A novel trans-nerolidol synthase, gene and use thereof

Abstract

The present invention discloses a novel trans-nerolidol synthase, gene and use thereof. The present invention discovers for the first time a novel trans-nerolidol synthase that can efficiently and specifically synthesize trans-nerolidol, and can be used as a fragrance in the flavor and fragrance industry. The present invention obtains a recombinant vector and an engineered bacterium by recombining the synthase gene for synthesizing trans-nerolidol, and the shake flask yield can reach 154 mg / L, which lays an important foundation for the application of trans-nerolidol.

Description

Technical Field

[0001] The invention belongs to the field of natural product biotechnology, and specifically relates to a new trans-nerolidol synthase, a gene and use thereof. Background Art

[0002] Trans-nerolidol is an important sesquiterpene compound with the characteristic aroma of orange blossom and is widely used in the flavor and fragrance industry. For example, because it has the aroma of rose and fresh apple, it is suitable for the fragrance of orange blossom, jasmine, narcissus, etc., and has been used to prepare rose-type, lilac-type and other flavors. At the same time, it is stipulated in GB2760-88 as an edible flavoring allowed for use, mainly used to prepare apple, miscellaneous fruit and citrus flavors.

[0003] Trans-nerolidol can also be used as an important pharmaceutical intermediate to synthesize isophytol, and can also be used as a high-grade fragrance in cosmetics, so it has very important economic value.

[0004] At present, there are no reports in the literature on the gene that can synthesize trans-nerolidol in the important economic crop Alpinia oxyphylla under the rubber tree forest and the research on the biosynthesis of trans-nerolidol using the gene.

[0005] The invention clones the trans-nerolidol synthase gene from Alpinia oxyphylla and Hevea brasiliensis for the first time, can be used for efficiently synthesizing trans-nerolidol, and determines the nucleotide sequence and amino acid sequence thereof, fills the blank of the gene for synthesizing trans-nerolidol in Alpinia oxyphylla and Hevea brasiliensis in the prior art, and provides a gene element for the biotechnological synthesis of trans-nerolidol. Summary of the invention

[0006] The object of the present invention is to address the above-mentioned deficiencies in the prior art. The present invention first provides an enzyme, which is the following enzyme a) or b):

[0007] a) an enzyme whose amino acid sequence is SEQ ID No. 2;

[0008] b) An enzyme whose amino acid sequence is SEQ ID No. 4.

[0009] Secondly, the present invention also provides a biological material related to the Alpinia oxyphylla and Hevea brasiliensis trans-nerolidol synthase, which is any one of the following B1) to B8):

[0010] B1) nucleic acid molecules encoding Alpinia oxyphylla and Hevea brasiliensis trans-nerolidol synthase;

[0011] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0012] B3) a recombinant vector containing the nucleic acid molecule described in B1),

[0013] B4) a recombinant vector containing the expression cassette described in B2);

[0014] B5) a recombinant microorganism containing the nucleic acid molecule described in B1);

[0015] B6) a recombinant microorganism containing the expression cassette described in B2);

[0016] B7) a recombinant microorganism containing the recombinant vector described in B3);

[0017] B8) a recombinant microorganism containing the recombinant vector described in B4);

[0018] Optionally, the vector comprises a pESC yeast expression vector and a transgenic plant expression vector;

[0019] Optionally, the recombinant microorganism comprises an engineered bacterium or a plant cell.

[0020] The recombinant vector and the engineering bacteria provided by the invention can be directly cultured, amplified and expressed to obtain Alpinia oxyphylla and Hevea brasiliensis trans-nerolidol synthase, and a large amount of active Hevea brasiliensis trans-nerolidol synthase obtained can be used to produce trans-nerolidol.

[0021] Preferably, the nucleic acid molecule is the nucleic acid molecule shown in 1) or 2) or 3) below:

[0022] 1) The coding sequence is a DNA molecule or cDNA molecule of SEQ ID No. 1 or SEQ ID No. 3 in the sequence list;

[0023] 2) The nucleic acid sequence is the DNA molecule of SEQ ID No. 1 or SEQ ID No. 3 in the sequence list;

[0024] 3) A cDNA molecule or genomic DNA molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the above enzyme.

[0025] Secondly, the present invention also provides the use of the rubber tree trans-nerolidol synthase in the preparation of trans-nerolidol.

[0026] The invention also provides the use of the biological material in preparing trans-nerolidol synthase from rubber tree or constructing transgenic plants or producing trans-nerolidol.

[0027] In addition, the present invention also provides a primer pair for amplifying a nucleic acid molecule fragment encoding Alpinia oxyphylla and Hevea brasiliensis trans-nerolidol synthase;

[0028] Preferably, the amplification primer pair is: the forward primer is shown as SEQ ID NO.5 or SEQ ID NO.7, and the reverse primer is shown as SEQ ID NO.6 or SEQ ID NO.8.

[0029] The invention also provides a method for producing trans-nerolidol, which uses the trans-nerolidol synthase of Alpinia oxyphylla and Hevea brasiliensis to catalyze farnesyl pyrophosphate to obtain trans-nerolidol.

[0030] The invention also provides the use of Alpinia oxyphylla, Hevea brasiliensis trans-nerolidol synthase or the above biological materials in the development of raw materials for flavors and spices or the preparation of high-grade flavors and spices.

[0031] Finally, the present invention also provides a biosynthetic product for the development or formulation of flavors and fragrances, wherein the product comprises Alpinia oxyphylla, Hevea brasiliensis trans-nerolidol synthase or the above-mentioned biological material.

[0032] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0033] (1) The present invention is the first to discover a synthase gene from Alpinia oxyphylla and Hevea brasiliensis that can efficiently synthesize trans-nerolidol. The gene can mainly synthesize trans-nerolidol and can be used as a potential aromatic compound in the flavor and fragrance industry.

[0034] (2) The present invention obtains a recombinant vector and an engineered bacterium by recombining the trans-nerolidol synthase genes of Alpinia oxyphylla and Hevea brasiliensis for synthesizing trans-nerolidol, and successfully constructs trans-nerolidol producing strains of Alpinia oxyphylla and Hevea brasiliensis, with shake flask yields reaching 154 mg / L and 125 mg / L, respectively, thus laying an important foundation for the industrial application of trans-nerolidol. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a graph showing the GC-MS test results of the JBS3 and JBS4 strain products of the present invention. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical scheme and advantages of the present invention clearer, the specific embodiments of the present invention are further described in detail below in conjunction with specific examples and drawings. If no specific technology or conditions are specified in the examples, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0037] DNA polymerase, restriction endonuclease and plasmid extraction kit were purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.; RNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; DNA gel recovery kit and homologous recombination kit were purchased from Nanjing Novagen Biotechnology Co., Ltd.; pTOPO-Blunt Simple vector was purchased from Beijing Aidelai Biotechnology Co., Ltd., and yeast expression plasmid pESC was purchased from Novagen; specific gene primer pairs P1-P2 and P3-P4 were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0038] Detection method of trans-nerolidol: GC-MS detection was performed using a Thermo TRACE GC Ultra system and a TSQ 9000 system. The GC detection program was set as follows: the initial oven temperature was 50°C for 1 minute; then it was increased to 280°C at a rate of 15°C / min and held for 1 minute; then it was increased to 300°C at a rate of 20°C / min and held for 2 minutes. Volatile samples were injected at 240°C and the MS transfer temperature was maintained at 270°C. Compounds were identified by comparison with the NIST database and retention indices.

[0039] YPD medium: The medium components contain 2% glucose (Sinopharm), 2% tryptone (Angel Yeast), and 1% yeast extract (Angel Yeast);

[0040] Yeast strain JCR27, the construction method of which is described in Siemon, Thomas et al. "Semisynthesis of Plant-Derived Englerin A Enabled by Microbe Engineering of Guaia-6,10(14)-diene as Building Block." Journal of the American Chemical Society vol.142,6(2020):2760-2765.

[0041] Preparation of cDNA: RNA extracted from Alpinia oxyphylla and rubber tree latex is reverse transcribed into cDNA. This process is usually carried out according to conventional conditions such as the conditions described in the "Molecular Cloning Laboratory Manual (4th Edition)" (Chinese version) published by Science Press, or according to the conditions recommended by the manufacturer. It is an experimental operation well known to those skilled in the art and the present invention is not limited to this.

[0042] The nucleotide sequences of trans-nerolidol synthase genes of Alpinia oxyphylla and Hevea brasiliensis are shown as SEQ ID NO.1 and SEQ ID NO.3.

[0043] The amino acid sequence of the trans-nerolidol synthase from Alpinia oxyphylla and Hevea brasiliensis provided by the present invention is shown as SEQ ID NO.2 or SEQ ID NO.4.

[0044] Example 1

[0045] (1) Gene cloning

[0046] The applicant analyzed the genome sequences of rubber tree and Alpinia oxyphylla and found a trans-nerolidol synthase gene of Alpinia oxyphylla and rubber tree, respectively, and the nucleotide sequences of the genes are shown in SEQ ID NO.1 and SEQ ID NO.3.

[0047] The corresponding genes were cloned from rubber tree latex cDNA and Alpinia oxyphylla cDNA templates using primer pairs P1-P2 and P3-P4 (see Table 1), respectively.

[0048] Table 1 Primer sequences

[0049] Primer name Primer sequence (5'-3') P1 SEQ ID NO.5: GGCCCGGGCGTCGACATGCATTCGTGCATGGT P2 SEQ ID NO.6: CGGATCTTAGCTAGCCTAGATATGTTTAAACAACAAGTTTG P3 SEQ ID NO.7: GGCCCGGGCGTCGACATGGACTTGAAGATGAACTT P4 SEQ ID NO.8: CGGATCTTAGCTAGCCTACATGGAGACACTTTCAT

[0050] The PCR reaction system used was (30 μL): 12.5 μL of water, 15 μL of 2x PrimerSTAR Max Permix, 1 μL of each forward and reverse primer (10 μM), and 0.5 μL of cDNA template. The RT-PCR reaction system was: 95°C for 3 min, 95°C for 10 s, 54°C for 20 s, 72°C for 2 min, 33 cycles, 72°C for 10 min, and 10°C hold. The gene fragment was then recovered using an agarose gel DNA recovery kit, connected to the pEasy vector, and transformed into DH5α E. coli competent cells. After verification by bacterial liquid PCR, it was sent to a DNA sequencing company for sequencing confirmation.

[0051] (2) Construction of recombinant expression vector

[0052] The recombination kit was used to connect with the yeast linearized expression vector pESC in an appropriate ratio: 37°C, 30 min. After transformation into DH5α Escherichia coli competent cells, the bacterial solution PCR was used for verification, and the plasmid was extracted from the positive strain to obtain the yeast expression vector containing the target gene.

[0053] (3) Construction and functional characterization of engineered bacteria

[0054] (3.1) Preparation of competent yeast

[0055] After overnight culture, the JCR27 strain was transferred to 50 mL of fresh YPD medium and cultured at 30°C until OD600 was about 0.6. After centrifugation at 500 g for 5 min, the strain was suspended in LiAC solution. After centrifugation at 500 g for 5 min, the strain was collected and resuspended in 1 mL of LiAC solution to obtain the competent state.

[0056] (3.2) Yeast competent cell transformation

[0057] The above-mentioned recombinant expression vectors were transferred into JCR27 yeast competent cells by PEG-LiAc transformation method, placed at 30°C for 30 min, heat shocked at 42°C for 10 min, centrifuged for 5 min, spread on yeast screening plates, and cultured at 30°C for 3 days. Then, colony PCR verification was performed using primer pairs P1-P2 or P3-P4, and the positive bacteria were named JBS3 and JBS4.

[0058] (3.3) Functional characterization

[0059] The cryopreserved JBS3 and JBS4 strains were inoculated into 5-10 mL screening medium for overnight culture, then transferred to YPDHG medium, added with 0.5%-1% IPM, cultured at 30°C for 3 days, centrifuged at 4000 rpm for 7 minutes, and then the test samples were prepared for GC-MS detection. The test results of the fermentation samples of JBS3 and JBS4 strains are shown in Figure 1 The product was identified as trans-nerolidol by comparison with the trans-nerolidol standard.

[0060] (3.4) Fermentation evaluation

[0061] After the gene function was determined, JBS3 and JBS4 were inoculated into 50 mL YPDHG medium using a similar method, 0.5%-1% IPM was added, and cultured at 30°C for 3 days. After centrifugation at 4000 rpm for 7 minutes, test samples were prepared for GC-MS detection and quantification. The shake flask yield of JBS3 strain was about 154 mg / L, and the shake flask yield of JBS4 strain was about 125 mg / L.

[0062] In the absence of conflict, the above embodiments and features in the embodiments may be combined with each other.

[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. An enzyme, which is the enzyme of a) below: a) An enzyme whose amino acid sequence is SEQ ID No.

2.

2. The biomaterial related to the enzyme according to claim 1, which is any one of the following B1) to B8): B1) a nucleic acid molecule encoding the enzyme according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) a recombinant microorganism containing the recombinant vector described in B4); The vectors include pESC yeast expression vectors and transgenic plant expression vectors; The recombinant microorganisms include engineered bacteria.

3. The biomaterial according to claim 2, characterized in that: The nucleic acid molecule is the nucleic acid molecule shown in 1) or 2) below: 1) The coding sequence is a DNA molecule or cDNA molecule of SEQ ID No. 1 in the sequence list; 2) A cDNA molecule or genomic DNA molecule that hybridizes with the nucleotide sequence defined in 1) under stringent conditions and encodes the enzyme according to claim 1.

4. Use of the enzyme according to claim 1 in the preparation of trans-nerolidol.

5. Use of the biological material according to claim 2 in preparing trans-nerolidol synthase or constructing transgenic plants or producing trans-nerolidol.

6. A primer pair for amplifying a nucleic acid molecule encoding the enzyme of claim 1.

7. The primer pair according to claim 6, characterized in that The primer pair is shown as SEQ ID No.5 and SEQ ID NO.

6.

8. A method for producing trans-nerolidol, characterized in that: The method comprises the step of synthesizing using the enzyme of claim 1.

9. Use of the enzyme according to claim 1 or the biomaterial according to claim 2 in the development of raw materials for flavors and fragrances or the preparation of high-grade flavors and fragrances.

10. A biosynthetic product for the development or formulation of flavors and fragrances, the product comprising the enzyme according to claim 1 or the biomaterial according to claim 2.

Images