Genetically engineered bacteria, preparation method and application thereof

By integrating the orfZ gene and promoter into luminescent bacteria LN01, the problems of low P3HB4HB yield and 4HB content were solved, achieving efficient P3HB4HB synthesis and promoting the industrial application of bio-based plastics.

CN121086965BActive Publication Date: 2026-03-31MSTN TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-27
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

In existing technologies, the yield of P3HB4HB is low and the 4HB content is low, making it difficult to achieve high-density fermentation and an ideal 4HB ratio, which limits its widespread use in industrial production and application.

Method used

Based on the bioluminescent bacterium LN01, the synthesis of 4-hydroxybutyric acid was promoted by integrating the orfZ gene and the promoter that regulates its expression into its genome, especially by inserting the orfZ gene into the 6-base position after the stop codon of the phaC gene or ldhA1 gene, thereby increasing the yield of P3HB4HB and the content of 4HB.

Benefits of technology

The efficient synthesis of P3HB4HB was achieved, with a significant increase in 4HB content, which promotes the industrial production of bio-based plastics and reduces the negative environmental impact of petroleum-based plastics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121086965B_ABST
    Figure CN121086965B_ABST
Patent Text Reader

Abstract

The application provides a genetically engineered bacterium, a preparation method and application thereof. The genetically engineered bacterium contains an exogenous introduced orfZ gene; the genetically engineered bacterium is selected from luminous bacillus LN01. When the genetically engineered bacterium is fermented by using sucrose and gamma-butyrolactone as precursors, P3HB4HB can be efficiently synthesized, and the content of 4HB in the P3HB4HB is high. The genetically engineered bacterium is expected to be applied to industrialized production of bio-based plastics, and high-efficiency production of P3HB4HB with high content of 4HB is realized. The genetically engineered bacterium has important significance for promoting wide application of biopolyesters and reducing negative influences of petroleum-based plastics on the environment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biosynthesis, and more specifically, to a genetically engineered bacterium, its preparation method, and its application. Background Technology

[0002] Biodegradable plastics are considered a key approach to mitigating plastic pollution as an alternative to petroleum-based non-degradable plastics. Polyhydroxyalkanoate (PHA), a bio-based material synthesized entirely by microorganisms, stands out for its unique bio-based properties.

[0003] Depending on the monomer structure that makes up PHA, it exhibits a variety of different material properties, such as mechanical properties, tensile properties, and elastic properties, thus demonstrating its wide applicability in various scenarios. Currently, the commercially available types of PHA include the following four: poly(3-hydroxybutyrate) (PHB), poly(3-hydroxybutyrate-3-hydroxyhexanoate) (PHBHHx), poly(3-hydroxybutyrate-3-hydroxyvalerate) (PHBV), and poly(3-hydroxybutyrate-4-hydroxybutyrate) (P3HB4HB).

[0004] PHB has a simple structure, but its high crystallinity and low elongation at break result in brittleness and insufficient toughness, increasing processing difficulty and limiting its application in a wider range of fields. PHBHHx, due to the introduction of a longer 3-hydroxyhexanoic acid (C6) segment, exhibits better flexibility than P3HB, but its tensile strength may be lower, making it difficult to balance high toughness and high strength requirements. While its crystallinity is lower than P3HB, its processing window remains narrow, potentially requiring additives or blending to improve melt stability. The synthesis of 3-hydroxyhexanoic acid monomers is complex, resulting in higher production costs than 3-hydroxyvalerate (C5) or 4-hydroxybutyric acid (C4) monomers. The addition of 3-hydroxyvalerate (HV) to PHBV reduces crystallinity, but at low HV content (<20%), the material remains brittle; at excessively high content (>30%), strength decreases significantly. The melting temperature (Tm) decreases with HV content, potentially limiting high-temperature applications.

[0005] Compared to PHB, P3HB4HB exhibits significantly improved physicochemical properties due to the incorporation of the 4HB monomer, and the proportion of the 4HB monomer directly affects the material properties of P3HB4HB. For example, when the molar percentage of 4HB increases from 64% to 100%, the tensile strength of P3HB4HB jumps from 17 MPa to 104 MPa; similarly, when the 4HB content increases from 0% to 82%, the elongation at break of P3HB4HB increases from 5% to 1320%. The introduction of the 4HB monomer significantly reduces the crystallinity of P3HB4HB (approaching amorphous), while maintaining high ductility (elongation at break exceeding 1000%), far surpassing PHBHHx and PHBV. P3HB4HB possesses a wider melting temperature range and a lower tendency for thermal degradation, making it suitable for processes such as blown film and injection molding. The presence of the 4HB monomer improves the material's hydrophilicity and promotes uniform degradation, giving P3HB4HB greater advantages in fields such as medical sutures and drug carriers. In addition, P3HB4HB can be used to replace traditional plastic packaging, reducing plastic waste and the burden on the environment.

[0006] The production of P3HB and 4HB can be achieved through wild-type bacteria or genetically modified bacteria. For example, recombinant *E. coli* can synthesize P3HB and 4HB with a 4HB composition exceeding 10 mol%, but the cell dry weight in the fermenter only reaches 23.5 g / L, making industrial-scale production difficult (Li, ZJ, Shi, ZJ, Guo, YY, Wu, Q., Chen, GQ, 2010. Production of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) from unrelated carbon sources by metabolically engineered *Escherichia coli*. *Metab. Eng.*, 12, 4, 352-359.). *Rhodotrophoblastus* can effectively synthesize P3HB and 4HB with the addition of precursors such as γ-butyrolactone or 4-hydroxybutyric acid, achieving a cell dry weight as high as 51 g / L, a P3HB and 4HB content of 35%, and a 4HB proportion of 32 mol%. Although the 4HB ratio is relatively high, the cell dry weight and P3HB / 4HB content are low due to the inhibitory effect of the precursor on bacterial growth, resulting in a production intensity of only 0.24 g / L / hour. Currently, few technologies can simultaneously achieve high-density fermentation and an ideal 4HB ratio (greater than 10 mol%) in P3HB / 4HB. Summary of the Invention

[0007] The main objective of this invention is to provide a genetically engineered bacterium, its preparation method, and its application, in order to solve the problems of low yield and low 4HB content of P3HB4HB in the prior art.

[0008] To achieve the above objectives, according to a first aspect of the present invention, a genetically engineered bacterium is provided, the genome of which contains an exogenously introduced orfZ gene; the genetically engineered bacterium is selected from luminescent bacillus LN01.

[0009] In a preferred embodiment of the present invention, the above-mentioned orfZ gene is derived from Clostridium krusei.

[0010] In a preferred embodiment of the present invention, the above-mentioned genetically engineered bacteria further contains a promoter that regulates the expression of the above-mentioned orfZ gene;

[0011] Preferably, the promoter is selected from the PDC promoter;

[0012] Preferably, the genetically engineered bacteria contain an endogenous phaC gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the phaC gene, or the genetically engineered bacteria contain an endogenous ldhA1 gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the ldhA1 gene.

[0013] To achieve the above objective, according to a second aspect of the present invention, a method for preparing a genetically engineered bacterium is provided, the method comprising: knocking in the orfZ gene into the genome of a starting engineered bacterium to obtain the above-mentioned genetically engineered bacterium; the starting engineered bacterium is selected from luminescent bacillus LN01.

[0014] In a preferred embodiment of the present invention, the above-mentioned orfZ gene is derived from Clostridium krusei.

[0015] In a preferred embodiment of the present invention, a promoter that regulates the expression of the orfZ gene is knocked into the genome of the above-mentioned starting engineered bacteria; the promoter is located upstream of the start codon of the orfZ gene.

[0016] Preferably, the promoter is selected from the PDC promoter;

[0017] Preferably, the starting engineered bacteria contains an endogenous phaC gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the phaC gene, or the starting engineered bacteria contains an endogenous ldhA1 gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the ldhA1 gene.

[0018] To achieve the above objective, according to a third aspect of the present invention, a method for synthesizing a copolyester of 3-hydroxybutyric acid and 4-hydroxybutyric acid is provided, the method comprising: using the above-described genetically engineered bacteria or the genetically engineered bacteria prepared by the above-described method for preparing genetically engineered bacteria to ferment and synthesize the above-described copolyester of 3-hydroxybutyric acid and 4-hydroxybutyric acid in a fermentation medium.

[0019] In a preferred embodiment of the present invention, the fermentation includes: inoculating the above-mentioned genetically engineered bacteria cultured overnight into a fermentation medium for expansion culture to obtain the above-mentioned 3-hydroxybutyric acid and 4-hydroxybutyric acid copolyester;

[0020] Preferably, the overnight culture conditions are 30-37℃ and 200-220 rpm; the scale-up culture conditions are 30-37℃ and 200-220 rpm.

[0021] More preferably, the above-mentioned scale-up culture is a fermenter culture, and the culture conditions of the fermenter culture further include: an aeration rate of 2 to 10 vvm and a pH of 7.4 to 7.6;

[0022] Preferably, the OD of the above-mentioned genetically engineered bacteria cultured overnight is... 600 The dosage is 2-10; the inoculation dosage mentioned above is 5%-10%.

[0023] In a preferred embodiment of the present invention, the fermentation medium is selected from MS medium.

[0024] In a preferred embodiment of the present invention, the fermentation medium further includes 0-70 g / L sodium chloride; 30-50 g / L sucrose concentration and 2-8 g / L γ-butyrolactone.

[0025] Applying the technical solution of this invention, the luminescent bacterium LN01 containing the exogenously introduced orfZ gene can efficiently synthesize P3HB4HB with a high 4HB content during fermentation using sucrose and γ-butyrolactone as precursors. This genetically engineered bacterium holds promise for the industrial production of bio-based plastics, enabling the efficient production of P3HB4HB with high 4HB content. This is of great significance for promoting the widespread application of biopolyesters and reducing the negative environmental impact of petroleum-based plastics. Attached Figure Description

[0026] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0027] Figure 1The results of secondary homologous recombination during the construction of the LN01-POP strain according to Example 1 of the present invention are shown, where M represents the Marker and numbers 1-14 represent different clones.

[0028] Figure 2 The results of secondary homologous recombination of the LN01-OP strain constructed according to Example 2 of the present invention are shown, where M represents the marker and numbers 1-24 represent different clones.

[0029] Figure 3 A metabolic pathway diagram of P3HB4HB synthesized by the luminescent bacillus LN01 using sucrose according to an embodiment of the present invention is shown. Detailed Implementation

[0030] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0031] Terminology Explanation:

[0032] 3HB: 3-Hydroxybutyric acid, also known as 3-Hydroxybutyrate, is a hydroxy fatty acid monomer with a chemical structure containing a hydroxyl (OH) group and a butyric acid skeleton, with the hydroxyl group located on the third carbon. It is one of the most common monomers of PHA.

[0033] 4HB: 4-Hydroxybutyric acid, is a hydroxy fatty acid monomer with a chemical structure containing a hydroxyl (OH) group and a butyric acid skeleton, with the hydroxyl group located on the fourth carbon. 4HB is a monomer used in the synthesis of PHA.

[0034] P3HB: Poly(3-hydroxybutyrate), also known as poly-3-hydroxybutyrate, is a polymer (homopolymer) formed by the polymerization of 3HB monomers. It is the most common PHA and has good biodegradability and biocompatibility.

[0035] P4HB: Poly(4-hydroxybutyrate), also known as poly-4-hydroxybutyrate, is a polymer (homopolymer) formed by the polymerization of 4HB monomers. It is characterized by good flexibility and fast degradation.

[0036] P3HB4HB: Poly(3-hydroxybutyrate-co-4-hydroxybutyrate), also known as a copolyester of 3-hydroxybutyrate and 4-hydroxybutyrate, is a copolymer of 3HB and 4HB monomers. Adjusting the ratio of 3HB to 4HB can alter the mechanical properties and degradation rate of the material.

[0037] As mentioned in the background section, P3HB4HB possesses advantages such as low crystallinity (approaching amorphous), high ductility (elongation at break exceeding 1000%), a wide melting temperature range, and low thermal degradation tendency, making it suitable for a wide range of applications. Furthermore, the presence of the 4HB monomer in P3HB4HB improves the material's hydrophilicity and promotes uniform degradation, further enhancing its advantages in fields such as medical sutures and drug carriers.

[0038] However, existing technologies using microorganisms to produce P3HB and 4HB suffer from low yields and low 4HB content. Photobacterium sp. LN01 has the potential to be used for industrial PHA production, but the wild-type strain synthesizes P3HB and 4HB with an excessively low 4HB content, failing to meet the demand for a high 4HB ratio. Photobacterium sp. LN01 can efficiently synthesize various polyhydroxy fatty acid esters; therefore, the inventors of this invention attempted to modify this bacterium, proposing a series of protective schemes.

[0039] In a first typical embodiment of the present invention, a genetically engineered bacterium is provided, the genome of which contains an exogenously introduced orfZ gene; the genetically engineered bacterium is selected from luminescent bacillus LN01.

[0040] *Proteobacterium luminiferum* LN01 can convert sucrose into acetyl-CoA, which is then converted into 3HB-CoA by phaA and phaB. Furthermore, *Proteobacterium luminiferum* can utilize exogenously added γ-butyrolactone (GBL) to convert it into 4-hydroxybutyric acid (4HB). Subsequently, 4HB is catalyzed by 4-hydroxybutyryl-CoA transferase (a protein encoded by the pct gene contained in LN01 itself, whose nucleotide sequence is SEQ ID NO: 22, and which has the same function as the orfZ gene) to generate 4HB-CoA. 3HB-CoA and 4HB-CoA are then polymerized by the PHA synthase phaC to generate P3HB4HB (see [link to P3HB4HB]). Figure 3 ).

[0041] The orfZ gene functions as a 4-hydroxybutyrate-coenzyme A transferase and is relatively easy to integrate into the genome. Introducing this gene into *Proteobacterium luminiferum* LN01 efficiently promotes the conversion of 4-hydroxybutyrate (4HB) to 4-hydroxybutyrate-coenzyme A (4HB-CoA), which is then utilized by the microorganism to synthesize P3HB and 4HB. Introducing the exogenous orfZ gene into *Proteobacterium luminiferum* LN01 promotes the conversion of more 4HB to 4HB-CoA, thereby contributing to increased yields and 4HB content in P3HB and 4HB.

[0042] In a preferred embodiment of the present invention, the orfZ gene is derived from Clostridium krillione. The protein encoded by the orfZ gene derived from Clostridium krillione has the advantage of high catalytic efficiency, thus rapidly increasing the yield of 4-hydroxybutyrate coenzyme A, thereby contributing to increasing the yield of P3HB4HB and the content of 4HB in P3HB4HB.

[0043] In a more preferred embodiment of the present invention, the nucleotide sequence of the orfZ gene is SEQ ID NO: 21.

[0044] The sequence of SEQ ID NO: 21 is shown below:

[0045]

[0046] To further increase the content and proportion of P3HB4HB in this application, in a preferred embodiment of the invention, the above-mentioned genetically engineered bacteria also contains a promoter that regulates the expression of the orfZ gene.

[0047] Promoters are key elements in gene expression regulation, located in the non-coding region upstream of the gene, and are responsible for controlling the initiation, efficiency, and specificity of transcription. In a preferred embodiment of the present invention, the promoter is selected from the pdc promoter. The pdc promoter has high transcription initiation activity and can efficiently promote the transcription of the orfZ gene, thereby achieving efficient expression of the orfZ gene.

[0048] In a preferred embodiment of the present invention, the genetically engineered bacteria contain an endogenous phaC gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the phaC gene, or the genetically engineered bacteria contain an endogenous ldhA1 gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the ldhA1 gene. Inserting the orfZ gene into this position in the genome of *Bacillus luminifera* LN01 has the beneficial effect of increasing the proportion of 4HB monomers in P3HB4HB.

[0049] In a second typical embodiment of the present invention, a method for preparing a genetically engineered bacterium is provided. The method includes: knocking in the orfZ gene into the genome of a starting engineered bacterium to obtain the aforementioned genetically engineered bacterium; the genetically engineered bacterium is selected from *Bacillus luminifera* LN01. The genetically engineered bacterium prepared using this method has the advantages of high synthesis efficiency and a high proportion of 4HB in the synthesized P3HB4HB when used for P3HB4HB synthesis.

[0050] In a preferred embodiment of the present invention, the above-mentioned orfZ gene is derived from Clostridium krusei.

[0051] In a preferred embodiment of the present invention, a promoter that regulates the expression of the orfZ gene is knocked into the genome of the aforementioned engineered bacteria; the promoter is located upstream of the start codon of the orfZ gene.

[0052] In a preferred embodiment of the present invention, the promoter is selected from the pdc promoter.

[0053] In a preferred embodiment of the present invention, the starting engineered bacteria contains an endogenous phaC gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the phaC gene, or the engineered bacteria contains an endogenous ldhA1 gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the ldhA1 gene.

[0054] In a third typical embodiment of the present invention, a method for synthesizing a copolyester of 3-hydroxybutyric acid and 4-hydroxybutyric acid is provided. The method includes: using the above-mentioned genetically engineered bacteria or the genetically engineered bacteria prepared by the above-mentioned method to ferment and synthesize the above-mentioned copolyester of 3-hydroxybutyric acid and 4-hydroxybutyric acid in a fermentation medium.

[0055] The method of this invention can synthesize P3HB4HB, which not only achieves efficient synthesis of P3HB4HB, but also has a high content of 4HB in the synthesized P3HB4HB.

[0056] In a preferred embodiment of the present invention, the fermentation includes: inoculating the genetically engineered bacteria cultured overnight into a fermentation medium for expansion culture to obtain the copolyester of 3-hydroxybutyric acid and 4-hydroxybutyric acid.

[0057] In a preferred embodiment of the present invention, the overnight culture conditions are 30-37°C and 200-220 rpm; the scale-up culture conditions are 30-37°C and 200-220 rpm. These culture conditions can promote the rapid growth and reproduction of the above-mentioned genetically engineered bacteria, which is conducive to the efficient synthesis of P3HB4HB.

[0058] In a more preferred embodiment of the present invention, the above-mentioned scale-up culture is a fermenter culture, and the culture conditions of the fermenter culture further include: an aeration rate of 2-10 vvm and a pH of 7.4-7.6. In a more preferred embodiment of the present invention, a 30% NaOH solution is used to adjust the pH.

[0059] It should be noted that when using a fermenter, sucrose, yeast extract, urea, and γ-butyrolactone need to be added. Sucrose serves as the carbon source, yeast extract and urea as nitrogen sources, and γ-butyrolactone as a precursor. The sucrose concentration needs to be maintained at 5-10 g / L, the yeast extract concentration at 1-5 g / L, the urea concentration at 0.5-5 g / L, and the γ-butyrolactone concentration at 2-8 g / L.

[0060] In a preferred embodiment of the present invention, the OD of the above-mentioned genetically engineered bacteria cultured overnight... 600 The dosage is 2-10; the inoculation dosage mentioned above is 5%-10%.

[0061] In a preferred embodiment of the present invention, the fermentation medium is selected from MS medium. In a more preferred embodiment of the present invention, the fermentation medium further includes 0-70 g / L sodium chloride; 30-50 g / L sucrose concentration and 2-8 g / L γ-butyrolactone.

[0062] In one selected embodiment of the present invention, the fermentation culture medium includes component I, component II, trace element mother liquor and substrate;

[0063] Component I above includes 492.5 g / L of disodium hydrogen phosphate dodecahydrate and 75 g / L of potassium dihydrogen phosphate;

[0064] Component II above includes 100 g / L ammonium sulfate and 20 g / L magnesium sulfate heptahydrate;

[0065] The above-mentioned base includes 40 g / L sucrose, 5 g / L yeast powder, 30 g / L sodium chloride and 2 g / L γ-butyrolactone;

[0066] The above-mentioned trace element mother liquor includes component III, component IV and deionized water; the solvent for component III and component IV is 1 mol / L dilute hydrochloric acid;

[0067] Component III above includes 5 g / L of ferric ammonium citrate and 2 g / L of calcium chloride dihydrate;

[0068] Component IV includes 0.1 g / L zinc sulfate heptahydrate, 0.03 g / L manganese chloride tetrahydrate, 0.3 g / L boric acid, 0.2 g / L cobalt chloride hexahydrate, 0.01 g / L copper sulfate pentahydrate, 0.02 g / L nickel chloride hexahydrate, and 0.03 g / L sodium molybdate dihydrate.

[0069] The present invention will be further described in detail below with reference to specific embodiments, which should not be construed as limiting the scope of protection claimed by the present invention.

[0070] I. Primer sequences used in this application

[0071] 112-POP-F (SEQ ID NO: 1): cttgtccgggtacctctagaagaagcttgggatc.

[0072] 112-POP-R (SEQ ID NO: 2): cgcttgcatgcgatatcgagctctcc.

[0073] POP-FF (SEQ ID NO: 3): ctcgatatcgcatgcaagcgtgccacagtacattg.

[0074] POP-FR (SEQ ID NO: 4): gtatatctccttggatcctataaaataatcaattcgggcttgaaaactcaatc.

[0075] POP-RF(SEQ ID NO:5):agttgaacgccaaatatcagtattgtaaaaac。

[0076] POP-RR(SEQ ID NO:6):tctagaggtacccggacaagatgcacgctg。

[0077] POP-F(SEQ ID NO:7):ccgaattgattatttcgctcatgatcgcggc。

[0078] POP-R(SEQ ID NO:8):ctgatattggcgttcaactttaaaatctctttttaaattcattcattaatgattctctg。

[0079] 112-OP-F(SEQ ID NO:9):cttgtccgggtacctctagaagaagcttgggatc。

[0080] 112-OP-R(SEQ ID NO:10):cgcttgcatgcgatatcgagctctcc。

[0081] OP-FF(SEQ ID NO:11):ctcgatatcgcatgcaagcgtgccacagtacattg。

[0082] OP-FR(SEQ ID NO:12):gtatatctccttggatcctataaaataatcaattcgggcttgaaaactcaatc。

[0083] OP-RF(SEQ ID NO:13):aagttgaacgccaatatcagtattgtaaaaac。

[0084] OP-RR(SEQ ID NO:14):tctagaggtacccggacaagatgcacgctg。

[0085] OP-F(SEQ ID NO:15):taggatccaaggagatataccatggc。

[0086] OP-R(SEQ ID NO:16):ctgatattggcgttcaactttaaaatctctttttaaattcattcattaatgattctctg。

[0087] pRE112-VF (SEQ ID NO: 17): gcttccatgtcggcagaatgc.

[0088] pRE112-VR (SEQ ID NO: 18): gcccggctgtatgcg.

[0089] II. Experimental materials and culture media used in this application

[0090] MS liquid culture medium is prepared by mixing component I, component II, trace element stock solution and substrate in a volume ratio of 1:1:1:50.

[0091] Component I consists of 492.5 g / L disodium hydrogen phosphate dodecahydrate and 75 g / L potassium dihydrogen phosphate. Component II consists of 100 g / L ammonium sulfate and 20 g / L magnesium sulfate heptahydrate. The trace element stock solution is prepared by mixing components III, IV, and deionized water in a volume ratio of 10:1:9, and adjusting the pH to 4-5 using sodium hydroxide. Component III consists of 5 g / L ferric ammonium citrate and 2 g / L calcium chloride dihydrate, dissolved in 1 mol / L dilute hydrochloric acid. Component IV consists of 0.1 g / L zinc sulfate heptahydrate, 0.03 g / L manganese chloride tetrahydrate, 0.3 g / L boric acid, 0.2 g / L cobalt chloride hexahydrate, 0.01 g / L copper sulfate pentahydrate, 0.02 g / L nickel chloride hexahydrate, and 0.03 g / L sodium molybdate dihydrate, dissolved in 1 mol / L dilute hydrochloric acid. The base consists of 40 g / L sucrose, 5 g / L yeast powder, 30 g / L sodium chloride, and 2 g / L γ-butyrolactone.

[0092] LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L.

[0093] LB30 medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 30 g / L.

[0094] LB60 medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 60 g / L.

[0095] Strains:

[0096] Photobacterium sp. LN01, whose strain preservation number is CGMCC No:28073; see patent application CN 118853483 A for details.

[0097] Escherichia coli S17-1: purchased from Beijing Bomed Biotechnology Co., Ltd., product number BC129-01.

[0098] The nucleotide sequence of the orfZ gene used in this embodiment is SEQ ID NO: 21.

[0099] Example 1: Establishment of LN01-POP recombinant strain

[0100] To improve the conversion rate of γ-butyrolactone in the strain, the orfZ gene was integrated into the genome of LN01. Specifically, the orfZ gene, driven by the pdc promoter, was inserted six bases from the stop codon of the phaC gene in LN01. This resulted in the recombinant strain LN01::PhaC-pdc-orfZ, abbreviated as LN01-POP. The orfZ gene is the 4-hydroxybutyryl-CoA transferase gene, and the phaC gene is the PHA synthase gene.

[0101] See below for specific instructions:

[0102] (1) Construction of pRE112-POP plasmid:

[0103] Using pRE112 as a template, PCR amplification with primers 112-POP-F and 112-POP-R yielded a 5773bp fragment, named the 112-POP vector fragment. Using the LN01 genome as a template, PCR amplification with primers POP-FF and POP-FR yielded a 500bp DNA fragment, named the POP-F homologous arm. Using the LN01 genome as a template, PCR amplification with primers POP-RF and POP-RR yielded a 500bp DNA fragment, named the POP-R homologous arm. Using pMCS3-pdc-orfZ as a template, PCR amplification with primers POP-F and POP-R yielded a 1714bp fragment, named the POP gene fragment. The obtained DNA fragments were purified and collected using agarose gel electrophoresis and a kit. After collection, the four fragments were assembled using the seamless cloning kit from BOMIDE to obtain the pRE112-POP plasmid.

[0104] (2) Construction of Escherichia coli S17-1 (pRE112-POP):

[0105] The plasmid pRE112-POP was transformed into the recipient strain *Escherichia coli* S17-1 using chemical transformation. The transformed bacteria were then plated onto LB agar containing chloramphenicol and incubated overnight at 37°C. PCR verification was performed on the colonies on the plate using pRE112-VF and pRE112-VR primers. A DNA fragment of approximately 3047 bp was obtained, indicating preliminary success. Further plasmid extraction and sequencing confirmed the presence of the recombinant strain pRE112-POP, which was identified as *Escherichia coli* S17-1 (pRE112-POP).

[0106] (3) Construction of LN01-POP strain:

[0107] A. Strain culture: S17-1 (pRE112-POP) was cultured overnight in LB medium containing chloramphenicol, and luminescent bacillus LN01 was cultured overnight in LB30 medium. The amount of chloramphenicol added was 1 / 1000 of the medium volume, and the inoculum size was 1 / 1000.

[0108] B. Strain transfer: Transfer 400 μL of overnight cultured S17-1 (pRE112-POP) to LB medium containing chloramphenicol, and transfer 200 μL of luminescent bacillus LN01 to LB30 medium. Incubate at 37°C for 4-5 hours, with chloramphenicol added at a concentration of 1 / 1000 of the medium volume.

[0109] C. Cell Collection: Take 1 mL of S17-1 (pRE112-POP) and luminescent bacillus LN01 bacterial suspensions respectively, and transfer them to pre-sterilized 1.5 mL centrifuge tubes. Centrifuge at 5500 rpm for 2 min at room temperature to collect the cells. Wash the enriched S17-1 (pRE112-POP) and LN01 cells twice with LB medium, centrifuging at 5500 rpm for 2 min after each wash. After washing, discard the supernatant and retain the precipitate containing the cells.

[0110] D. Binding: Add 100 μL of LB medium to a centrifuge tube containing *C. luminescence* LN01 cells and resuspend the cells. Transfer 100 μL of the resuspended *C. luminescence* LN01 solution to a centrifuge tube containing S17-1 (pRE112-POP). Mix well, then add 50 μL of the mixed solution dropwise onto LB20 solid medium and incubate at 37°C for 6 hours.

[0111] E. Screening and Cultivation: The mixed bacterial culture on the solid culture medium was resuspended in a sterile 1.5 mL centrifuge tube containing 200 μL LB60. The resuspended bacterial culture was spread on LB60 agar plates containing chloramphenicol and incubated at 37°C for 12-24 hours. Finally, positive single clones were screened to obtain the first homologous recombinant bacteria.

[0112] F. Overnight culture: The first homologous recombinant bacteria obtained from screening were picked and transferred to test tubes containing LB60 medium containing chloramphenicol for overnight culture.

[0113] G. Transfer of bacterial culture: Take 100 μL from the overnight culture and transfer it to an LB30+200 Suc tube, and incubate for 2 to 4 hours.

[0114] H. Spreading on plates: Spread 100 μL of the cultured bacterial solution onto an LB30+200 Suc plate and incubate overnight.

[0115] I. Single Colony Selection and Validation: Single colonies were selected from the cultured plates, and colony PCR was performed using POP-FF and POP-RR to verify the results of the second homologous recombination. The results are shown below. Figure 1 .

[0116] Experimental results showed that the final band size of 2700 bp was that of the LN01-POP recombinant bacteria. Figure 1 (Numbers 1, 2, 4, 8, and 9).

[0117] Example 2: Establishment of LN01-OP recombinant strain

[0118] To improve the conversion rate of γ-butyrolactone in the strain, the orfZ gene was integrated into the genome of LN01. Specifically, orfZ was directly inserted 6 bases after the stop codon of the phaC gene in LN01. This resulted in the LN01::PhaC-orfZ recombinant strain, abbreviated as LN01-OP.

[0119] See below for specific instructions:

[0120] (1) Construction of pRE112-OP plasmid:

[0121] Using pRE112 as a template, PCR amplification with primers 112-OP-F and 112-POP-R yielded a 5773bp fragment, named the 112-OP vector fragment; using the LN01 genome as a template, PCR amplification with primers OP-FF and OP-FR yielded a 500bp DNA fragment, named the OP-F homologous arm; using the LN01 genome as a template, PCR amplification with primers OP-RF and OP-RR yielded a 500bp DNA fragment, named the OP-R homologous arm; using pMCS3-pdc-orfZ as a template, PCR amplification with primers OP-F and OP-R yielded a 1516bp fragment, named the OP gene fragment. The remaining steps are described in Example 1(1).

[0122] (2) Construction of Escherichia coli S17-1 (pRE112-OP):

[0123] The experimental steps are described in Example 1 (2). The PCR verification primers were pRE112-VF and pRE112-VR. A DNA fragment of about 2866bp was obtained, which was a preliminary successful verification. Further plasmid extraction and sequencing verification were performed to obtain a recombinant bacterium containing plasmid pRE112-OP, which is Escherichia coli S17-1 (pRE112-OP).

[0124] (3) Construction of LN01-OP strain:

[0125] The experimental steps are described in Example 1(3), except that *E. coli* S17-1(pRE112-POP) was replaced with *E. coli* S17-1(pRE112-OP). Finally, single-clone selection and verification were performed using OP-FF and OP-RR colony PCR to verify the results of the second homologous recombination. The results are shown in […]. Figure 2 The final band size of 2566 bp was that of the LN01-OP recombinant strain. Figure 2 (Number 24).

[0126] Example 3

[0127] The recombinant strain obtained by inserting the PDC promoter-driven orfZ into the position 6 bases after the stop codon of lactate dehydrogenase (ldhA1) was named LN01-A1hPO. The remaining steps were the same as in Example 1.

[0128] Experiment 4: Shake-flask test of the fermentation capacity of recombinant bacteria

[0129] The recombinant bacteria obtained in Examples 1-3 were streaked onto plates to obtain single colonies. These single colonies were then inoculated into seed culture medium and cultured for 12 hours. The cultured bacterial solution was transferred to a 250 mL Erlenmeyer flask containing 20 mL of LB medium and cultured at 30°C and 200 rpm for 12 hours to obtain the seed culture. The OD of the seed culture was adjusted. 600 3. Inoculate 1.5 mL of the adjusted seed culture into a 250 mL shake flask containing 30 mL of MS liquid medium (inoculation amount is 5%), and incubate at 30 °C and 200 rpm for 48 h to obtain the fermentation broth.

[0130] Cell dry weight determination: 20 mL of fermentation broth was added to a centrifuge tube and centrifuged at 10,000 rpm for 5 min. The supernatant was removed, and the precipitate was washed twice with deionized water. After centrifugation at 10,000 rpm for 5 min, the supernatant was removed, the cells were collected, and the cells were frozen at -20℃ for 2 h. Then, the cells were freeze-dried in a freeze dryer for 10 h to obtain the freeze-dried product. The cell dry weight (CDM, unit: g / L) was calculated according to the following formula. The results are shown in Table 1.

[0131] The formula for calculating cell dry weight is: CDM = (m1 - m0) / v; where m1 is the weight of the centrifuge tube containing the freeze-dried product, m0 is the weight of the centrifuge tube, and v is the volume of the fermentation broth.

[0132] P3HB4HB Yield Determination: The freeze-dried product was subjected to esterification, and the yield was calculated by measuring the content of the product after esterification. Approximately 20 mg of a copolyester standard of 3-hydroxybutyric acid and 3-hydroxyvalerate (containing 3-hydroxybutyric acid and 3-hydroxyvalerate monomers) (purchased from Sigma-Aldrich, catalog number 403121) was subjected to esterification using the same method. Approximately 20 mg of a γ-butyrolactone standard (purchased from Beijing Tongguang Fine Chemical Co., Ltd., catalog number YZD23120811) was subjected to esterification using the same method.

[0133] The specific steps of the esterification reaction are as follows: Take 30-40 mg of the freeze-dried product into an esterification tube, add 2 mL of chloroform and 2 mL of esterification solution (which is obtained by adding 15 mL of concentrated sulfuric acid and 1 g of benzoic acid to 500 mL of methanol), mix well, cover and seal, and keep in an oven at 100℃ for 4 h; after cooling to room temperature, add 1 mL of deionized water, shake thoroughly with a vortex mixer, and let stand to separate the layers; after the chloroform phase and water are completely separated, take 1 μL of the chloroform phase for gas chromatography analysis.

[0134] Gas chromatography analysis parameters: An HP6890 gas chromatograph was used, with an HP-5 capillary column, 30m in length and 320μm in inner diameter, and a 25nm thick phenylmethyl polysiloxane stationary phase; a flame ionization detector (FID) was used; high-purity nitrogen was used as the carrier gas, hydrogen as the fuel gas, and air as the combustion-supporting gas;

[0135] The conditions for gas chromatography analysis are as follows:

[0136] (1) Column temperature: Start at 80℃ and hold for 1.5 min; increase the temperature to 140℃ at a rate of 30℃ / min and hold for 0 min; increase the temperature to 220℃ at a rate of 40℃ / min and hold for 1 min. The total time is 6.5 min.

[0137] (2) Column pressure: Start at 10 psi and hold for 1.5 min; increase the pressure to 20 psi at a rate of 2.5 psi / min and hold for 0.5 min. (psi is a unit of pressure, i.e., pounds per square inch, 1 psi = 6.89476 kPa).

[0138] (3) Inlet: Temperature is 200℃, split mode is used, and split ratio is 30.

[0139] (4) Detector: Temperature is 220℃, hydrogen flow rate is 30mL / min, and air flow rate is 400mL / min.

[0140] Using an Agilent microsyringe with an injection volume of 1 μL, the polymer was quantitatively analyzed using the internal standard method. Based on the peak area, the yield (g / L) and content (wt%) of P3HB and 4HB, as well as the proportion of 4HB (mol%), were calculated. The results are shown in Table 1.

[0141] The esterification reaction and gas chromatography detection were performed using the above steps. During gas chromatography detection, the frozen stem cell sample was compared with standards of 3-hydroxybutyric acid and 3-hydroxyvalerate copolyester and γ-butyrolactone.

[0142] The presence of a signal in the frozen stem cell sample with the same elution position as 3-hydroxybutyric acid in the standard indicates that the polyhydroxy fatty acid ester accumulated in the bacterial cells is poly-3-hydroxybutyrate.

[0143] The frozen stem cell sample contained signals with the same elution positions as 3-hydroxybutyric acid and 3-hydroxyvalerate in the standard, indicating that the polyhydroxy fatty acid ester accumulated in the bacterial cells was poly(3-hydroxybutyrate-co-3-hydroxyvalerate).

[0144] The frozen stem cell sample contained signals with the same elution positions as 3-hydroxybutyric acid and 4-hydroxybutyric acid in the standard, indicating that the polyhydroxy fatty acid ester accumulated in the bacterial cells was poly(3-hydroxybutyrate-co-4-hydroxybutyrate).

[0145] P3HB4HB content = PHB content + P4HB content;

[0146] PHB content = (S 样,PHB / S 样,内标 )×[(S 标1,内标 / S 标1,PHB )×m 标1 [×0.908] / m 样 ×100%;

[0147] P4HB content = (S sample) ,P4HB / S sample, internal standard) × [(S standard) 2, Internal standard / S standard 2,P4HB [(m standard 2) / m sample × 100%]

[0148] P3HB4HB yield = P3HB4HB content × CDM;

[0149] 4HB ratio = (P4HB content × CDM / 86) / [(PHB yield × CDM / 86) + (P4HB yield × CDM / 86)];

[0150] Among them, S 样,PHB S represents the peak area of ​​PHB in the sample. 样,内标 S represents the area of ​​the internal standard peak in the sample. 标1,内标S represents the peak area of ​​the internal standard in the PHB standard. 标1,PHB The peak area of ​​PHB in the PHB standard is in m. 标1 For the quality of PHB standard, S 样,P4HB S represents the peak area of ​​P4HB in the sample. 样,内标 S represents the area of ​​the internal standard peak in the sample. 标2,内标 S represents the peak area of ​​the internal standard in the γ-butyrolactone standard. 标2,P4HB The peak area of ​​P4HB in the γ-butyrolactone standard is m. 标2 For the mass of γ-butyrolactone standard, m 样 The constant represents the esterification quality of the sample; the constant 0.908 represents the proportion of 3HB in the standard, which can be found in the standard's instructions; the constant 86 represents the molecular weight of 4-hydroxybutyric acid minus one molecule of water.

[0151] Table 1

[0152]

[0153] The shake-flask results showed that, compared with the control strain LN01, the proportion of 4HB produced by LN01-POP using the pdc promoter and LN01-OP with the orfZ gene inserted was significantly improved, indicating that there is room for further improvement in its fermentation performance.

[0154] To determine the expression intensity of the orfZ gene in strains LN01-POP and LN01-OP, qRT-PCR analysis was performed. The primer sequences used were orfZ-F: 5'-CTGCAGCACCAGTATCTAGAAG (SEQ ID NO: 19); orfZ-R: 5'-GGTAGCTATGGGCAAAGGTG (SEQ ID NO: 20). Using the 16S rRNA gene as an internal control and the 27F and 1492R sequences, the results showed that the expression intensity of the orfZ gene in LN01-POP was 1.6 times that in LN01-OP. This indicates that the addition of the promoter significantly increases the expression intensity of the orfZ gene, and this increased expression level effectively promotes the polymerization of more 4HB monomers.

[0155] Experiment Example 5: Recombinant Bacterial Fermenter Test

[0156] First, 1000 μL of the strains from Examples 1 and 2 preserved in glycerol tubes were inoculated into LB medium and cultured at 30°C and 200 rpm for 12 h to obtain primary seed culture. Next, 5% of this culture was inoculated into 30 mL of MS medium and cultured at 30°C and 200 rpm for 24 h to obtain secondary seed culture. Then, 10% of this secondary seed culture was inoculated into a 15 L fermenter containing 7 L of MS medium. The operating conditions were: fermentation temperature 30°C, stirring speed 200 rpm, aeration rate 3 vvm, and pH controlled between 7.4 and 7.6 using a 30% NaOH solution. During the culture, sucrose was continuously used as the carbon source, maintaining a sucrose concentration of 5-10 g / L. Yeast extract and urea were added as nitrogen sources, and γ-butyrolactone was added to synthesize 4HB. The culture time was 48 hours. Product detection was performed in the same manner as in Example 1. The culture results for each strain are shown in Table 2.

[0157] Table 2

[0158]

[0159] Compared to the control strain LN01, the recombinant strain LN01-POP, obtained through gene editing, showed a 26.71% increase in cell dry weight and a 497.86% increase in the proportion of 4HB; the recombinant strain LN01-OP showed a 2.10% increase in cell dry weight and a 39.88% increase in the proportion of 4HB. The P3HB and 4HB yields of both recombinant strains LN01-POP and LN01-OP reached 73.96–100.38 g / L. Furthermore, the proportion of 4HB in the P3HB and 4HB produced by these two engineered strains ranged from 7.19 to 30.73 mol%.

[0160] As can be seen from the above description, the above embodiments of the present invention achieve the following technical effects: The present invention uses bioengineering methods to efficiently express the relevant genes controlling 4HB synthesis, thereby improving the conversion rate of γ-butyrolactone, and ultimately increasing the proportion of 4HB in P3HB4HB, solving the problems of low conversion rate of 4HB precursor in P3HB4HB and low content of 4HB in P3HB4HB in the prior art.

[0161] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A genetically engineered bacterium, characterized in that, The genome of the genetically engineered bacteria contains an exogenously introduced orfZ gene; the genetically engineered bacteria are selected from Photobacterium LN01; The luminescent bacillus LN01 is derived from Photobacterium Pseudomonas sp.; the preservation number of the luminescent bacillus LN01 is CGMCC No: 28073; The nucleotide sequence of the orfZ gene is SEQ ID NO:

21. 2.The genetically engineered bacteria according to claim 1, characterized in that, The genetically engineered bacteria also contain a promoter that regulates the expression of the orfZ gene. 3.The genetically engineered bacteria according to claim 2, characterized in that, The promoter is selected from a pdc promoter. 4.The genetically engineered bacteria according to claim 2, characterized in that, The genetically engineered bacteria contain an endogenous phaC gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the phaC gene. Or the genetically engineered bacteria contain an endogenous ldhA1 gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the ldhA1 gene.

5. A method for preparing a genetically engineered bacterium, characterized by, The preparation method comprises: introducing an orfZ gene into the genome of a starting engineered bacteria to obtain the genetically engineered bacteria; the starting engineered bacteria are selected from Photobacterium LN01; The luminescent bacillus LN01 is derived from Photobacterium P. shermanii; the preservation number of the luminescent bacillus LN01 is CGMCC No: 28073. The nucleotide sequence of the orfZ gene is SEQ ID NO:

21.

6. The preparation method according to claim 5, characterized in that, A promoter that regulates the expression of the orfZ gene is introduced into the genome of the starting engineered bacteria; the promoter is located upstream of the start codon of the orfZ gene.

7. The preparation method according to claim 6, characterized in that, The promoter is selected from a pdc promoter.

8. The preparation method according to claim 6, characterized in that, The starting engineered bacteria contain an endogenous phaC gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the phaC gene. Or the starting engineered bacteria contain an endogenous ldhA1 gene; the promoter and the orfZ gene are located 6 bases after the stop codon of the ldhA1 gene.

9. A method of synthesizing poly(3-hydroxybutyric acid-co-4-hydroxybutyrate) characterized by, The method comprises: fermenting and synthesizing the poly(3-hydroxybutyric acid-co-4-hydroxybutyric acid ester) in a fermentation medium by using the genetically engineered bacteria of any one of claims 1-4 or the genetically engineered bacteria prepared by the preparation method of any one of claims 5-8.

10. The method of claim 9, wherein, The fermentation comprises: inoculating the overnight cultured genetically engineered bacteria into a fermentation medium for expansion culture to obtain the poly(3-hydroxybutyric acid-co-4-hydroxybutyric acid ester).

11. The method of claim 10, wherein, The conditions for overnight culture are 30-37℃ and 200-220rpm; the conditions for expansion culture are 30-37℃ and 200-220rpm.

12. The method of claim 11, wherein, The expansion culture is fermentation tank culture, and the culture conditions of the fermentation tank culture further comprise: a ventilation amount of 2-10vvm and a pH of 7.4-7.

6.

13. The method of claim 10, wherein, OD of the genetically engineered bacteria of the overnight culture 600 is 2-10; the inoculation amount of the inoculation is 5%-10%.

14. The method of claim 10, wherein, The fermentation medium is selected from an MS medium; The fermentation medium further comprises 0-70g / L sodium chloride, a sucrose concentration of 30-50g / L, and 2-8g / L γ-butyrolactone.