCR long-chain products. When the aptamer (lane 6) and G-quadruplex (lane 7) are introduced into the HCR product, bright bands are observed at the sample inlet, and there are no bands at the place of the aptamer and G-quadruplex, indicating that the aptamer or G-quadruplex is assembled on the HCR scaffold to form a larger complex. When both are introduced into the HCR product at the same time (lane 8), the band at the sample inlet is significantly brighter than bands 6 and 7, and at the same time, almost no aptamer and G-quadruplex bands are left, indicating that the aptamer and G-quadruplex are assembled on the HCR product.

[0068] To further demonstrate the construction of the multivalent DNA nanowires in this example, streptavidin was coupled to the aptamer through the terminal biotin and then observed under an atomic force microscope. Figure 5 As shown, there are bright spots of different sizes on the linear HCR backbone, namely, streptavidin APT and G-quadruplex, which indicates that the construction of multivalent DNA nanowires is completed.

[0069] Example 3

[0070] Comparison of the binding ability of multivalent and monovalent aptamers based on multivalent DNA nanowires to Staphylococcus aureus and Escherichia coli

[0071] To further observe the enhanced affinity of the multivalent aptamers of the multivalent DNA nanowires, FAM was modified on all G-quadruplexes, and single target bacteria labeled with monovalent aptamers, single G-quadruplexes and multivalent DNA nanowires were observed using confocal fluorescence microscopy. Then 100 μL of target bacteria (10 8 CFU / mL) were incubated with 2.5 μL of FAM-modified G-quadruplex-aptamer (1 μM) and multivalent DNA nanowires (1 μM) at 37°C for 2 h. Then, the mixture was washed twice by centrifugation at 6000 r / min for 5 min, suspended in PBS and diluted to 10 7 CFU / mL. Finally, the images were observed using a confocal fluorescence microscope. Figure 6 As shown, the target bacteria treated with multivalent DNA nanowires showed stronger fluorescence intensity than the samples treated with the same concentration of monovalent aptamer-G-quadruplex, indicating that the multivalent DNA nanowires have stronger affinity.

[0072] Example 4

[0073] Multivalent DNA nanowire microfluidic chip for simultaneous detection of Staphylococcus aureus and Escherichia coli

[0074] The reaction chamber has two parallel channels, which are used to detect Staphylococcus aureus and Escherichia coli respectively. First, 10 μL of specific aptamer magnetic beads (MNBs-Apt) of Staphylococcus aureus and Escherichia coli are injected into different magnetic suction chambers respectively, and then 400 μL of samples containing two pathogens are injected into two magnetic suction chambers through the sample microchamber. Each magnetic suction chamber contains 200 μL. The pathogens are mixed with the corresponding specific MNBs-Apt and continue to be pumped into the downstream serpentine mixing channel. After mixing for 15 minutes for full capture, a magnet is placed under the reaction chamber to fix the pathogens captured by the magnetic beads, and then 20 μL of multivalent DNA nanowires corresponding to the pathogens (the nanowires have been prepared in advance and stored in the refrigerator) are slowly pumped in. The reaction continues for 15 minutes to form a "magnetic bead-pathogen-nanowire" sandwich structure, and then the sandwich structure is fixed with a magnet. After three washes, the two sandwich products are pumped into the downstream detection chamber with 5 μL of PBS respectively. Then, 3 μL of 50 mM ABTS was added to the detection chamber. 2- After fully reacting with 3 μL 50 mM hydrogen peroxide and 39 μL Tris-HCl Buffer for 7 minutes, colorimetric analysis was performed. In this embodiment, the RGB value of the photo was analyzed by taking a photo with a mobile phone to form a corresponding relationship with the bacterial concentration. The reaction of the two channels was carried out simultaneously. The detection principle is as follows Figure 1 and Figure 3 As shown. Figure 7 As shown, different concentrations (10 1 -10 7 The RGB value of Staphylococcus aureus and Escherichia coli (CFU / mL) was linearly related to the concentration of target bacteria. The standard curve equation of Staphylococcus aureus was y1=8.0357x1+106.29, and the correlation coefficient was R 2 =0.9914, the detection limit is 97CFU / mL; it can be used to detect target bacteria of unknown concentration; the standard curve equation of Escherichia coli is y2=7.6607x2+92.429, and the correlation coefficient is R 2 =0.9812, and the detection limit is 76 CFU / mL.

[0075] The curve obtained based on the RGB values ​​of the result images of different concentrations of Staphylococcus aureus and Escherichia coli is used to quantitatively detect the concentration of the target bacteria in the test solution; when the concentration of the added target bacteria is higher, the more multivalent DNA nanowires it specifically binds to, the more G-quadruplexes it binds to, and the better the final color development effect and the higher the absorbance value.

[0076] Example 5

[0077] In order to verify the value of the detection method in the fourth specific embodiment of the present invention in practical applications, Staphylococcus aureus and Escherichia coli were added to the cerebrospinal fluid as the doped samples, and the target bacteria at different concentrations were detected. The results are as follows: Figure 8 As shown, with the increase of pathogen concentration (10 1 -10 7 With the increase of CFU / mL, the RGB signal value gradually increases, which can effectively reflect the true concentration of adulterated pathogens.

[0078] Example 6

[0079] In order to verify the detection specificity of the detection method of the fourth specific embodiment of the present invention, 10 5 CFU / mL Escherichia coli, 10 5 CFU / mL Staphylococcus aureus, 10 5 CFU / mL Acinetobacter baumannii, 10 5 CFU / mL coagulase-negative staphylococci, 10 5 CFU / mL Vibrio vulnificus, 10 5 CFU / mL Klebsiella pneumoniae, 10 5 CFU / mL of Pseudomonas aeruginosa bacterial suspension and a mixture of these seven pathogens (mixing ratio 1:1:1:1:1:1:1) were tested. Fig. 9 As shown, when the target bacteria exist, the detected RGB value is much greater than the signal value of non-target pathogens, indicating that the detection method is specific to the target bacteria.

[0080] Although the disclosure is disclosed as above, the protection scope of the disclosure is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the disclosure, and these changes and modifications will fall within the protection scope of the present invention.

Claims

1. A microfluidic chip, characterized in that: The invention comprises aptamer magnetic beads, a reactor and a multivalent DNA nanowire reaction liquid. The aptamer magnetic beads comprise aptamer magnetic beads labeled with biotinylated Staphylococcus aureus aptamer and aptamer magnetic beads labeled with biotinylated Escherichia coli aptamer. The magnetic beads in the aptamer magnetic beads labeled with biotinylated Staphylococcus aureus aptamer are streptavidin magnetic beads, and the magnetic beads in the aptamer magnetic beads labeled with biotinylated Escherichia coli aptamer are streptavidin magnetic beads. In the biotinylated Staphylococcus aureus aptamer, biotin is connected to the 5' end of SEQ ID No.1, and in the biotinylated Escherichia coli aptamer, biotin is connected to the 5' end of SEQ ID No.

2. At the 5' end of No.2, the reactor comprises two sample microchambers (1), two magnetic suction chambers (2), two serpentine mixing channels (3), two detection chambers (4) and a sample outlet (5), wherein the sample microchamber (1) and the magnetic suction chamber (2) are connected via a swimming lane, the magnetic suction chamber (2) and the detection chamber (4) are connected via a serpentine mixing channel (3), and the detection chamber (4) and the sample outlet (5) are connected via a swimming lane; and the polyvalent DNA nanowire reaction liquid is a mixed liquid comprising polyvalent DNA nanowires, hemoglobin and Tris-HCl.

2. The microfluidic chip according to claim 1, characterized in that: The multivalent DNA nanowire is obtained by incubating the HCR initiating chain, the hairpin DNA H1, and the hairpin DNA H2 with the Escherichia coli aptamer, the Staphylococcus aureus aptamer, and the G-quadruplex. The nucleotide sequence of the HCR priming chain is shown in SEQ ID No. 3; The nucleotide sequence of the hairpin DNAH1 is shown in SEQ ID No.4; The nucleotide sequence of the hairpin DNA H2 is shown in SEQ ID No. 5; The nucleotide sequence of the Escherichia coli aptamer is shown in SEQ ID No.6; The nucleotide sequence of the Staphylococcus aureus aptamer is shown in SEQ ID No.7; The nucleotide sequence of the G-quadruplex is shown in SEQ ID No.

8.

3. The microfluidic chip according to claim 1, characterized in that: In the polyvalent DNA nanowire reaction solution, the volume ratio of the polyvalent DNA nanowire to heme is 5:(1-3).

4. A method for preparing a microfluidic chip according to any one of claims 1 to 3, characterized in that: The following steps are involved: S1: Preparation of aptamer magnetic beads; S2: Preparation of multivalent DNA nanowires; S3: Preparing a reactor by a mold.

5. The preparation method according to claim 4, characterized in that: The step S1 comprises the following steps: S11: mixing the streptavidin magnetic bead solution and the biotinylated Staphylococcus aureus aptamer solution and incubating them, adding the D-biotin solution to the reaction system after the incubation, incubating and blocking, washing the magnetic beads with phosphate buffer, and resuspending them with phosphate buffer to obtain biotinylated Staphylococcus aureus aptamer-labeled aptamer magnetic beads; S12: The streptavidin magnetic bead solution and the biotinylated Escherichia coli aptamer solution are mixed and incubated, and the D-biotin solution is added to the reaction system after the incubation is completed, and the magnetic beads are washed with phosphate buffer after incubation and resuspended with phosphate buffer to obtain biotinylated Escherichia coli aptamer-labeled aptamer magnetic beads.

6. The preparation method according to claim 4, characterized in that: The step S2 comprises the following steps: S21: All DNA sequences were centrifuged and dissolved separately, and the concentration of all DNA solutions was controlled to be 50 μM; S22: pre-annealing treatment was performed on HCR priming strand, hairpin DNAH1, hairpin DNAH2, G-quadruplex, Staphylococcus aureus aptamer, and Escherichia coli aptamer respectively; S23: mixing the hairpin DNA H1 treated in step S22, the hairpin DNA H2 treated in step S22, and the HCR priming chain treated in step S22, and incubating at 37° C. to form an HCR product; S24: Mix the Escherichia coli aptamer treated in step S22, the Staphylococcus aureus aptamer treated in step S22, the G-quadruplex treated in step S22, and the HCR product obtained in step S23, and incubate at 37° C. to form a multivalent DNA nanowire assembled with multivalent aptamers and G-quadruplexes.

7. The preparation method according to claim 6, characterized in that: In step S22, the annealing pre-treatment includes the following steps: the G-quadruplex is denatured at 95°C for 5 minutes and then shaken at room temperature for 2 hours; the hairpin DNA H1 is denatured at 95°C for 5 minutes and then placed on ice; the hairpin DNA H2 is denatured at 95°C for 5 minutes and then placed on ice, the Escherichia coli aptamer is denatured at 95°C for 5 minutes and then placed on ice; the Staphylococcus aureus aptamer is denatured at 95°C for 5 minutes and then placed on ice.

8. An application of the microfluidic chip according to any one of claims 1 to 3, characterized in that: The microfluidic chip is used for simultaneous quantitative detection of Escherichia coli and Staphylococcus aureus.

9. The use according to claim 8, characterized in that The microfluidic chip was used to simultaneously and quantitatively detect Escherichia coli and Staphylococcus aureus by the following steps: Step 1: injecting aptamer magnetic beads labeled with Staphylococcus aureus and aptamer magnetic beads labeled with Escherichia coli into different magnetic suction chambers (2) on the reactor respectively, and then injecting the sample into the two magnetic suction chambers (2) through the sample microchamber (1); Step 2: Mix the sample and magnetic beads and continue to pump the mixture into the downstream serpentine mixing channel (3) for full capture, and place a magnet under the reactor to fix the magnetic beads to capture pathogens; Step 3: slowly pump in the multivalent DNA nanowires to react and form a "magnetic bead-pathogen-nanowire" sandwich structure, then fix the sandwich structure with a magnet, wash it, and then pump the two sandwich products into the detection chamber with PBS (4); Step 4: Add ABTS2-, hydrogen peroxide and Tris-HCL Buffer into the detection chamber (4) to react fully for colorimetric analysis.

Images