A system for preparing circular RNA in vitro based on group I intron ribozyme and its application

Abstract

The present invention belongs to the field of nucleic acid technology and biomedicine, and specifically relates to a system for preparing circular RNA in vitro based on type I intron ribozymes and its application. Specifically, the present invention provides a nucleic acid composition for producing a circular sequence to be cyclized (Gene of interest, GOI), the nucleic acid composition comprising a first nucleic acid component and a second nucleic acid component; the first nucleic acid component is an RNA having the following structure or a nucleic acid producing the RNA: a first matching sequence-ribozyme sequence-second matching sequence; the second nucleic acid component is an RNA having the following structure or a nucleic acid producing the RNA: a third matching sequence-5' end structure-sequence to be cyclized (GOI)-3' end structure-fourth matching sequence; the first matching sequence and at least 75%, 80%, 85%, 90%, 95% of the fourth matching sequence are mutually reverse complementary sequences; the second matching sequence and at least 75%, 80%, 85%, 90%, 95% of the third matching sequence are mutually reverse complementary sequences.

Description

Technical Field

[0001] The present invention belongs to the field of nucleic acid technology and biomedicine, and specifically relates to a system for preparing circular RNA in vitro based on type I intron ribozymes and its application. Background Art

[0002] Circular RNA is a single-stranded RNA molecule that is mainly formed during the mRNA splicing process in cells through the reverse splicing mechanism. It does not have a 5' cap and a 3' poly (A) tail structure. Compared with linear RNA, the circular structure has excellent stability and is not easily degraded by nucleases. Recent studies have shown that circular RNA has the functions of adsorbing miRNA, proteins, protein translation and biomarkers. Due to the widespread use of mRNA vaccines in the human body, circular RNA has become a key technology platform in the field of RNA vaccine research and development with its unique advantages. Especially in the research on the new coronavirus, the successful application of circular RNA vaccines has provided potential possibilities for its use in vaccine preparation.

[0003] At present, there are several methods that can be used to synthesize circular RNA in vitro, including chemical catalysis, enzyme catalysis, and ribozyme technology. The chemical catalysis method has low ligation efficiency and is prone to introduce impurities during the reaction, posing potential safety risks. The enzyme catalysis method mainly uses T4 DNA ligase, T4 RNA ligase 1, and T4 RNA ligase 2 to achieve RNA cyclization with or without splints. However, this method has low efficiency, difficulty in connecting large RNA molecules, and serious intermolecular connection problems. Ribozyme technology mainly relies on the exon-intron rearrangement method to design and synthesize linear RNA molecules, and then uses the autocatalytic mechanism to achieve RNA cyclization. Due to its efficient cyclization ability, simple reaction conditions, and purification process, ribozyme technology has become the mainstream method for synthesizing circular RNA in vitro.

[0004] In the process of ribozyme preparation of circular RNA, improving circularization efficiency and reducing production costs are crucial to promote downstream applications. At present, group I intron is one of the important ribozymes for in vitro synthesis of circular RNA, among which the most commonly used ones include T4 bacteriophage td gene intron and Anabaena tRNA gene intron. Although there are some optimization methods, some of them may introduce a large number of exogenous sequences and lead to complementary pairing of the internal sequences of the final circular RNA, which may cause the circular RNA to induce unnecessary immune responses in downstream in vivo applications, bringing potential safety risks. Other methods achieve circularization by hiding splicing sites within the sequence to avoid the introduction of redundant exogenous sequences. However, this usually requires personalized design according to different RNA sequences, so it lacks versatility. Summary of the invention

[0005] The present invention adopts a novel universal RNA cyclization system named SIE (Seperated intronexon), which has high cyclization efficiency and can be used to catalyze RNA of different lengths. The ribozyme (component 1, the first nucleic acid component) in the system can be recovered and reused multiple times, which helps to reduce production costs; at the same time, the system does not introduce redundant complementary pairing sequences, which minimizes possible immunogenicity.

[0006] Specifically, the present invention provides the following technical solutions:

[0007] In one aspect, the present invention provides a nucleic acid composition for producing a circular sequence to be cyclized (Gene of interest, GOI), the nucleic acid composition comprising a first nucleic acid component and a second nucleic acid component;

[0008] The first nucleic acid component is an RNA having the following structure or a nucleic acid that produces the RNA: a first matching sequence-ribozyme sequence-a second matching sequence;

[0009] The second nucleic acid component is an RNA or a nucleic acid that produces the RNA having the following structure: a third matching sequence-5' end structure-sequence to be cyclized (GOI) or restriction site-3' end structure-fourth matching sequence;

[0010] The first matching sequence and at least 75%, 80%, 85%, 90%, 95% of the fourth matching sequence are reverse complementary sequences to each other;

[0011] The second matching sequence and at least 75%, 80%, 85%, 90%, 95% of the third matching sequence are reverse complementary sequences to each other.

[0012] Preferably, the ribozyme sequence has the sequence shown in SEQ ID NO.1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34.

[0013] Preferably, the 5' end structure has a sequence shown in SEQ ID NO. 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35.

[0014] Preferably, the 3' end structure has a sequence shown in SEQ ID NO. 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36.

[0015] Preferably, the first matching sequence and the fourth matching sequence are reverse complementary sequences to each other.

[0016] Preferably, the second matching sequence and the third matching sequence are reverse complementary sequences to each other.

[0017] Preferably, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence, each independently, can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nt in length.

[0018] Preferably, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length.

[0019] Preferably, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is at least 5 nt.

[0020] Preferably, the length of the first matching sequence, the second matching sequence, the third matching sequence or the fourth matching sequence is 5-50 nt.

[0021] In the present invention, the "sequence to be cyclized (GOI)" can be linear or circular, and may contain one or more of IRES, "target RNA (target gene)" or other elements (such as elements that promote gene expression, spacer, 5'UTR, 3'UTR). The "target RNA" includes any naturally occurring sequence or artificially synthesized sequence, such as any viral antigen, chimeric antigen receptor (CAR) or T cell receptor (TCR), etc. The technical solution to be solved by the present invention is to obtain a circular "sequence to be cyclized" more efficiently, so that the target RNA (target gene) is stably and continuously highly expressed. The term "restriction enzyme cutting site" refers to a specific sequence of a base on DNA, and a restriction endonuclease can recognize this sequence and cut the DNA sequence into two segments here. The restriction enzyme cutting site in the present invention includes a specific sequence recognized by a restriction endonuclease, and also includes a sequence that can be excised after being recognized by two restriction endonucleases.

[0022] Preferably, the IRES sequence of the present invention includes an IRES sequence from any source, and the IRES sequence may include but is not limited to Taura syndrome virus, blood-sucking assassin bug virus, Theile's encephalomyelitis virus, simian virus type 40, red fire ant virus type 1, cereal aphid virus, reticuloendotheliosis virus, Forman polio virus type 1, soybean looper virus, Kashmir bee virus, human rhinovirus type 2, human immunodeficiency virus type 1, glass leafhopper virus type 1, lice P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus, equine rhinovirus, tea looper-like virus, encephalomyocarditis virus, fruit fly C virus, crucifer tobacco virus, cricket paralysis virus, bovine viral diarrhea virus type 1, black queen cell disease Virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, hibiscus yellow ringspot virus, swine fever virus, human FGF2, human SFTPA1, human AML1, fruit fly antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2, human p53, human Pim-1, mouse Rbm3, fruit fly reaper, dog Scamper, fruit fly Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP. Or the IRES type disclosed in CN112399860A and US11203767B2 patent applications. The wild-type IRES sequence can also be modified or mutated and applied to the present invention.

[0023] Specifically, the IRES of Coxsackie B3 virus (CVB3) was used for verification in the specific embodiments of the present invention. Preferably, the coding sequence of the IRES of Coxsackie B3 virus (CVB3) is shown in SEQ ID NO.43.

[0024] Preferably, the first nucleic acid component and the second nucleic acid component can be mixed in any proportion; for example, the molar ratio of the first nucleic acid component to the second nucleic acid component is 0.01-100 (including 1-100), 0.1-10 (including 1-10), 0.5-2, more specifically, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2; most preferably, the amount of the first nucleic acid component used is more than the second nucleic acid component.

[0025] Preferably, the nucleic acid of the present invention includes DNA and RNA; the nucleic acid may be single-stranded or double-stranded; and the nucleic acid (including the circular RNA prepared by the present invention) may contain modified nucleotide bases.

[0026] Preferably, the modification includes phosphate backbone modification, base modification, and ribose modification.

[0027] Preferably, the phosphate backbone modification may be a thio modification, which refers to the replacement of the non-bridging oxygen atom in the phosphodiester bond in the nucleotide fragment by a sulfur atom; the modification of the phosphate backbone may also be achieved by forming other types of phosphate bonds, including but not limited to methyl phosphate, selenophosphate, methylborylphosphate and dithiophosphate.

[0028] Preferably, the ribose modification may be modification of the 2' position of the pentose. The 2' position modification of the pentose includes but is not limited to methoxy, methoxyethoxy, propyleneoxy and fluoro modification.

[0029] Preferably, the base modification mainly refers to the inclusion of rare bases in single-stranded deoxynucleotides, and rare bases refer to some bases other than A, G, C, U, and T, including dihydrouracil (DHU), pseudouracil, and methylated purine (mG, mA).

[0030] Preferably, the nucleic acid may be linear or circular, preferably linear.

[0031] Specifically, the ribozyme and substrate RNA fragments in the nucleic acid composition are separated, and are applicable to all RNA circularization methods based on intronic ribozymes (including but not limited to type I and II intronic ribozymes).

[0032] On the other hand, the present invention also provides a vector or vector composition for expressing the sequence to be cyclized, wherein the vector or vector composition carries the aforementioned nucleic acid composition.

[0033] The term "vector" refers to a nucleic acid carrier into which a polynucleotide can be inserted. A vector can be introduced into a host cell by transformation, transduction or transfection so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art, and include but are not limited to: plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage and animal viruses, etc.

[0034] Preferably, the first nucleic acid component and the second nucleic acid component are located on different vectors, or the first nucleic acid component and the second nucleic acid component are located on the same vector.

[0035] More preferably, a promoter is respectively provided in front of the first nucleic acid component and the second nucleic acid component, the first nucleic acid component is connected to the first promoter, and the second nucleic acid component is connected to the second promoter.

[0036] Preferably, the first promoter and the second promoter are identical or different.

[0037] Preferably, the first promoter and the second promoter each independently include T7, Sp6, T3, T7lac, araBAD, trp, lac, Ptac, pL, CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1, and U6 promoters.

[0038] Preferably, the first promoter and the second promoter, each independently, are promoters routinely used in vitro.

[0039] Preferably, the first promoter and the second promoter, each independently, are T7 promoters.

[0040] In another aspect, the present invention also provides a cell comprising the above nucleic acid composition or vector.

[0041] Preferably, the cells include prokaryotic and eukaryotic cells.

[0042] Preferably, the prokaryotic cells include various bacterial cells, including Escherichia coli (E. coli).

[0043] Preferably, the eukaryotic cells include, but are not limited to, mammalian cells, insect cells, plant cells, fungal cells, eukaryotic algae cells, nematode cells, protozoan cells and fish cells.

[0044] In a specific embodiment, said cells do not comprise embryonic cells.

[0045] In a specific embodiment, the cell is an isolated cell or a commercial cell line.

[0046] In another aspect, the present invention provides a method for producing a sequence to be cyclized, the method comprising mixing the aforementioned first nucleic acid component with the second nucleic acid component, or allowing the aforementioned vector to transcribe and express, or culturing the aforementioned cell.

[0047] Specifically, the first nucleic acid component and the second nucleic acid component are mixed, and then a buffer solution is added and incubated.

[0048] More specifically, the incubation condition is 37-60° C. for 5-60 min; preferably, 55° C. for 15 min.

[0049] Preferably, the buffer solution contains GTP or excess GMP; preferably, the final concentration of GTP is 2 mM;

[0050] Preferably, the buffer solution contains magnesium ions (Mg 2+ ); Preferably, the buffer solution contains 10 mM MgCl2.

[0051] Preferably, the buffer solution consists of 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5.

[0052] Preferably, the method further comprises the step of purifying the product to improve its purity.

[0053] In certain embodiments, the circularized RNA may or may not have actual function.

[0054] Preferably, the method is performed in vitro.

[0055] Preferably, the method is of therapeutic or non-therapeutic purpose.

[0056] On the other hand, the present invention provides a circular sequence to be cyclized prepared by the above method.

[0057] In another aspect, the present invention provides a composition comprising the above-mentioned nucleic acid composition, vector, cell or sequence to be circularized.

[0058] Preferably, the composition further comprises an agent that promotes gene transfection.

[0059] Specifically, the gene transfection includes allowing the aforementioned product of the present invention to enter cells.

[0060] Preferably, the reagents include lipids and liposomes (DOTMA, DOGS, DOPE, etc.), calcium phosphate, polyethylene glycol (PEG), cationic polymers (such as polyethyleneimine (PEI), DEAE-dextran, nanoparticles, or lipo series commercial transfection reagents.

[0061] Preferably, the composition is a pharmaceutical composition, which further contains a pharmaceutically acceptable carrier.

[0062] The "pharmaceutically acceptable carrier" used herein should be compatible with the aforementioned sequence combination, nucleic acid sequence, vector, and host cell of the present invention, that is, it can be mixed therewith without significantly reducing the effect of the pharmaceutical composition under normal circumstances.

[0063] Preferably, the pharmaceutical composition can be formulated for various ways of parenteral or non-parenteral administration. It can be provided, for example, as a sterile liquid preparation, such as an isotonic aqueous solution, emulsion, suspension, dispersion or viscous composition, which can be buffered to a desired pH.

[0064] On the other hand, the present invention provides the use of any one of the above nucleic acid compositions, cells or compositions in preparing sequences to be cyclized, or increasing the content or expression of target RNA in cells.

[0065] More specifically, a circular sequence to be cyclized is prepared.

[0066] On the other hand, the present invention provides the use of any one of the above nucleic acid compositions, cells or compositions in the preparation of a product for increasing the content or expression of a target RNA in a cell.

[0067] Beneficial effects:

[0068] 1. The present invention greatly increases the flexibility of the system by separating the ribozyme and the reaction sequence. In the past, when using type I ribozymes, the ribozyme and the reaction fragment were both present on the same RNA chain, which made it quite challenging for the ribozyme to efficiently cyclize the RNA fragment. However, in our system, we can add a large number of ribozymes to promote the reaction, thereby significantly increasing the possibility of RNA cyclization.

[0069] In the common exon-intron rearrangement (PIE) system, the spatial distance between the two domains of PIE is far during the cyclization of long RNA fragments, so it is quite difficult to form a complete active center. In contrast, the ribozyme in our system exists as an independent unit, which can more easily form a complete reaction center. In addition, our ribozyme can be used in excess, which significantly promotes the possibility of long RNA cyclization.

[0070] 2. The traditional PIE method requires internal complementary pairing sequences to assist in cyclization, and the double-stranded RNA structure formed in this way increases the potential immunogenicity. However, our innovative cyclization scheme does not introduce complementary pairing sequences into circular RNA, thus reducing the potential immunogenicity problem.

[0071] 3. The cyclization reactants and products involved in the present invention are relatively clear and single, which facilitates the purification of the circular RNA product in the later stage.

[0072] 4. The ribozyme in this system can be recovered and reused many times, which helps to reduce production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 It is a schematic diagram of the two-component SIE system.

[0074] Figure 2 This is the working principle diagram of the SIE system.

[0075] Figure 3 This is the SIE system cyclization efficiency test result diagram.

[0076] Figure 4 This is the result of HPLC separation of the cyclization products of the SIE system.

[0077] Figure 5 This is the result of DNA sequencing to verify the circular RNA splicing site.

[0078] Figure 6 This is a graph showing the expression results of circular RNA prepared by the SIE system. DETAILED DESCRIPTION

[0079] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes based on the technical solution and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0080] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0081] The SIE system provided by the present invention comprises two RNA components, component 1 is a ribozyme with a substantially complete sequence formed by opening the rings of P1 / P2 and P9 / P.1 / P9.2 of the ribozyme, and component 2 is composed of carrying sequences corresponding to the two ends of component 1 (component 2-5' end and component 2-3' end) on both sides of the GOI sequence (or enzyme cleavage site); at the same time, matching sequences are set at both ends of component 1 and component 2 to facilitate the proximity of component 1 and component 2. Figure 1 shown.

[0082] Preferably, component 1 and its corresponding component 2-5' end and component 2-3' end in various SIE systems provided by the present invention are as shown in Table 1.

[0083] Table 1. Sequences in the SIE system

[0084]

[0085] SEQ ID NO.1: TGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGG GAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTAACAATAGATGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTA

[0086] SEQ ID NO.2: CGACCTTATCTGAACATAATGCTTAG

[0087] SEQ ID NO.3:TTGGGTTA

[0088] Specifically, the above SIE systems are named after the intron sources and the opening positions. For example, the P1+P9.2 system represents the SIE system of the ribozyme sequence that opens at the P1 and P9.2 positions to form component 1, and the corresponding component 2 is set according to component 1; in addition, matching sequences are set at both ends of component 1 and component 2 to form a complete SIE system, which can be subsequently used to prepare circularized RNA.

[0089] More specifically, the matching sequence at the 5' end of component 1 is called the first matching sequence, the matching sequence at the 3' end of component 1 is called the second matching sequence, the matching sequence at the 5' end of component 2 is called the third matching sequence (connected to the 5' end structure), and the matching sequence at the 3' end of component 2 is called the fourth matching sequence (connected to the 3' end structure).

[0090] The first matching sequence can be paired with at least 75%, 80%, 85%, 90%, 95% of the fourth matching sequence, and the second matching sequence can be paired with at least 75%, 80%, 85%, 90%, 95% of the third matching sequence. Preferably, the first matching sequence is completely paired with the fourth matching sequence, and the second matching sequence is completely paired with the third matching sequence.

[0091] By adding in vitro promoters (such as T7 promoter from Escherichia coli) in front of the designed two components of the SIE system, the two RNA components in the SIE system can be synthesized using an in vitro transcription kit to prepare circular RNA.

[0092] In the following, circular RNA was prepared in the T4-P1+P9.2 system using IRES-EGFP (CVB3-IRES and the coding sequence of EGFP were connected by Kozak) as GOI as an example.

[0093] Example 1: Preparation of circular RNA

[0094] The sequence shown in SEQ ID NO. 37-38 was constructed into a vector to prepare circularized IRES-EGFP.

[0095] Among them, SEQ ID NO.37 is composed of the first matching sequence (SEQ ID NO.39), ribozyme (component 1, first nucleic acid structure) (SEQ ID NO.1), and the second matching sequence connected in sequence (SEQ ID NO.40). SEQ ID NO.38 carries the coding sequence of IRES and EGFP. SEQ ID NO.38 is composed of the third matching sequence (SEQ ID NO.41), component 2-5' end (SEQID NO.2), Spacer 1 (SEQ ID NO.42), IRES (SEQ ID NO.43), kozak (SEQ ID NO.44, GCCACC), EGFP (SEQ ID NO.45), Spacer 2 (SEQ ID NO.46), component 2-3' end (SEQ ID NO.3), and the fourth matching sequence (SEQ ID NO.47) connected in sequence. The vector structure and working principle diagram are shown in the figure below. Figure 2 .

[0096] Specific steps:

[0097] 1. For plasmid extraction, refer to the instructions of Tiangen Plasmid Extraction Kit.

[0098] 2. Plasmid linearization can be performed using a single restriction site reserved in the plasmid DNA. Please refer to the instructions for Takara restriction endonuclease.

[0099] 3. Linearized plasmid purification:

[0100] 1) Add water to 500 μL of the digested product, add an equal volume of organic solvent (phenol / chloroform / isoamyl alcohol 25:24:1), mix well, and centrifuge at 4°C, 12,000 rpm for 15 min.

[0101] 2) After centrifugation, transfer the DNA in the upper aqueous phase to a new EP tube, aspirate about 400 μL. Add an equal volume of chloroform, a total of 800 μL, vortex to mix. Centrifuge at 4°C, 12,000 rpm for 15 minutes.

[0102] 3) Take 300 μL of the supernatant and put it into a new centrifuge tube, add 30 μL of 3M sodium acetate, and then add twice the volume (660 μL) of pre-cooled anhydrous ethanol. Mix well and precipitate at -20℃ for at least 30 minutes.

[0103] 4) Centrifuge at 14000 rpm for 15 min at 4°C to collect the DNA precipitate.

[0104] 5) After removing the supernatant, slowly add 750 μL of ice-cold 70% ethanol to the EP tube, shake gently, and centrifuge at 4°C, 14,000 rpm for 5 minutes to collect the DNA precipitate.

[0105] 6) Repeat step 5);

[0106] 7) Discard the supernatant, invert the centrifuge tube, and air dry. Add 20 μL of RNase-free water to dissolve.

[0107] 4. In vitro transcription:

[0108] 1) Prepare the following system in an EP tube using NEB's in vitro transcription kit:

[0109]

[0110]

[0111] 2) Gently mix and centrifuge to the bottom of the tube. Place the reactants in a PCR instrument and incubate at 37°C for 2 hours.

[0112] 3) Add DNase I (Takara) to degrade the DNA template, prepare the reaction system according to the table below, mix well, and place in a 37°C metal bath for 20-30 minutes.

[0113] Element Quantity (μL) Total RNA 20 10X DNase I Buffer 10 Nuclease free water 60 Recombinant DNAse I 8 RNase inhibitor 2 Total Rection Volume 100

[0114] 4) After the incubation, add 2.5 μL of 0.5 M EDTA to the reaction mixture, mix well, centrifuge, place in an 80°C water bath for 2 min to inactivate DNase I, and then perform RNA column purification to obtain RNA.

[0115] 5. Cyclization reaction:

[0116] Prepare 100 μL of cyclization system: mix the two RNA components in equal molar proportions (total amount is 50-100 μg), and add cyclization buffer (final concentration is 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.5) and GTP (final concentration is 2 mM). Make up the shortfall with RNase-free water.

[0117] The mixture was incubated at 55°C for 15 minutes, and then purified using an RNA column to obtain a reaction product containing circular RNA.

[0118] The electrophoresis analysis results showed that circular RNA ( Figure 3 ), and grayscale analysis showed that the cyclization efficiency could reach over 95%.

[0119] Example 2: Purity analysis of circular RNA

[0120] The cyclization product was separated and purified by high performance liquid chromatography (HPLC). The separation and purification adopted a 150mM phosphate isogradient elution method, and the separation spectrum showed that the cyclization product could be effectively separated ( Figure 4 A).

[0121] collect Figure 4 The corresponding main peak sample in A was analyzed by HPLC for purity. The results showed that the impurities in the cyclization reaction had been basically removed ( Figure 4 B).

[0122] Example 3: Splice site verification

[0123] The collected circular RNA was used for reverse transcription experiments, and the reverse transcription was performed according to the full-strand gold reverse transcription kit. The product obtained by PCR amplification was inserted between EcoR1 and HidIII of the PUC57-kan vector by homologous recombination, and DNA sequencing was performed. The results showed that the circular RNA splicing reaction occurred at the expected position ( Figure 5 ).

[0124] Example 4: Circular RNA Expression Analysis

[0125] After desalting and precipitation, the obtained circular RNA was transformed into 293T cells and cultured for 12 hours to observe the expression of fluorescent protein. The results showed that circular RNA can efficiently express green fluorescent protein ( Figure 6 ).

[0126] The above contents are further detailed descriptions of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as falling within the protection scope of the present invention.

Claims

1. A nucleic acid composition for producing a circular sequence to be cyclized, the nucleic acid composition comprising a first nucleic acid component and a second nucleic acid component; The first nucleic acid component is an RNA having the following structure or a nucleic acid that produces the RNA: a first matching sequence-ribozyme sequence-a second matching sequence; The second nucleic acid component is an RNA having the following structure or a nucleic acid that produces the RNA: a third matching sequence-5' end structure-sequence to be cyclized-3' end structure-fourth matching sequence; The ribozyme sequence is the sequence shown in SEQ ID NO. 1; The 5' end structure is the sequence shown in SEQ ID NO. 2; The 3' end structure is the sequence shown in SEQ ID NO.3; The first matching sequence is the sequence shown in SEQ ID NO.39; The second matching sequence is the sequence shown in SEQ ID NO.40; The third matching sequence is the sequence shown in SEQ ID NO.41; The fourth matching sequence is the sequence shown in SEQ ID NO.

47.

2. The nucleic acid composition according to claim 1, wherein the first matching sequence and the fourth matching sequence are reverse complementary sequences to each other.

3. The nucleic acid composition according to claim 1, wherein the second matching sequence and the third matching sequence are reverse complementary sequences to each other.

4. The nucleic acid composition according to claim 1, wherein the molar ratio of the first nucleic acid component to the second nucleic acid component is 0.01-100.

5. The nucleic acid composition according to claim 4, wherein the molar ratio of the first nucleic acid component to the second nucleic acid component is 0.1-10.

6. The nucleic acid composition according to claim 5, wherein the molar ratio of the first nucleic acid component to the second nucleic acid component is 0.5-2.

7. The nucleic acid composition of claim 1, wherein the first nucleic acid component is used in an amount greater than the second nucleic acid component.

8. A vector or a vector composition for preparing circular RNA, wherein the vector or the vector composition carries the nucleic acid composition according to any one of claims 1 to 7.

9. The vector or vector composition according to claim 8, wherein the first nucleic acid component and the second nucleic acid component are located on different vectors, or the first nucleic acid component and the second nucleic acid component are located on the same vector.

10. The vector or vector composition of claim 8, wherein the first nucleic acid component in the nucleic acid composition is connected to a first promoter, the second nucleic acid component in the nucleic acid composition is connected to a second promoter, and the first promoter and the second promoter are the same or different.

11. The vector or vector composition of claim 10, wherein the first promoter is T7, Sp6, T3, T7lac, araBAD, trp, lac, Ptac, pL, CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1 or U6 promoter.

12. The vector or vector composition of claim 10, wherein the second promoter is T7, Sp6, T3, T7lac, araBAD, trp, lac, Ptac, pL, CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKIIa, GAL1, GAL10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1 or U6 promoter.

13. The vector or vector composition according to claim 11, wherein the first promoter is a T7 promoter.

14. The vector or vector composition according to claim 12, wherein the second promoter is a T7 promoter.

15. A cell comprising the nucleic acid composition according to any one of claims 1 to 7 or the vector or vector composition according to any one of claims 8 to 14.

16. A method for producing circular RNA, the method being selected from any one of the following: 1) mixing the first nucleic acid component and the second nucleic acid component in the nucleic acid composition according to any one of claims 1 to 7, adding a buffer solution, and incubating, 2) causing the vector or vector combination according to any one of claims 8 to 14 to transcribe, or 3) Cultivating the cell according to claim 15.

17. The method according to claim 16, wherein the incubation condition is 37-60°C for 5-60 min.

18. The method according to claim 17, wherein the incubation condition is 55°C for 15 min.

19. The method of claim 16, wherein the buffer solution contains GTP or excess GMP.

20. The method of claim 19, wherein the final concentration of GTP is 2 mM.

21. The method of claim 16, wherein the buffer solution contains magnesium ions.

22. The method of claim 21, wherein the buffer solution contains 10 mM MgCl2.

23. The method of claim 16, wherein the buffer solution comprises 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.

5.

24. The method of claim 16, further comprising the step of purifying the product to increase its purity.

25. A composition comprising one or more of the following: 1) The nucleic acid composition according to any one of claims 1 to 7, 2) The carrier or carrier composition according to any one of claims 8 to 14, or 3) The cell according to claim 15.

26. The composition of claim 25, further comprising an agent that promotes gene transfection.

27. The composition of claim 26, wherein the agent is a lipid, a liposome, calcium phosphate, polyethylene glycol, a cationic polymer or a nanoparticle.

28. The composition of claim 27, wherein the agent is DEAE-dextran.

29. Any of the following for use in preparing circular RNA or increasing the content or expression of target RNA in cells for non-therapeutic purposes; 1) The nucleic acid composition according to any one of claims 1 to 7, 2) The carrier or carrier composition according to any one of claims 8 to 14, or 3) The cell according to claim 15.

Images