A primer set for detecting rice gene PL9 and its application

Abstract

The present application relates to the field of genetic agricultural technology, and specifically to a primer set for detecting rice gene PL9 and its application. The present application provides a primer set of KA_091501 marker, which can be used to detect rice panicle length gene PL9, and can quickly and accurately detect rice panicle length gene PL9; it can also be used to judge rice panicle length, and used in molecular breeding of new rice panicle length varieties. The present application relates to a detection method and detection site of the KA_091501KASP molecular marker, and the polymorphic site is located at Chr9_18658706. There are differences in the amino acids synthesized by different variations of the KA_091501KASP molecular marker detection site. If the genotype of the detection site is G, the amino acid synthesized at position 349 of the PL9 gene is lysine (Lys), and if the detection site is T, the synthesized amino acid is aspartic acid (Asn). The genotype of the long panicle type marked by KA_091501KASP is G, and the genotype of the short panicle type is T.

Description

Technical Field

[0001] The present application relates to the field of gene agricultural technology, and in particular to a primer set for detecting rice gene PL9 and an application thereof. Background Art

[0002] Rice (Oryza Sativa L.) is one of the main food crops. Therefore, rice yield is related to national food security and social stability. The number of effective panicles, number of grains per panicle, fruit set rate and 1000-grain weight of rice are the four factors that determine rice yield. Panicle length is an important trait that affects the number of grains per panicle of rice and is highly correlated with rice yield (Li et al., 2011). Therefore, the discovery of panicle length functional genes and the development of corresponding molecular markers are of great significance for the breeding of new high-yield rice varieties. At present, more than 250 genes or QTLs related to panicle length development have been located.

[0003] The current key research direction is to use molecular marker technology to detect target genes, apply them to the detection of rice panicle length functional genes, and determine the rice panicle length typing. Summary of the invention

[0004] In order to solve the above technical problems existing in the prior art, the present application provides a primer set for detecting rice gene PL9 and its application, which is specifically achieved through the following technical solutions:

[0005] A primer set for detecting rice panicle length gene PL9, the primer set comprises 3 primers, as follows:

[0006] Primer_AlleleFAM:

[0007] GAAGGTGACCAAGTTCATGCTTTTCGCCATTCAAGCCGTGAGGAAT;

[0008] Primer_AlleleHEX:

[0009] GAAGGTCGGAGTCAACGGATTTTTCGCCATTCAAGCCGTGAGGAAG;

[0010] Primer_Common:

[0011] TCGCAGGGGTAGAGCTCGTAGG.

[0012] The Primer_Common is a common primer.

[0013] The Primer_AlleleFAM and Primer_AlleleHEX are specific primers.

[0014] The Primer_AlleleFAM and Primer_AlleleHEX are specific primers.

[0015] The FAM and HEX are fluorescent labeling sequences.

[0016] The primer set can be used to detect the rice panicle length gene PL9.

[0017] The primer set can be used to determine the length of rice panicles.

[0018] Furthermore, the rice panicle length is determined by the difference in amino acids synthesized by different variations in the molecular marker detection site. If the genotype of the detection site is G, it is a long panicle type, and if the genotype of the detection site is T, it is a short panicle type.

[0019] A method for judging the panicle length of rice, using the above primer set to judge the genotype of the molecular marker detection site corresponding to the rice, if the genotype of the detection site is G, it is a long panicle type, if the genotype of the detection site is T, it is a short panicle type.

[0020] The present application provides a detection method and detection site of the KA_091501KASP molecular marker, and the polymorphic site is located at Chr9_18658706.

[0021] There are differences in the amino acids synthesized by different variants in the KA_091501KASP molecular marker detection site. If the genotype of the detection site is G, the amino acid synthesized at position 349 of the PL9 gene is lysine (Lys). If the detection site is T, the synthesized amino acid is aspartic acid (Asn).

[0022] The genotype of the long-ear type marker KA_091501KASP is G, and the genotype of the short-ear type marker is T.

[0023] Compared with the prior art, the technical effects created by this application are embodied in:

[0024] (1) The present application provides a primer set labeled with KA_091501, which can be used to detect the rice panicle length gene PL9, and can quickly and accurately detect the rice panicle length gene PL9.

[0025] (2) The present application provides a primer set marked by KA_091501, which can be used to determine the length of rice panicle and can be used in the molecular breeding of new rice panicle length varieties.

[0026] (3) The present application provides a detection method and detection site of the KA_091501KASP molecular marker, and the polymorphic site is located at Chr9_18658706. The amino acids synthesized by different variants of the KA_091501KASP molecular marker detection site are different. If the genotype of the detection site is G, the amino acid synthesized at position 349 of the PL9 gene is lysine (Lys), and if the detection site is T, the synthesized amino acid is aspartic acid (Asn). The genotype of the long-ear type of the KA_091501KASP marker is G, and the genotype of the short-ear type is T. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the molecular marker typing diagram of KA_091501.

[0028] Figure 2 Variance analysis of ear length of different genotypes of KA_091501 in Guiyang and Hainan.

[0029] Figure 3 This is a genome-wide association analysis of panicle length in 153 japonica rice samples, including (a) an association analysis of panicle length in 153 japonica rice samples in Hainan; (b) an association analysis of panicle length in 153 japonica rice samples in Guiyang.

[0030] Figure 4 Verification of panicle length using the KA_091501 molecular marker in 346 rice accessions in the database. DETAILED DESCRIPTION

[0031] The technical solution of the present application is further limited below in conjunction with specific implementation methods, but the scope of protection required is not limited to the description.

[0032] Example 1

[0033] 1. DNA Extraction

[0034] Take 150 rice leaves as test samples and store them in a -80°C ultra-low temperature freezer. (2) Transfer the frozen samples to a 2 ml centrifuge tube, add small steel balls, freeze them with liquid nitrogen, and grind the leaves into powder using a tissue grinder. (3) Add CTAB extraction solution, incubate at 65°C for 2 hours, then centrifuge at 12,000×g for 10 minutes at 4°C; (4) Take the supernatant and add an equal volume of chloroform, mix thoroughly, and centrifuge at 12,000×g for 10 minutes at 4°C; (5) Take the supernatant and transfer it to a new centrifuge tube, add 2 times the volume of anhydrous ethanol, mix, place at -20°C for 30 minutes, centrifuge at 12,000×g for 10 minutes at 4°C, and discard the supernatant; (6) Add 1 ml of pre-cooled 70% ethanol, centrifuge at 12,000×g for 10 minutes at 4°C, and discard the supernatant (repeat this step twice); (6) Dry at room temperature until the precipitate is colorless and transparent, add sterile ddH2O to dissolve the DNA precipitate, and freeze at -20°C for later use.

[0035] 2DNA dilution

[0036] The DNA concentration and quality of the samples were measured using the BioDrop uLite nucleic acid micro-analyzer, and all samples were diluted to a suitable concentration for the instrument (about 5-10 ng / μl) according to the test results.

[0037] 3. Primer design

[0038] PL9 (LOC_Os09g30980) is located in the interval 18659177–186573850 on chromosome 9. Then, SNP sites in the interval 100 kb upstream and downstream of this interval were mined, and the online primer design website BatchPrimer3 was used.

[0039] 4KASP (competitive allele-specific PCR) typing test

[0040] The reaction system was configured as follows: the total reaction volume was 1.6ul, including 0.8ul DNA and 0.8ul 2x KASP Master mix + Assay. The program was compiled using the IntelliQube SNP gene detection platform, and the 384 array tape, DNA sample plate, and KASP genotyping mixture were placed into the machine in sequence. The machine was operated to execute the program, and the DNA sample dilution and KASP genotyping mixture were automatically dispensed into the 384-well array tape and sealed. The PCR reaction was performed in a water bath, with the first step being 94℃ pre-denaturation for 15min; the second step being 94℃ denaturation for 20s, 61℃~55℃ annealing / extension for 60s, 10 cycles were set, and the temperature of annealing and extension was reduced by 0.6℃ in each cycle; the third step was 94℃ denaturation for 20s, 55℃ annealing and extension for 60s, and 26 cycles.

[0041] 5KA_091501 marker typing results

[0042] like Figure 1 As shown, KA_091501( Figure 1 ) is polymorphic, mainly including two genotypes, G and T, and it is found that different genotypes will cause variations in the encoded amino acids. When the genotype is G, the amino acid synthesized at position 349 is lysine (Lys), and when the genotype is T, the amino acid encoded by this site is aspartic acid (Asn).

[0043] 6SNP molecular marker verification

[0044] 153 rice accessions were planted in Guiyang and Hainan, and the panicle lengths were measured after harvest. The panicle lengths of individuals with different genotypes were then statistically analyzed. The results showed that the panicle lengths of genotype G were significantly greater than those of genotype T in Guiyang and Hainan ( Figure 2 ).

[0045] 7SNP molecular marker verification

[0046] In order to ensure the reliability of the KA_091501 molecular marker in identifying rice panicle length, genome-wide association studies (GWAS) were conducted on the panicle length of 153 japonica rice samples in two ecological environments, Hainan and Beijing. The results showed that panicle length was significantly correlated with the KA_091501 molecular marker under the two environmental conditions of Hainan and Beijing ( Figure 3 ).

[0047] 8SNP molecular marker verification

[0048] To further verify the role of KA_091501 molecular marker in breeding parent selection, we screened 346 rice samples (Table 2) from the database (RiceVar.Map v2.0 (RiceVarMap2 (ncpgr.cn)). The 346 rice samples included different rice subspecies (including indica rice, japonica rice, AUS rice and intermediate types). The grain types of the KA_091501 marker genotypes of these samples were statistically analyzed. The results are as follows: Figure 4 As shown, the ear length of genotype G is larger than that of genotype T.

[0049] Table 1 Typing results of KA_091501 marker and panicle length determination results of 153 japonica rice samples

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056] Table 2 Information of 346 rice samples from RiceVar.Map v2.0 database

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066] Finally, it should be pointed out that the above embodiments are only representative examples of the present application. Obviously, the technical solution of the present application is not limited to the above embodiments, and there may be many variations. All variations that can be directly derived or associated with the contents disclosed in the present application by a person of ordinary skill in the art should be considered as the protection scope of the present application.

Claims

1. A primer set for detecting rice panicle length gene PL9, characterized in that: The primer set consists of 3 primers, as follows: Primer_AlleleFAM: GAAGGTGACCAAGTTCATGCTTTTCGCCATTCAAGCCGTGAGGAAT; Primer_AlleleHEX: GAAGGTCGGAGTCAACGGATTTTTCGCCATTCAAGCCGTGAGGAAG; Primer_Common: TCGCAGGGGTAGAGCTCGTAGG.

2. The primer set according to claim 1, characterized in that The Primer_Common is a common primer.

3. The primer set according to claim 1, characterized in that The Primer_AlleleFAM and Primer_AlleleHEX are specific primers.

4. The primer set according to claim 1, characterized in that The FAM and HEX are fluorescent labeling sequences.

5. Use of the primer set according to claim 1 in detecting the rice panicle length gene PL9.

6. Use of the primer set according to claim 1 in determining the length of rice panicle.

7. The use according to claim 6, characterized in that The rice panicle length is determined by detecting the difference in amino acids synthesized by different mutations in the molecular marker detection site. If the genotype of the detection site is G, it is a long panicle type, and if the genotype of the detection site is T, it is a short panicle type.

8. A method for determining the length of a rice ear, characterized in that: The primer set described in claim 1 is used to judge the genotype of the molecular marker detection site corresponding to rice. If the genotype of the detection site is G, it is a long panicle type, and if the genotype of the detection site is T, it is a short panicle type.

Images