Construction method and application of recombinant plant lactobacillus plantarum overexpressing bacteriocin synthesis regulatory gene plnc

By constructing a recombinant Lactobacillus plantarum that overexpresses the bacteriocin synthesis regulatory gene plnC, the problems of low bacteriocin yield and high production cost were solved, and the antibacterial activity of bacteriocin and gene expression were significantly improved, laying the foundation for efficient production.

CN118345096BActive Publication Date: 2026-04-14NINGBO UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410532995.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-30
Publication Date
2026-04-14
Estimated Expiration
2044-04-30

AI Technical Summary

Technical Problem

Existing technologies suffer from low bacteriocin yields, complex separation and purification steps, high production costs, and a lack of methods and applications for overexpressing the bacteriocin synthesis regulatory gene plnC and its recombinant Lactobacillus plantarum.

Method used

A recombinant Lactobacillus plantarum overexpressing the bacteriocin synthesis regulatory gene plnC was constructed. PCR amplification was performed using designed specific primers, and the amplified gene was ligated into the linear vector pMG36e. The amplified gene was then transformed into competent cells, and the overexpressing strain B1-plnC was obtained by electroporation, resulting in a significant increase in both plnC gene and protein expression.

Benefits of technology

It significantly improved the antibacterial activity of bacteriocins and the expression level of genes within the pln gene cluster, with the expression level of the plnC gene increasing by more than 4.5 times and the content of plnC protein increasing by more than 1.5 times, thus promoting the efficient production of plant lactobacillus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118345096B_ABST
    Figure CN118345096B_ABST
Patent Text Reader

Abstract

The application discloses a bacteriocin synthesis regulation gene plnC overexpression and a construction method and application of a recombinant plant lactis bacillus, and has the characteristics that the nucleotide sequence is shown in SEQ ID No:1 in the sequence table, and the construction method steps are as follows: 1) taking the plant lactis bacillus genomic DNA as a template, designing specific primers and performing PCR amplification; 2) purifying and double enzyme cutting the plnC gene fragment, and connecting the linear carrier pMG36e which is also double enzyme cut to obtain a pMG36e-plnC recombination cloning carrier; (3) through an electric transformation method, the pMG36e-plnC is transferred into plant lactis bacillus B1 competent cells to obtain a plnC overexpression strain B1-plnC, and the advantages are that the synthesis of the plant lactis bacillins is promoted, the plnC gene expression amount of the overexpression strain B1-plnC is increased by more than 4.5 times, and the PlnC protein content is increased by more than 1.5 times.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering and microbial fermentation technology, and in particular relates to a method for constructing and applying an overexpression of the bacteriocin synthesis regulatory gene plnC and its recombinant Lactobacillus plantarum. Background Technology

[0002] Bacteriocins are a class of proteins or polypeptides synthesized by ribosomes and possessing antibacterial activity. Lactic acid bacteria bacteriocins, in particular, are widely used in food processing and storage, and in the biopharmaceutical field due to their safety profile. However, traditional methods for producing bacteriocins by screening wild-type strains suffer from low yields, complex isolation and purification procedures, and high production costs. Therefore, utilizing bioinformatics tools to design primers, amplify, clone, and express bacteriocin synthesis genes, and establishing highly stable recombinant bacteriocin expression systems, has become a new approach for bacteriocin production. The universal expression plasmid pMG36e for *Lactococcus lactis* is a classic artificially constructed constitutive expression vector widely used to study the mechanisms of bacteriocin action and has become one of the important tools in lactic acid bacteria genetic engineering research.

[0003] Plantaricin is a class IIa / IIb bacteriocin produced by *Lactiplantibacillus plantarum*, and is one of its main antibacterial substances. Plantaricin is regulated by quorum sensing (QS), a regulatory system controlled by operons on the gene cluster (pln) that controls plantaricin synthesis in *Lactiplantibacillus plantarum*. The plantaricin gene cluster is approximately 18–29 kb in length and consists of five operons: plnABCD, plnEFI, plnJKLR, plnGHSTUVW, and plnMNOP. plnABCD encodes the QS regulatory system; this operon can activate both its own transcription and the transcription of the other four operons. plnA encodes the autoinducible peptide (AIP), plnB encodes a histidine protein kinase, and plnC and plnD encode two highly homologous response regulatory proteins, PlnC and PlnD. PlnC promotes the expression of the target protein, while PlnD inhibits its expression. plnEFI and plnJKLR encode two dipeptide bacteriocins (PlnEF and PlnJK) and their respective bacteriocin immunoglobulins (PlnI, PlnL, and PlnR). plnGH in plnGHSTUVW encodes ABC transporters and accessory proteins involved in bacteriocin transport, secretion, and processing, enabling the secretion of bacteriocins with diglycine leader sequences extracellularly. The protein encoded by plnSTUVW belongs to the CAAX aminoprotease family. plnMNOP encodes four hypothetical proteins. Therefore, exploring the regulatory mechanism of the pln gene cluster in the metabolism and synthesis of bacteriocins in *Lactobacillus plantarum* is of great significance for improving the bacteriocin production capacity of *Lactobacillus plantarum* and provides strong support for understanding the synthesis mechanism of bacteriocins and enhancing their applicability. Currently, there are no publicly available research reports, either domestically or internationally, on the construction methods and applications of the overexpression of the bacteriocin synthesis regulatory gene plnC and its recombinant Lactobacillus plantarum. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide an overexpression of the bacteriocin synthesis regulatory gene plnC that promotes the synthesis of plant lactobacillus and its construction method and application. The expression level of plnC gene in the overexpression strain B1-plnC is significantly increased by more than 4.5 times and the plnC protein content is significantly increased by more than 1.5 times.

[0005] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows: an overexpression of the bacteriocin synthesis regulatory gene plnC, wherein the gene is derived from the gene of Lactiplantibacillus plantarum encoding the response regulatory protein PlnC, and its nucleotide sequence is shown in SEQ ID No:1 in the sequence listing.

[0006] The Lactiplantibacillus plantarum was deposited on January 8, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 29542.

[0007] The specific steps for constructing the recombinant Lactobacillus plantarum overexpressing the bacteriocin synthesis regulatory gene plnC are as follows:

[0008] (1) Using Lactobacillus plantarum genomic DNA as a template, specific primers were designed and PCR amplification was performed;

[0009] (2) After purifying the plnC gene fragment obtained by step (1), it is ligated with the linear vector pMG36e digested by Pst I and HindIII using homologous recombination technology. The ligation product is transformed into Trans1-T1 competent cells for replication. Positive clones are verified by double enzyme digestion and identified by colony PCR to obtain the pMG36e-plnC recombinant cloning vector.

[0010] (3) The pMG36e-plnC recombinant cloning vector was transferred into B1 competent cells of *Lactobacillus plantarum* by electroporation and replicated. Positive clones were identified by colony PCR to obtain recombinant *Lactobacillus plantarum* with the regulatory gene plnC.

[0011] Furthermore, the sequences of the PCR-specific primers described in step (1) are as follows: plnC upstream amplification primer TCCTCTAGAGTCGAC CTGCAG GTGTTTCCAATTTATTTATTAGAAGATAACG; plnC downstream amplification primers: GTTTTCAGACTTTGC AAGCTT CTATTTCTTTTTCAATATTTTGTTAAGCT. The sequence in the italics of the primer is the homologous sequence at both ends of the restriction site on pMG36e, and the underlined part is the restriction site.

[0012] Further, the PCR amplification procedure described in step (1) is as follows: (1) Pre-denaturation at 95℃ for 3 min; (2) Denaturation at 95℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 60 s, for 35 cycles; (3) Complete extension at 72℃ for 5 min; The PCR reaction system is: 2 μL template DNA, 25 μL 2×Phanta Max Master Mix, 2 μL forward primer, 2 μL reverse primer, and ddH2O to make up to 50 μL.

[0013] Furthermore, the plnC gene fragment mentioned in step (2) is mixed with the linear vector pMG36e at a molar ratio of 3:1, and the ligation conditions are 37℃ for 30 min, and then placed at 4℃ for 10 min.

[0014] Further, the preparation of competent Lactobacillus plantarum cells described in step (3) is as follows: 2 mL of activated Lactobacillus plantarum is inoculated into 100 mL of MRS broth containing 0.5 wt% glucose and 0.5 wt% glycine, cultured to the exponential phase, and the cells are collected by low-speed centrifugation at 3000 rpm for 10 min. The cells are then washed with pre-cooled sterile water and a mixture containing 10 wt% glycerol and 10 wt% sucrose, respectively. Finally, the cells are resuspended in a mixture equal in volume to obtain competent Lactobacillus plantarum cells.

[0015] Furthermore, the sequences of the recombinant Lactobacillus plantarum verification primers for the regulatory gene plnC mentioned in step (3) are: 36e-CF: GCTCGACATACTGTTCTTCCC, 36e-CR: GCAGTCAGCCTAATACTACCC.

[0016] The above-mentioned recombinant Lactobacillus plantarum overexpressing the bacteriocin synthesis regulatory gene plnC is used in the preparation of promoters for Lactobacillus plantarum synthesis.

[0017] Compared with existing technologies, the advantages of this invention are as follows: This invention discloses for the first time the construction method and application of the overexpression of the bacteriocin synthesis regulatory gene plnC and its recombinant *Lactiplantibacillus plantarum*. The PlnC protein encoded by plnC can positively regulate the expression of genes related to class IIb bacteriocin synthesis, playing an important role in promoting the synthesis of plant lactic acid. The plnC gene fragment of *Lactiplantibacillus plantarum* was cloned and ligated into the pMG36e expression vector, then electroporated into *Lactiplantibacillus plantarum* producing broad-spectrum antibacterial bacteriocins. Recombinant bacteria carrying the target gene, namely recombinant *Lactiplantibacillus plantarum* B1-plnC overexpressing the bacteriocin synthesis regulatory gene (plnC), were obtained through erythromycin resistance screening and identification. The expression level of the plnC gene in the overexpressing strain B1-plnC increased significantly by more than 4.5 times, and the PlnC protein content increased significantly by more than 1.5 times, demonstrating that plnC is overexpressed at both the gene and protein levels. Compared to wild-type *Lactobacillus plantarum* B1, B1-0 and B1-plnC cells were shorter and wider. The antibacterial activity of bacteriocins was also significantly increased. Overexpression of plnC significantly enhanced the expression of different gene fragments (plnABCD, plnEFI, plnJKLR, plnGHSTUVW, plnMNOP) within the pln gene cluster in *Lactobacillus plantarum* to varying degrees. This invention is the first to construct a recombinant *Lactobacillus plantarum* B1-plnC strain capable of overexpressing the bacteriocin synthesis regulatory gene (plnC), laying the foundation and providing technical support for the efficient production of bacteriocins from *Lactobacillus plantarum*.

[0018] The above-mentioned Lactiplantibacillus plantarum, with accession number CGMCC No. 29542, accession date: January 8, 2024, depositary institution: China General Microbiological Culture Collection Center, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0019] Figure 1 The results of agarose gel electrophoresis were obtained for the PCR products of the overexpression of the bacteriocin synthesis regulatory gene (plnC). Lane 1 is the product after gene plnC amplification.

[0020] Figure 2 The results of agarose gel electrophoresis were obtained for the linear plasmid pMG36e.

[0021] Figure 3 Procedure for constructing the pMG36e-plnC map of recombinant plasmid;

[0022] Figure 4The results of electrophoresis of colony PCR products of T1-pMG36e-plnC positive clones are shown. Lane (1-48) are colony PCR products of T1-pMG36e-plnC positive clones selected with erythromycin.

[0023] Figure 5 The results of double digestion of recombinant plasmid pMG36e-plnC are shown. Lane(1,3) is the undigested plasmid pMG36e-plnC, and Lane(2,4) is the double digestion product of pMG36e-plnC.

[0024] Figure 6 To verify the results of electroporation PCR, (a) is an electrophoresis image of the PCR product of pMG36e electroporated into Bacillus plantarum B1; (b) is an electrophoresis image of the PCR product of pMG36e-plnC electroporated into Bacillus plantarum B1.

[0025] Figure 7 The growth of B1, B1-0 and B1-plnC on erythromycin MRS plates;

[0026] Figure 8 The results of qPCR relative quantification of plnC;

[0027] Figure 9 The results of SDS-PAGE validation of intracellular PlnC in B1-0 and B1-plnC cells are shown. Lanes (1, 2) and (5, 6) are the supernatant of B1-0 cell lysis, and Lanes (3, 4) and (7, 8) are the supernatant of B1-plnC cell lysis. The positions marked by the red boxes are the target bands.

[0028] Figure 10 Cell morphology under a scanning electron microscope: (a) wild-type *Lactobacillus plantarum* B1; (b) *Lactobacillus plantarum* B1-0; (c) *Lactobacillus plantarum* B1-plnC.

[0029] Figure 11 The graph shows the changes in bacteriocin antibacterial activity. (a) Bar graph showing the changes in antibacterial activity of B1-0 and B1-plnC; (b) Bar graph showing the changes in antibacterial activity of B1-0 (+PlnA) and B1-plnC (+PlnA). Groups 1, 2, 3, 4, and 5 represent samples fermented for 4, 8, 12, 16, and 24 hours, respectively.

[0030] Figure 12 The graph shows the relative expression levels of regions related to the pln gene clusters. Each column represents the relative expression level of each functional region of the pln gene cluster in B1-plnC, calculated with B1-0 as the control group. The red dashed line represents the calculated control group with a fixed value of 1. A relative expression level greater than 1 indicates gene upregulation, while a value less than 1 indicates downregulation. Detailed Implementation

[0031] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0032] Example 1

[0033] Construction of recombinant expression vector pMG36e-plnC

[0034] 1. Based on the *Lactobacillus plantarum* pln gene cluster sequence (GenBank: X94434.2) in the NCBI database, plnC amplification primers (plnC-F and plnC-R) were designed to amplify the overexpressed bacteriocinogen synthesis regulatory gene plnC fragment. The PCR primer sequences are shown below: plnC upstream amplification primer TCCTCTAGAGTCGAC CTGCAG GTGTTTCCAATTTATTTATTAGAAGATAACG; plnC downstream amplification primers: GTTTTCAGACTTTGC AAGCTT CTATTTCTTTTTCAATATTTTGTTAAGCT (The underlined part is the enzyme cleavage site).

[0035] 2. Using *Lactobacillus plantarum* B1 genomic DNA as a template, the following PCR procedure was performed: (1) pre-denaturation (95℃, 3 min); (2) denaturation (95℃, 15 s), annealing (60℃, 15 s), extension (72℃, 60 s), 35 cycles; (3) complete extension (72℃, 5 min). The PCR reaction system was as follows: 2 μL template DNA, 25 μL 2×Phanta Max Master Mix, 2 μL 20 mM plnC upstream amplification primer, 2 μL 20 mM downstream amplification primer, and ddH2O to a final volume of 50 μL. After further verification by PCR, sequencing was performed, and the plnC gene sequence was obtained as shown in SEQ ID No:1.

[0036] Figure 1 The results of agarose gel electrophoresis of the target gene PCR products are shown. Lane 1 is the product of gene plnC amplification. Figure 1 The position of the electrophoretic bands shows that the molecular weight of the product is basically consistent with the length of the gene.

[0037] 3. Construction of the recombinant expression vector pMG36e-plnC

[0038] (1) The amplified gene fragment was purified using a PCR product purification kit to obtain specific amplified bands, and the target fragment plnC was obtained by gel extraction. The plasmid pMG36e DNA was extracted using a plasmid DNA mini extraction kit, digested with Pst I and HindIII, and then subjected to agarose gel electrophoresis and gel extraction to obtain the linear vector pMG36e.

[0039] (2) Using seamless cloning (homologous recombination) technology, the target fragment (plnC) was ligated to the linear vector (pMG36e) so that the plnC target gene was inserted between the two restriction sites of pMG36e. The ligation was carried out at 37℃ for 30 min, 4℃ for 10 min, and then the ligation product was transformed into Trans1-T1 competent cells for replication. The transformed and revived bacterial culture was plated on LB plates containing erythromycin and cultured at 37℃ for 24 h. Transformants were screened and verified by double restriction enzyme digestion, PCR, and sequencing to obtain the pMG36e-plnC recombinant cloning vector.

[0040] Figure 2 The results of agarose gel electrophoresis were performed on the linear plasmid pMG36e. The bands of the Lane1 restriction plasmid were located between Marker 5000 and 3000, and the band positions were consistent and singular, indicating that the plasmid was completely digested. Figure 3 Procedure for constructing the pMG36e-plnC map of recombinant plasmid;

[0041] Figure 4 The images show the electrophoresis results of colony PCR products from T1-pMG36e-plnC positive clones. Lane (1-48) represents the colony PCR products from T1-pMG36e-plnC positive clones selected with erythromycin. The colony PCR products are single, with a size of approximately 1000 bp, and the submitted results match the recombinant plasmid sequence.

[0042] Figure 5 The results of double enzyme digestion of the recombinant plasmid pMG36e-plnC are shown. Lanes (1, 3) represent the undigested pMG36e-plnC plasmid, and Lanes (2, 4) represent the double-digested products of pMG36e-plnC. The results show linear plasmid bands and the target gene band. This indicates that the recombinant plasmid pMG36e-plnC was successfully constructed.

[0043] Example 2

[0044] DNA was extracted from plasmid pMG36e and pMG36e-plnC prepared in Example 1 using a plasmid DNA mini-extraction kit. The two plasmids, pMG36e and pMG36e-plnC, were transformed into competent *Lactobacillus plantarum* cells via electroporation, and the resulting strains were named B1-0 and B1-plnC, respectively. The transformed and revived bacterial cultures were plated on MRS plates containing erythromycin and incubated at 37°C for 24 h. Transformants were screened, and their verification was performed by PCR and sequencing to obtain the plnC overexpressing strain B1-plnC. The sequences of the verification primers for strains B1-0 and B1-plnC were as follows: 36eF: AGCAAACCCGTATTCCAC, 36eR: GCCACCTTCGTTTTCAGACT; 36e-CF: GCTCGACATACTGTTCTTCCC, 36e-CR: GCAGTCAGCCTAATACTACCC.

[0045] The specific steps for preparing competent Lactiplantibacillus plantarum cells are as follows: 2 mL of activated Lactiplantibacillus plantarum was inoculated into 100 mL of MRS broth containing 0.5 wt% glucose and 0.5 wt% glycine. The cells were cultured to the exponential phase, and the cells were collected by low-speed centrifugation at 3000 rpm for 10 min. The cells were then washed with pre-cooled sterile water and solution A (10% glycerol + 10% sucrose, with ultrapure water as the solvent). Finally, the cells were resuspended in an equal volume of solution A to prepare competent Lactiplantibacillus plantarum B1 cells. The bacterial suspension was aliquoted into sterile PCR tubes, flash-frozen in liquid nitrogen, and stored at -80℃.

[0046] The specific steps for electroporation are as follows: Add recombinant expression plasmid pMG36e-plnC (≤1 μg) to 100 μL of *Lactobacillus plantarum* competent cells and gently fuse. Incubate on ice for 5 min. Transfer the mixture to a pre-chilled electroporation cuvette, wipe the surface of the metal plate dry, and electroporate at 1.3 kV, 4 ms pulses. After electroporation, incubate on ice for 2 min, then quickly transfer the bacterial culture to 1 mL of pre-chilled MRS broth and incubate at 37°C for 2-3 h. Spread 100 μL of the transformed competent cells onto erythromycin MRS plates.

[0047] Figure 6To verify the results of electroporation PCR, (a) is the electrophoresis image of the PCR product of *Lactobacillus plantarum* electroporated with pMG36e. The verification primers 36e-F / R for pMG36e are located at both ends of the cloning site. The product length is 961 bp, and the position of the electrophoresis band is consistent with the theoretical product size. (b) is the electrophoresis image of the PCR product of *Lactobacillus plantarum* B1 electroporated with pMG36e-plnC. The primers 36e-CF / R designed for pMG36e-plnC have the upstream primer located on the plasmid and the downstream primer located on the inserted target gene. The product length is 1887 bp, and the position of the electrophoresis band is consistent with the theoretical product size.

[0048] Figure 7 The growth of B1, B1-0, and B1-plnC on erythromycin MRS plates is shown. Both the control strain B1-0 and the recombinant strain B1-plnC grew normally under erythromycin conditions. This indicates that strains B1-0 and B1-plnC were successfully constructed.

[0049] Example 3

[0050] Validation at the gene level

[0051] RNA was extracted from the overexpression strain B1-plnC obtained in Example 2, and cDNA was obtained by reverse transcription. qPCR primers for plnC were designed: plnC-qF: 5'-GTGGCGACAGGAGATTTACAAG-3'; plnC-qR: 5'-GTTCCCCAATTTCCATATCCAAG-3', with 16S rRNA as an internal reference gene (16S-F: CACCGCTACACATGGAG; 16S-R: AGCAGGGAATCTTCCA). A three-step qPCR method was used, with the reaction system being: cDNA (10 pg) -1 μg, upstream primer 0.4μL, downstream primer 0.4μL, 10 μL of Tip Green qPCR SuperMix was added to a final volume of 20 μL with Nuclease-free Water. The amplification program was set as follows: (1) pre-denaturation (94℃, 30 s); (2) denaturation (94℃, 5 s), annealing (60℃, 15 s), extension (72℃, 10 s), 45 cycles; (3) cooling (37℃, 10 min). A dilution gradient (0, 1 ... -1 10 -2 10 -3 The standard curve of ) and Ct value is used to calculate the amplification efficiency and relative expression level according to the following formula: e = (10 -1 / k -1)×100%, relative expression level = (1+e) -ΔΔCtWhere e: amplification efficiency, %; Ct value is the number of cycles corresponding to the amplification of the initial template to the set baseline position in qPCR; k: slope of the standard curve of template dilution gradient and Ct value.

[0052] Figure 8 The results of qPCR relative quantification of plnC are shown. B1-0 was used as the control strain, and its relative expression level was always 1. The results show that compared with B1-0, the expression level of plnC in the overexpressing strain B1-plnC increased significantly by more than 4.5 times, which proves that plnC is overexpressed at the gene level.

[0053] Example 4

[0054] Protein level verification

[0055] After activation, strains B1-0 and B1-plnC obtained in Example 2 were inoculated into 100 mL LMR broth and cultured overnight. After culture, the bacterial suspensions were adjusted to the same OD600 (approximately 0.6). 50 mL of each bacterial suspension was centrifuged, the supernatant was discarded, and the cells were washed three times with sterile PBS solution (pH = 7.2-7.4). The cells were then resuspended in 2 mL of pre-chilled sterile 0.1 M PBS solution. 500 μL of the bacterial suspension was aliquoted into 2 mL sterile sample tubes, and 2 g of pre-chilled zirconia beads were added to each tube. The tubes were then placed in a biosample homogenizer for homogenization. The homogenization parameters were: oscillation speed 6 m / s, run time 60 s, pause time 30 s, 30 cycles, total working time 45 min. After centrifugation, the supernatant was transferred to a new pre-chilled 2 mL centrifuge tube, and the protein supernatant was collected by centrifugation again. The protein concentration was determined using a BCA protein concentration assay kit. Equal amounts (50-100 μg) of protein from B1-0 and B1-plnC cell lysates were mixed with 1 / 4 volume of protein loading buffer in centrifuge tubes. The mixture was heated in a boiling water bath for 5 min, then inverted and briefly centrifuged. 20 μL of the loading solution was then subjected to SDS-PAGE. The molecular weight of the expressed protein was calculated to be 28.66 kDa based on the plnC sequence. The differences in plnC protein expression levels between the two bacteria at different growth stages were compared using SDS-PAGE.

[0056] Figure 9The SDS-PAGE results for intracellular PlnC in B1-0 and B1-plnC cells are shown. Lanes (1, 2) and (5, 6) are the supernatant from B1-0 cell lysis; Lanes (3, 4) and (7, 8) are the supernatant from B1-plnC cell lysis. The target bands are marked in red. The bands shown in the figure exhibit differences, and their positions and sizes correspond to the theoretical molecular weight of the target proteins. The normalization ratio of the B1-plnC target band is significantly higher than that of B1-0 by more than 1.5 times, indicating that PlnC is overexpressed at the protein level in B1-plnC.

[0057] Example 5

[0058] Scanning electron microscopy observation of morphological changes of B1-0 and B1-plnC

[0059] After overnight culture of strains B1-0 and B1-plnC obtained in Example 2 in MRS broth, bacterial cells (OD600 approximately 1) of each strain were collected and washed three times with 0.1M PBS (pH = 7.0). After each wash, the cells were centrifuged (4°C, 6000 rpm, 5 min). The resulting bacterial cells were resuspended in 2.5% glutaraldehyde and fixed at 4°C for 3 h. Then, the cells were washed three times with 0.1M PBS. The cells were then subjected to a gradient elution with ethanol, dehydrating for 15 min each time and centrifuged. The cells were then replaced sequentially with 25%, 50%, 75%, and 100% (v / v) tert-butanol prepared with anhydrous ethanol for 10 min each time. Finally, the cells were centrifuged, resuspended in 1 mL of 100% tert-butanol, and frozen at -80°C for vacuum freeze-drying. After freeze-drying, the sample was attached to a stage with conductive adhesive, and then placed in an ion sputtering instrument for gold sputtering for 60-120 seconds. Finally, the stage with the sample was placed in a scanning electron microscope to observe cell morphology.

[0060] Figure 10 Cell morphology under a scanning electron microscope: (a) wild-type *Lactobacillus plantarum* B1; (b) *Lactobacillus plantarum* B1-0; (c) *Lactobacillus plantarum* B1-plnC. Compared with wild-type *Lactobacillus plantarum* B1, both B1-0 and B1-plnC showed changes in cell length and diameter, which may be caused by transformation with exogenous plasmids. There was no significant difference in cell morphology between B1-0 and B1-plnC, indicating that overexpression of plnC does not alter cell morphological characteristics.

[0061] Example 6

[0062] Determination of bacteriocin activity

[0063] The strains B1-0 and B1-plnC obtained in Example 2 were used to activate single colonies with isoOD values. 6002 mL of seed culture was inoculated into 100 mL of MRS broth and incubated at 37°C for 4, 8, 12, 16, and 24 h. The fermentation supernatant at each time point was filtered through a sterile 0.22 μm filter to remove bacteria and impurities, then freeze-dried and reconstituted with sterile water to a concentration of 10-fold. The pH was adjusted to 6.5-7.0 with 5 M NaOH solution, and then filtered through a sterile 0.2 μm filter to remove bacteria and impurities. Then, sterile catalase solution was added to the supernatant to a concentration of 1 mg / mL, and the mixture was incubated at 37°C for 2 h. Inhibition plates were prepared by placing sterile Oxford cups on them. 200 μL of the supernatant (deacidified and dehydrogenase-removed) was added to each Oxford cup, and the plates were incubated at 37°C for 24 h. The diameter of the inhibition zone was then measured. A control group was prepared by adding MRS broth with a pH adjusted to 6.5-7.0. The synthesis of plant lactobacillusin may be concentrated during the logarithmic growth phase of cells. However, early studies found that bacteriocin production was low or even undetectable under liquid culture of lactic acid bacteria. This was attributed to the easy diffusion of self-induced peptides in liquid, making it difficult to reach the cellular histidine kinase recognition threshold. Two mL of activated seed culture from single colonies of B1-0 and B1-plnC were inoculated into 100 mL of MRS broth containing 500 ng / mL inducible peptide PlnA. The antibacterial activity was measured after incubation at 37°C for 4, 8, 12, 16, and 24 hours.

[0064] Figure 11 The graphs show the changes in bacteriocin antibacterial activity: (a) bar graphs showing the changes in antibacterial activity of B1-0 and B1-plnC; (b) bar graphs showing the changes in antibacterial activity of B1-0(+PlnA) and B1-plnC(+PlnA). Groups 1, 2, 3, 4, and 5 represent samples fermented for 4, 8, 12, 16, and 24 hours, respectively. Before 12 hours of fermentation, the bacteriocin antibacterial activity of both B1-0 and B1-plnC remained at a high level. After 12 hours of fermentation, the bacteriocin antibacterial activity of B1-plnC was significantly higher than that of B1-0. After the exogenous addition of the bacteriocin-inducible peptide PlnA, it was found that the bacteriocin antibacterial activity of B1-plnC was consistently significantly higher than that of B1-0, and the overexpression of plnC was the only factor that made the bacteriocin antibacterial activity of B1-plnC significantly higher than that of B1-0. During fermentation for 16-24 hours, the bacteriostatic activity of both B1-0 and B1-plnC remained at a certain level, and bacteriocin synthesis reached a steady state.

[0065] Example 7

[0066] qPCR validation of pln gene cluster genes

[0067] The strains B1-0 and B1-plnC obtained in Example 2 were cultured at 37°C for 16 hours to the exponential phase under PlnA induction (500 ng / mL). 2 mL of each bacterial culture was taken and total RNA was extracted according to the kit instructions. cDNA products were obtained by reverse transcription. qPCR was performed using a three-step method, with the reaction system and amplification conditions the same as in Example 3. In addition to verifying whether plnC was overexpressed, it was also necessary to investigate the regulatory role of plnC on other functional regions of the pln gene cluster. Therefore, primers for five different functional regions (each region has a corresponding promoter controlling transcriptional expression) were designed (as shown in Table 1).

[0068] Table 1 qPCR primers

[0069]

[0070] Figure 12 The graph shows the relative expression levels of relevant regions within the pln gene cluster. Each column represents the relative expression level of each functional region of the pln gene cluster in B1-plnC, calculated with B1-0 as the control group. The red dashed line represents the fixed control value of 1. A relative expression level greater than 1 indicates gene upregulation, while a level less than 1 indicates downregulation. The effect of plnC overexpression on the expression of this gene cluster was detected by calculating the relative expression levels of relevant functional regions within the pln gene cluster using qPCR. This confirms that plnC, expressed by plnC, is a response regulatory protein in *Lactobacillus plantarum* that activates the expression of bacteriocin-related genes; that is, overexpression of plnC significantly increases the expression of gene fragments in different regions within the pln gene cluster in *Lactobacillus plantarum* to varying degrees.

[0071] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.

Claims

1. A recombinant Lactobacillus plantarum ( Lactiplantibacillus plantarum strain B1-plnC, characterized by: This strain overexpresses the bacteriocin synthesis regulatory gene plnC, which is derived from *Lactobacillus plantarum*. Lactiplantibacillus plantarum The gene encoding the response regulatory protein PlnC, the nucleotide sequence of which is shown in SEQ ID No:1, is from *Lactobacillus plantarum* (…). Lactiplantibacillus plantarum The accession number of the object is CGMCCNo.29542.

2. A recombinant Lactobacillus plantarum as described in claim 1 ( Lactiplantibacillus plantarum The method for constructing strain B1-plnC is characterized by... The specific steps are as follows: (1) Using the genomic DNA of *Lactobacillus plantarum* with accession number CGMCC No. 29542 as a template, specific primers were designed and PCR amplification was performed; (2) Amplify the product obtained in step (1) plnC After purification, the gene fragments were combined with... Pst I and Hind The linear vector pMG36e, digested with enzymes III, was ligated using homologous recombination. The ligation product was transformed into Trans1-T1 competent cells for replication. Positive clones were verified by double enzyme digestion and identified by colony PCR, thus obtaining pMG36e- plnC Recombinant cloning vector; (3) pMG36e- plnC The recombinant cloning vector was transformed into competent *Lactobacillus plantarum* cells via electroporation and replicated. Positive clones were identified by colony PCR to obtain the regulatory genes. plnC Recombinant Lactobacillus plantarum.

3. The overexpression of the bacteriocin synthesis regulatory gene according to claim 2 plnC The method for constructing recombinant Lactobacillus plantarum, characterized in that... The sequences of the PCR-specific primers described in step (1) are as follows: plnC Upstream amplification primer TCCTCTAGAGTCGAC CTGCAG GTGTTTTCCAATTTATTTATTAGAAGATAACG; plnC Downstream amplification primers: GTTTTCAGACTTTGC AAGCTT CTATTTCTTTTTCAATATTTTGTTAAGCT.

4. The recombinant Lactobacillus plantarum according to claim 3 ( Lactiplantibacillus plantarum The method for constructing strain B1-plnC is characterized by... The PCR amplification procedure described in step (1) is as follows: (1) Pre-denaturation at 95℃ for 3 min; (2) Denaturation at 95℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 60 s, for 35 cycles; (3) Complete extension at 72℃ for 5 min; The PCR reaction system is: template DNA 2 µL, 2×Phanta Max Master Mix 25 µL, forward primer 2 µL, reverse primer 2 µL, and ddH2O to make up to 50 µL.

5. The recombinant Lactobacillus plantarum according to claim 2 ( Lactiplantibacillus plantarum The method for constructing strain B1-plnC is characterized by... The steps described in step (2) plnC The gene fragment was mixed with the linear vector pMG36e at a molar ratio of 3:1, and the ligation conditions were 37℃ for 30 min, followed by 4℃ for 10 min.

6. The recombinant Lactobacillus plantarum according to claim 2 ( Lactiplantibacillus plantarum The method for constructing strain B1-plnC is characterized by... The preparation of competent Lactobacillus plantarum cells described in step (3) is as follows: 2 mL of activated Lactobacillus plantarum cells with preservation number CGMCC No.29542 are inoculated into 100 mL of MRS broth containing 0.5 wt% glucose and 0.5 wt% glycine. The cells are cultured to the exponential phase, and the cells are collected by low-speed centrifugation at 3000 rpm for 10 min. The cells are then washed with pre-cooled sterile water and a mixture containing 10 wt% glycerol and 10 wt% sucrose, respectively. Finally, the cells are resuspended in a mixture equal in volume to obtain competent Lactobacillus plantarum cells.

7. The recombinant Lactobacillus plantarum according to claim 2 ( Lactiplantibacillus plantarum The method for constructing strain B1-plnC is characterized by... The regulatory genes described in step (3) plnC The sequences of the recombinant Lactobacillus plantarum verification primers are: 36e-CF: GCTCGACATACTGTTCTTCCC, 36e-CR: GCAGTCAGCCTAATACTACCC.

8. A recombinant Lactobacillus plantarum as described in claim 1 ( Lactiplantibacillus plantarum Application of strain B1-plnC in the preparation of bacteriocins from Lactobacillus plantarum.