Lilium small bulb occurrence regulation related protein, and coding gene and application thereof

By cloning and silencing the LiARF6 gene during lily scale propagation, the problem of unclear regulatory mechanisms for the growth and development of lily bulblets was solved, achieving the effects of accelerating bulblet growth and improving reproductive efficiency.

CN118207219BActive Publication Date: 2026-04-07BEIJING UNIV OF AGRI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410060225.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-16
Publication Date
2026-04-07
Estimated Expiration
2044-01-16

AI Technical Summary

Technical Problem

Lily bulblets have low reproductive efficiency and long propagation cycle. The complex hormonal network and its regulatory mechanism on bulblet formation and development are unclear. The regulatory mechanism of ARF in the growth and development of lily bulblets is still unknown.

Method used

The regulatory gene LiARF6, which regulates the formation of bulblets from lily scale cuttings, was cloned. Its expression characteristics were analyzed by RT-qPCR, and the LiARF6 gene was silenced using virus-induced gene silencing (VIGS) technology to promote the occurrence and development of bulblets.

Benefits of technology

It accelerated the growth and development of lily bulblets, improved the efficiency and quality of cutting propagation, and shortened the propagation cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118207219B_ABST
    Figure CN118207219B_ABST
Patent Text Reader

Abstract

This invention discloses proteins related to the regulation of lily bulblet formation, their encoding genes, and their applications. The lily bulblet formation regulation proteins disclosed in this invention are either A1) or A2): A1) is a protein with the amino acid sequence of Sequence 2; A2) is a protein with one or more amino acid residues substituted and / or deleted and / or added to the amino acid sequence shown in Sequence 2 in the sequence listing, and has the same function as the protein shown in Sequence 2. This invention isolated and identified a LiARF6 gene related to bulblet formation from scale cuttings in 'Siberian' lily, and improved it using VIGS technology. By infecting bulbs with a bacterial solution containing this gene vector, the effect of enhancing the formation of bulblets during scale cutting was successfully achieved, providing a new method for promoting lily scale cutting propagation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology. Specifically, this invention relates to a protein related to the regulation of lily bulb formation, its encoding gene, and its applications. Background Technology

[0002] Lilies are perennial herbaceous bulbous plants. Due to their unique flower shape, rich colors, and auspicious symbolism, they are beloved worldwide and are among the top ten cut flowers. Currently, the lilies available on the market are mainly the 'Siberian' lily, a hybrid of Oriental lilies. The 'Siberian' lily has beautiful white flowers with a unique fragrance. Its stems are sturdy, possessing strong antibacterial properties and no leaf burn, making it advantageous for storage and transportation. However, as it is a hybrid, bulb production must begin with virus-free tissue-cultured bulblets. After virus-free identification and cultivation into original bulbs, the scales are peeled off for propagation into new bulblets. It takes 2-3 years of cultivation to finally produce flowering commercial bulbs. This long propagation cycle and low efficiency significantly limit bulb production efficiency. A complex hormonal network plays a regulatory role in bulb formation and development. Auxin is often considered an important hormone affecting bulb development; the auxin-responsive factor ARF plays a crucial role in plant growth and development. However, the regulatory mechanism of ARF in the growth and development of lily bulblets remains unclear. Summary of the Invention

[0003] To address the aforementioned shortcomings in existing technologies, this invention provides a cloning and application of the lily bulblet formation regulatory gene LiARF6. Based on practical exploration, this invention divides the bulblet formation process of lily scale cuttings into four stages. Based on transcriptome data from these four stages, the gene sequence of LiARF6, the regulatory gene for lily scale cutting bulblet formation, was cloned. The expression characteristics of LiARF6 during bulblet formation were analyzed using RT-qPCR. Furthermore, the function of this gene in the bulblet formation process of lily scale cuttings was analyzed using virus-induced gene silencing (VIGS) technology. This provides a reference for in-depth research on the molecular mechanisms of bulblet formation during lily scale cuttings and its propagation applications.

[0004] The purpose of this invention is to provide a protein related to the regulation of lily bulb formation, its encoding gene, and its application.

[0005] The lily bulblet generation regulation-related protein provided by this invention is derived from lily (Lilium L.) and is as follows: A1) or A2):

[0006] A1) The amino acid sequence is the same as sequence 2 of the protein;

[0007] A2) A protein that has undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in Sequence 2 of the sequence listing and has the same function as the protein shown in Sequence 2.

[0008] Sequence 2 in the sequence listing consists of 942 amino acid residues.

[0009] To facilitate the purification of proteins in A1), tags as shown in Table 1 can be attached to the amino or carboxyl terminus of proteins consisting of the amino acid sequence shown in Sequence 2 of the sequence listing.

[0010] Table 1. Sequence of Labels

[0011] Label residues sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0012] The proteins in A1) or A2) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically. The encoding genes of the proteins in A2) above can be obtained by deleting one or more amino acid residues from the DNA sequence shown in Sequence 1 from the 5′ end to nucleotides 1-732 in the sequence listing, and / or by performing a missense mutation on one or more nucleotide pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0013] The genes encoding proteins related to the regulation of lily bulb formation mentioned above also fall within the scope of protection of this invention.

[0014] Preferably, the encoding gene is as follows: 1), 2), or 3):

[0015] 1) The cDNA or DNA molecule shown in sequence 1 of the sequence listing;

[0016] 2) Having 75% or more identity with the nucleotide sequence defined in 1), and encoding a cDNA molecule or DNA molecule encoding a protein related to the regulation of lily bulblet formation as described in claim 1;

[0017] 3) Hybridizes under stringent conditions to the nucleotide sequence defined in 1) and encodes a cDNA molecule or DNA molecule that encodes a protein related to the regulation of lily bulblets as described in claim 1.

[0018] Sequence 1 in the sequence listing consists of 2829 nucleotides, with the coding sequence being nucleotides 1-2829 from the 5' end of Sequence 1.

[0019] The application of the aforementioned proteins regulating lily bulblet development in controlling the rate of bulblet development is also within the scope of this invention. Specifically, regulating the rate of bulblet development can accelerate bulblet growth.

[0020] The application of biomaterials related to the proteins involved in the regulation of lily bulb development in accelerating the growth and development of lily bulbs is also within the scope of protection of this invention; the biomaterials are any one of B1) to B9) below:

[0021] B1) Nucleic acid molecules encoding proteins related to the regulation of lily bulblet formation;

[0022] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0023] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0024] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0025] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0026] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0027] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0028] B8) Nucleic acid molecules that inhibit the expression of genes encoding proteins that regulate the formation of lily bulblets;

[0029] B9) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0030] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0031] In the above applications, the nucleic acid molecule described in B1) can be one of the following: 1), 2), or 3):

[0032] 1) The cDNA or DNA molecule shown in sequence 1 of the sequence listing;

[0033] 2) A cDNA molecule or DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the grape canker resistance-related protein;

[0034] 3) A cDNA molecule or DNA molecule that hybridizes to the nucleotide sequence defined in 1) under strict conditions and encodes the grape canker resistance-related protein.

[0035] The term "identity" used here refers to sequence similarity to a natural nucleic acid sequence. "Identity" can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0036] The above stringent conditions can be hybridization and washing of the membrane in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS at 65°C.

[0037] B8) The nucleic acid molecule may specifically be a DNA molecule that is reverse complementary to any segment of the DNA molecule represented by nucleotides 1-738 of sequence 1 in the sequence listing.

[0038] The microorganisms may specifically be yeast, bacteria, algae, or fungi. The bacteria may be Agrobacterium, such as Agrobacterium EHA105.

[0039] The transgenic cell lines, transgenic plant tissues, and transgenic plant organs mentioned do not include plant propagation material.

[0040] The present invention also provides a method for accelerating the growth and development of lily bulblets, which involves inactivating the lily bulblet growth regulation-related protein or its encoding gene as described in claim 1, and screening to obtain transgenic plants that overexpress the lily bulblet growth regulation-related protein.

[0041] The method for inactivating the lily bulblet generation regulation-related protein or its encoding gene is to knock out or silence the lily bulblet generation regulation-related protein or its encoding gene.

[0042] The method for silencing the protein or its encoding gene that regulates the occurrence of lily bulblets is to silence the encoding gene of the protein that regulates the occurrence of lily bulblets using the VIGS system.

[0043] By using the above method to obtain lily mother scales with transiently silenced LiARF6 gene, when these scales were used for cutting culture, the development of small bulbils was advanced and the growth was accelerated, thus improving the efficiency and quality of cutting culture.

[0044] Experiments have shown that, phenotypically, silencing the LiARF6 gene in the VIGS system promotes the occurrence of bulblets and accelerates their growth and development.

[0045] The IAA content at the base of the LiARF6-silenced mother scale was higher than that in the blank control group. At 22 days, the IAA content at the base of the LiARF6-silenced mother scale was 52.7% higher than that in the empty pTRV2 lily mother scale, which is consistent with the detection efficiency of LiARF6 gene silencing. This proves that LiARF6 gene silencing increases the IAA content at the base of the mother scale, thus advancing the development of bulbils.

[0046] Thirty-two days after infection, the bulb weight and root number of small bulbs produced by pTRV2 empty vector and silent LiARF6 gene were statistically analyzed. The results showed that ( Figure 11 The average bulb weight and number of roots of lily bulblets both increased to varying degrees. Among them, the average bulb weight of lily bulblets silenced after transformation with pTRV2-LiARF6 increased by approximately 0.276g compared with the control group, and the average number of roots increased by approximately 18.8% compared with the control group.

[0047] The beneficial effects of this invention are:

[0048] 1. This invention has isolated and identified a LiARF6 gene associated with bulbil formation from 'Siberian' lily, and conducted a preliminary analysis of its structural characteristics and function in bulbil formation, providing a reference for further elucidating the molecular mechanism of bulbil formation from lily scale cuttings.

[0049] 2. This invention clones the 'Siberian' lily LiARF6 and studies its regulatory effect on bulblet formation, laying a molecular foundation for a comprehensive understanding of the development mechanism of bulblets and thus making full use of lily scale cutting propagation.

[0050] 3. This invention, based on an improved VIGS technology, successfully enhances the formation of small bulbs during lily scale propagation by infecting bulbils with a bacterial solution containing the constructed gene vector, providing a new method for promoting lily scale propagation. While gene editing can permanently knock out target genes to create stable new germplasm, the lily gene editing regeneration system is still imperfect. The realization of gene function in this invention provides a material basis for future stable germplasm production through lily scale propagation via gene editing. Attached Figure Description

[0051] Figure 1 Electrophoresis results of the amplified fragment of the LiARF6 gene in 'Siberian' lily.

[0052] Figure 2 It is the LiARF6 protein domain.

[0053] Figure 3 This is the phylogenetic tree of the LiARF6 system.

[0054] Figure 4Prediction of the secondary structure of the LiARF6 protein.

[0055] Figure 5 The results are from the LiARF6 subcellular localization assay.

[0056] Figure 6 To detect the silencing efficiency of the LiARF6 gene.

[0057] Figure 7 Phenotypic results of LiARF6-silenced infection in mother scales for 15 days

[0058] Figure 8 Phenotypic characteristics of LiARF6-silently infected 22-day-old mother scales

[0059] Figure 9 Phenotypic characteristics of LiARF6-silently infected 32-day-old mother scales

[0060] Figure 10 Effects of LiARF6 gene silencing on the content of endogenous hormone IAA in lilies

[0061] Figure 11 Effects of LiARF6 gene silencing on average bulb weight (left) and number of roots (right) of small bulbs Detailed Implementation

[0062] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0063] Plant materials:

[0064] The experimental material for this study was the Oriental lily hybrid 'Siberia'. Healthy bulbs were selected, and robust middle-layer scales were peeled off as mother scales for cuttings. These scales were rinsed with clean water, then soaked in a 1:5000 carbendazim solution for 30 minutes for disinfection, rinsed again with clean water, and air-dried. They were then planted in peat moss that had been autoclaved; the ideal moisture level was when the peat moss could not crumble when squeezed in the hand. Scales on day 0 were designated as stage S1, those on day 10 with a slightly raised base were designated as stage S2, those on day 20 with the formation of the growth cone at the base of the scales were designated as stage S3, and those on day 30 with complete formation and swelling of the bulblets were designated as stage S4. Transcriptome analysis was performed at these four stages. Subcellular localization was performed on Nicotiana benthamiana bulbifera cultured for 4-5 weeks.

[0065] Example 1: Obtaining the protein related to the regulation of lily bulblet development and its encoding gene LiARF6 according to the present invention.

[0066] I. Cloning of the LiARF6 gene.

[0067] Using the base of 'Siberian' lily bulbs as material, total RNA was extracted using a plant polysaccharide and polyphenol RNA extraction kit (Beijing Aibosen), and then utilized... Reverse transcription was performed using the First-Strand cDNA Synthesis Super Mix kit. Based on the transcriptome sequence information, full-length amplification primers were designed using SnapGene: LiARF6-F: ATGAGGCTATCTTCGGCAGG, LiARF6-R: TCAGTAGTCCAGTGCACCTA. PCR amplification was performed using 'Siberian' lily bulb base DNA as a template, following the RT-qPCR (Full Gold) instructions. The reaction mixture consisted of 12.5 μL of 2x Apex HFFSPCR Master Mix, 0.5 μL each of forward and reverse primers, 1 μL of cDNA, and 10.5 μL of Nuclease-free Water. The reaction program was: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 90 s, 34 cycles; 72°C extension for 5 min. The gel-cut products recovered in the previous step were ligated and transformed using the zero-background pTOPO-TA Blunt cloning kit. The bacterial culture was sent to Beijing Sangon Biotech for sequencing and plasmid extraction. The sequencing results were compared with the original sequence in SnapGene software and further analyzed with NCBI. The plasmids with correct alignment were stored at -20℃ for subsequent experiments.

[0068] The results showed that the final band position of LiARF6 was around 2800 bp in the gel electrophoresis image. Figure 1 Sequencing analysis showed that the LiARF6 gene sequence fragment is 2829 bp in length and encodes 942 amino acids. The LiARF6 protein sequence is shown in Sequence 2 of the sequence listing, and the sequence of its encoding gene is shown in Sequence 1 of the sequence listing. The coding sequence is from nucleotides 1 to 2829 at the 5' end of Sequence 1.

[0069] Example 2, LiARF6 bioinformatics analysis:

[0070] The sequence was translated into a protein, and the conserved domain information of the protein was obtained by alignment using CD Search in NCBI. The results are as follows: Figure 2As shown, this protein contains three conserved domains of the ARF family: the B3 domain (amino acid sequence 127-229, E-value 3.99e-27), the Auxin_resp domain (amino acid sequence 259-336, E-value 4.38e-40), and the Aux_IAA domain (amino acid sequence 800-881, E-value 5.28e-06). Using the BLAST function on the NCBI online website, 26 amino acid sequences similar to this gene were downloaded, and protein homology comparisons were performed to construct a phylogenetic tree. The results are shown below. Figure 3 As shown. It exhibits high similarity and homology to proteins from rubber tree (Hevea brasiliensis), yam (Dioscorea cayenensis subsp. Rotundata), and cassava (Manihot esculenta). The LiARF6 gene encodes a protein with a relative molecular mass of 10.5 kDa, a total of 7429 atoms, and a molecular formula of C4607H7199N1325O1430S37. It contains 65 positively charged amino acid residues and 79 negatively charged residues. The protein has an instability index of 72.69 and an average hydrophilicity index of -0.518, classifying it as an unstable hydrophilic protein. The LiARF6 protein contains 310 α-helices and 428 random coils, accounting for 32.91% and 45.44% respectively; it also contains 144 extended strands and 60 β-turns, accounting for 15.29% and 6.37% respectively. Figure 4 ).

[0071] Example 3: Subcellular localization analysis of the LiARF6 gene:

[0072] Using the base of 'Siberian' lily bulbs as material, total RNA was extracted using a plant polysaccharide and polyphenol RNA extraction kit (Beijing Aibosen). The LiARF6 gene fragment was amplified by RT-PCR using the following primers. Primers for ligating the LiARF6 gene into a subcellular localization vector were: LiARF6-YF: agtggtctctgtccagtcctATGAGGCTATCTTCGGCAGG; LiARF6-YR: ggtctcagcagaccacaagtTCAGTAGTCCAGTGCACCTA. After adding samples according to the vector single-enzyme digestion reaction system (Table A), the mixture was homogenized and digested. The vector pNC-Cam1304-subN, digested with Sfi I restriction endonuclease, was mixed with the purified and recovered LiARF6 gene target fragment to construct a subcellular localization vector expressing the LiARF6 gene. After homogenization, ligation was performed in a metal bath. The vector was then transformed into competent *E. coli* cells. The bacterial culture PCR results were correct, and the samples were sent to Beijing Sangon Biotech for sequencing. Sequence alignment was performed on the returned sequencing results. The recombinant plasmid expressing LiARF6 that showed correct sequencing results was named...

[0073] The pNC-Cam1304-subN-LiARF6 plasmid was stored at -20℃ for subsequent experiments. (The pNC-Cam1304-subN vector was provided by Dr. Yan Pu of the Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences (ITBB, CATAS). pNC-Cam1304-subN has been documented and published in the literature: Yin Guanwen. Research on Cloning and Breeding Application of MbCFAT1 Gene in *Cymbopogon schreberi* [D]. Fujian Agriculture and Forestry University, 2023. or (and) Yan P, Zeng Y, Shen W, Tuo D, Li X and Zhou P. NimbleCloning: A Simple, Versile, and Efficient System for Standardized Molecular Cloning. Front. Bioeng. Biotechnol. 2020.7:460.)

[0074] A certain concentration of recombinant plasmid pNC-Cam1304-subN-LiARF6 and empty vector pNC-Cam1304-subN were transformed into Agrobacterium GV3101, which then infected the abaxial surface of tobacco leaves. The location of green fluorescence expression in the cells was observed under a laser confocal microscope. The results showed that ( Figure 5 ), control group unloaded pNC-Cam1304-subN ( Figure 5 Green fluorescence can be observed throughout the cell in the GFP group, and fluorescence dispersion is also observed in surrounding cells. However, cells containing the target gene LiARF6 (…) exhibit this fluorescence. Figure 5The green fluorescence of LiARF6-GFP in tobacco leaves was only detected in the cell nucleus, and no green fluorescence was observed in other cellular structures, indicating that LiARF6 is located in the cell nucleus and mainly functions in the cell nucleus.

[0075] Example 4: Expression and functional analysis of the LiARF6 gene based on VIGS silencing:

[0076] I. Expression analysis of LiARF6 gene silenced based on VIGS

[0077] A virus-induced gene silencing method was used to successfully construct the pNC-TRV2-LiARF6 silencing expression vector. This vector was transformed into Agrobacterium and then used to infect the mother scales of 'Siberian' lily used for cutting propagation. The primers used for constructing the VIGS silencing vector were: T-LiARF6-F.

[0078] agtggtctctgtccagtcctATGTGGCTCAATGGAG, T-LiARF6-R:

[0079] ggtctcagcagaccacaagtATTGAGGTGGCAGATG.

[0080] A 274bp fragment of the LiARF6 gene sequence was selected using SnapGene software. Primers were designed for this fragment, and universal adapter primers for NC vectors were added to its front end: T-LiARF6-F and T-LiARF6-R, respectively. The target fragment was amplified by PCR using the plasmid returned from sequencing as a template. The amplified LiARF6 gene was then cloned into the pNC-TRV2 vector to obtain the pNC-TRV2-LiARF6 silencing expression vector.

[0081] pNC-TRV2-LiARF6 is a recombinant vector obtained by reverse insertion of DNA fragments from positions 1195 to 1468 of sequence 1 in the pNC-TRV2 vector.

[0082] The empty vectors pNC-TRV2-LiARF6, pNC-TRV2, and TRV1 were transformed into Agrobacterium. Selected bacterial suspensions confirmed by PCR were used for Agrobacterium propagation. 1 mL of the bacterial suspension was added to 50 mL of LB broth containing kanamycin and rifampin, and cultured with shaking at 200 rpm for 8 hours. Once the suspension became turbid, it was poured into 200 mL of LB broth containing the same antibiotics and cultured overnight. The overnight cultured suspension, confirmed by PCR, was centrifuged at 6000 rpm for 15 minutes to collect the bacteria. The supernatant was discarded, and the lower bacterial precipitate was resuspended in infection solution. The pH was adjusted to 5.6, and the OD value to 0.9. The empty TRV1 bacterial suspension was mixed with an equal volume of pNC-TRV2 bacterial suspension (this is the infection solution), and incubated in the dark for 3 hours. Healthy mid-layer scales of 'Siberian' lily bulbs were selected for infection. The scales were immersed in the infection solution, and a vacuum was applied until the pressure reached -0.9 kPa. After standing for 10 minutes, this process was repeated once. The bulbs were then removed and kept in the dark for 10 hours before being transferred to normal light conditions for culture. A second infection was performed one week later. Control groups were provided by injection of TRV1 and pNC-TRV2 transgenic bacterial cultures. (TRV1 and pNC-TRV2 vectors were provided by Dr. Yan Pu of the Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences (ITBB, CATAS). TRV1 and pNC-TRV2 were derived from the literature by Muthappa Senthil-Kumar &...)

[0083] Kirankumar S Mysore. Tobacco rattle virus–based virus-induced genesilencing in Nicotiana benthamian. Nature Protocols, 20149(9):1549–1562. Or (and) Yan P, Tuo D, Shen W, DengH, Zhou P, Gao XA Nimble Clonin-compatible vectorsystem for high-throughput gene functional analysis in plants.

[0084] (Recorded and published in Plantcommunications, 2023, 4, 100471)

[0085] After silencing the LiARF6 gene, samples were collected after normal growth until phenotypic differences were observed (at 15, 22, and 32 days). Gene expression levels were then measured by real-time RT-qPCR (primer sequences for quantitative real-time PCR: Q-LiARF6-F: CGTGTTTCTGTGGGAATGCG, Q-LiARF6-R: ATCCCAGCCAACCTTCACAG; Lilium-Actin-F / Lilium-Actin-R were internal control primers: Lilium-Actin-F: ACCTCCAATCCAGACACTG, Lilium-Actin-R: TTGCTGACCGTATGAGCAAG). The levels of endogenous hormone IAA were measured using an ELISA kit, and gene expression levels were simultaneously detected using real-time quantitative PCR.

[0086] The results showed that the expression level of the endogenous LiARF6 gene in LiARF6-silenced lilies was significantly reduced after 15 days. Figure 6 In pNC-TRV2-LiARF6-infected scales, the expression level of the LiARF6 gene decreased by about 40% compared with the control group; at 22 days, it decreased by about 67% compared with the control group; but at 32 days, the gene expression level was higher than that of the control group (the VIGS silencing efficiency decreased after a longer period of time). This indicates that the LiARF6 gene was effectively silenced and further experiments can be carried out.

[0087] II. Phenotypic characteristics after LiARF6 gene silencing

[0088] After 32 days of infection, the weight of bulbs and the number of roots of pNC-TRV2 and pNC-TRV2-LiARF6 lilies were counted.

[0089] After infection, the pNC-TRV2 was transferred to an empty carrier. Figure 7 , 8 TRV2 in 9 and the maternal scales of the silenced LiARF6 gene ( Figure 7 , 8 The phenotype of TRV2-ARF6 in pNC-TRV2-LiARF6 was compared, and it was found that at 15 days after infection, the base of the pNC-TRV2-LiARF6 mother scales showed obvious bulging, while the base of the untransplanted mother scales in the control group showed no change. Figure 7 ); at 22 days of infection, the base of the pNC-TRV2-LiARF6 lily mother scales had already developed obvious growth cones, while the base of the control group empty mother scales had just begun to bulge. Figure 8 ); At 32 days of infection, complete bulbils formed at the base of both pNC-TRV2-LiARF6 mother scales and the control group, but the number of bulbils in the control group was smaller than that produced by pNC-TRV2-LiARF6 lily mother scales. Figure 9 Phenotypically, silencing the LiARF6 gene promotes the occurrence of bulblets and accelerates their growth and development.

[0090] III. Effects of LiARF6 gene silencing on auxin content in 'Siberian' lilies

[0091] The content of endogenous hormone IAA at the base of the mother scales was measured, and the results showed ( Figure 10 The IAA content at the base of LiARF6-silenced mother scales (transgenic pNC-TRV2 lily) was higher than that in the blank control group. At 22 days, the IAA content at the base of LiARF6-silenced mother scales was 52.7% higher than that in the empty pNC-TRV2 lily mother scales, which is consistent with the detection efficiency of LiARF6 gene silencing. This proves that LiARF6 gene silencing increases the IAA content at the base of mother scales, thus advancing the development of small bulbils.

[0092] IV. Effects of LiARF6 gene silencing on average bulb weight and number of roots in small bulbs

[0093] Thirty-two days after infection, the bulb weight and root number of small bulbs produced by pNC-TRV2 empty vector and LiARF6 gene silenced were statistically analyzed. The results showed that ( Figure 11 The average bulb weight and number of roots of lily bulblets both increased to varying degrees. Among them, the average bulb weight of lily bulblets silenced after transformation with pNC-TRV2-LiARF6 increased by approximately 0.276g compared with the control group, and the average number of roots increased by approximately 18.8% compared with the control group.

[0094] In summary, this invention isolated and identified a LiARF6 gene associated with bulblet formation in lily scale cuttings from 'Siberian' lily. Based on VIGS technology, and through the inoculation of bulbs with a bacterial solution containing this gene vector, the invention successfully enhanced the formation of bulblets during lily scale cutting propagation, providing a new method for promoting lily scale cutting propagation. While gene editing can permanently knock out target genes to create stable new germplasm, the lily gene editing regeneration system is still imperfect. The realization of gene function in this invention provides a material basis for future gene editing to generate stable germplasm in lily scale cutting propagation.

[0095] This application is the first to study the effect of ARF6 in this type of gene on the development of bulbils during the scale cutting process of the famous bulbous flower lily. It not only enriches the biological function of ARF transcription factors, but also, by optimizing VIGS silencing technology, obtains an application method that can effectively promote the development of lily bulbils using biological agents, laying a theoretical, technical and material foundation for improving the reproductive efficiency of lilies.

[0096] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

[0097] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. Application of the gene encoding the protein related to the regulation of lily bulb formation shown in Sequence 2 of the silencing sequence listing in increasing the bulb weight and number of roots of lily bulbs in lily scale cutting culture, wherein the silencing is achieved by the VIGS system and the DNA fragment at positions 1195-1468 in Sequence 1 of the sequence listing.

2. The application according to claim 1, characterized in that, The sequence of the encoding gene is sequence 1 in the sequence listing.

3. A method for increasing the bulb weight and root count of lily bulblets in lily scale cutting culture, characterized in that, The gene encoding the protein related to the regulation of lily bulb formation, shown in Sequence 2 of the Silencing Sequence Listing, is silenced by the VIGS system and the DNA fragment at positions 1195-1468 in Sequence 1 of the Silencing Sequence Listing.

Citation Information

Patent Citations

  • Cloning method and application of lily bulbil formation regulation gene LlWOX11

    CN113388619A