A kind of marine collagenase Almanase and its application in preparing tilapia skin collagen tripeptide

Abstract

The present invention relates to the field of polypeptides, and in particular to a marine collagenase Almanase and its application in preparing tilapia skin collagen tripeptide. The present invention screens out a S8 family serine protease Almanase from the marine genus Alteromonas sp., and its amino acid sequence is shown in SEQ ID NO: 1. The present invention also provides a Pichia yeast for producing Almanase, and Almanase with high enzyme activity can be obtained by fermentation. The marine collagenase Almanase of the present invention is compounded with commercially available alkaline protease Alcalase and Bacillus amyloliquefaciens neutral protease to produce tilapia skin collagen tripeptide. In the obtained enzymatic hydrolyzate, the proportion of oligopeptides with a molecular weight of <500Da is increased by 23%, and the content of collagen tripeptide is increased by 2.03 times.

Description

Technical Field

[0001] The invention relates to the field of polypeptides, and in particular to a marine collagenase Almanase and an application thereof in preparing tilapia skin collagen tripeptide. Background Art

[0002] A typical collagen (type I) molecule is mainly composed of three peptide chains, including two α1 chains and one α2 chain. There are continuous GXY repeating sequences on the chain, where X is usually proline (Pro) and Y is usually hydroxyproline (Hyp). The three collagen peptide chains form a triple helix tropocollagen molecule under the action of interchain hydrogen bonds. Due to the special structure of collagen, it can be degraded by collagenase from mammals, bacteria and other sources.

[0003] Collagen peptides are products with a relative molecular weight of less than 10,000 Da produced by extraction and hydrolysis of fresh animal tissues rich in collagen. Among them, collagen tripeptide (CTP) is composed of 3 amino acids. After entering the human small intestine, it can be directly absorbed into the blood, and then transported by the blood to various organs in the human body for the synthesis of collagen needed by the human body. In addition, collagen tripeptide has been shown to have physiological functions such as stimulating the proliferation of mouse and human skin fibroblasts, promoting hyaluronic acid synthesis, and reducing water loss in mouse skin. Compared with ordinary collagen peptides, collagen tripeptide is absorbed quickly and has a high absorption rate. Therefore, in recent years, collagen tripeptide has become more and more popular among consumers as a high-end product among collagen peptides, and has a trend of replacing ordinary collagen peptides.

[0004] The raw materials for the production of collagen peptides and collagen tripeptides are mainly various animal processing scraps rich in collagen, such as fish skin, scales and bones, as well as skin and bones of livestock and poultry such as cattle, sheep and chickens. Because collagen contains a repeating sequence with (GXY) tripeptide as a unit, collagenase that can cut the collagen sequence to produce (GXY) tripeptide is the key enzyme for the production of collagen tripeptides. So far, only a few proteases have been used for commercial preparation of collagen peptides, mainly including alkaline protease of the S8 family, trypsin and α-chymotrypsin of the S1 family, pepsin of the A1 family, and papain of the C1 family. The above-mentioned few proteases are relatively expensive and effective, so it is necessary to continue to develop new collagenases to reduce costs and improve production efficiency. Summary of the invention

[0005] In order to solve the above technical problems, the inventors screened out an S8 family serine protease Almanase from the marine Alteromonas sp., achieved efficient secretory expression in the Pichia pastoris host, and obtained Almanase with high enzyme activity by fermentation; Almanase was compounded with commercially available proteases for the preparation of tilapia skin collagen tripeptides, which could significantly increase the oligopeptide ratio and tripeptide content.

[0006] The first aspect of the present invention provides a marine collagenase Almanase, whose amino acid sequence is shown as SEQ ID NO:1.

[0007] Furthermore, the coding sequence of the marine collagenase Almanase is shown as SEQ ID NO:2.

[0008] The second aspect of the present invention provides a recombinant plasmid, wherein the recombinant plasmid contains the coding sequence of the marine collagenase Almanase, and the coding sequence of the marine collagenase Almanase is shown in SEQ ID NO:2.

[0009] The third aspect of the present invention provides a strain for producing marine collagenase Almanase, wherein the chromosome of the strain contains an expression frame of the marine collagenase Almanase.

[0010] Furthermore, the strain is Pichia pastoris.

[0011] The fourth aspect of the present invention provides the use of the marine collagenase Almanase in the enzymatic hydrolysis of fish skin to prepare collagen tripeptides.

[0012] Furthermore, the fish skin is tilapia skin.

[0013] The fifth aspect of the present invention provides a method for preparing fish skin collagen tripeptide, comprising: pre-treating fish skin, adding water to the pre-treated fish skin, first using alkaline protease to enzymatically hydrolyze the fish skin for a certain time, then adding neutral protease and marine collagenase Almanase to enzymatically hydrolyze for a certain time, heating the enzyme to inactivate, then removing impurities, filtering and drying to obtain peptide powder rich in fish skin collagen tripeptide.

[0014] Furthermore, the alkaline protease is alkaline protease Alcalase, and the neutral protease is Bacillus amyloliquefaciens neutral protease.

[0015] Furthermore, the pretreatment includes cleaning, degreasing and deashing.

[0016] Furthermore, the process parameters of alkaline protease enzymolysis of fish skin are as follows: pH is 10.0-11.0, enzymolysis temperature is 40-60° C.; the amount of alkaline protease used per gram of fish skin is 2000-6000 U / g, and the enzymolysis time is 1-4 hours.

[0017] Furthermore, the process parameters of enzymolysis of the neutral protease and the marine collagenase Almanase are: pH 8.0-9.0, enzymolysis temperature 40-60° C., the amount of neutral protease per gram of fish skin is 1000-3000 U / g, the amount of marine collagenase Almanase per gram of fish skin is 1000-3000 U / g, and the enzymolysis time is 1-4 h.

[0018] Furthermore, the impurity removal is to add activated carbon for decolorization and deodorization, and the drying is spray drying.

[0019] Compared with the prior art, the beneficial effects of the present invention include at least:

[0020] 1. The present invention screened out a marine collagenase Almanase derived from the ocean, which can specifically and efficiently cleave the collagen sequence to produce GXY tripeptide, which is the first discovery.

[0021] 2. The present invention obtains a Pichia pastoris strain capable of efficiently producing highly active marine collagenase Almanase through the construction of plasmids and strains.

[0022] 3. The marine collagenase Almanase of the present invention is compounded with commercially available alkaline protease Alcalase and Bacillus amyloliquefaciens neutral protease to produce tilapia skin collagen tripeptides. In the obtained enzymatic hydrolysate, the proportion of oligopeptides with a molecular weight of <500 Da is increased by 23%, and the content of the tripeptide is increased by 2.03 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The wet weight and enzyme activity curve of Pichia pastoris ST502 in a 30L reactor;

[0024] Figure 2 The liquid chromatogram of the molecular weight of peptides in the mixture of enzymatically hydrolyzed tilapia skin;

[0025] Figure 3 Chromatogram showing the detection of tripeptide content in the enzymatic hydrolysis mixture of tilapia skin. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and beneficial effects of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the present invention are only exemplary descriptions of the specific embodiments of the present invention, and are intended to be used to explain the present invention, but do not constitute a limitation of the present invention.

[0027] The endpoints of ranges and any values ​​disclosed herein are not limited to the exact range or value, and these ranges or values ​​should be understood to include approximations to these ranges.

[0028] The formula of the culture medium involved in the embodiments of the present invention is as follows, % refers to mass percentage:

[0029] LB liquid medium: 1% tryptone, 0.5% yeast powder, 0.5% NaCl.

[0030] LB solid medium: 1% tryptone, 0.5% yeast powder, 0.5% NaCl, and 1.5% agar.

[0031] YPD liquid medium: 1% yeast extract, 2% peptone, 2% glucose.

[0032] YPD solid medium: 1% yeast extract, 2% peptone, 2% glucose, 1.5% agar.

[0033] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, (4×10-5)% biotin, 1% glycerol;

[0034] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10-5 biotin, and 0.5% methanol.

[0035] 10×YNB: 34 g YNB (without ammonium sulfate and amino acids), 100 g ammonium sulfate, dissolved in water, fixed to 1 L, filtered, and stored at 4°C.

[0036] 500× Biotin: Dissolve 20 mg of biotin in water, dilute to 100 mL, filter, and store at 4°C.

[0037] PTM1: Copper sulfate pentahydrate 6g / L, potassium iodide 0.088g / L, manganese sulfate monohydrate 3.0g / L, sodium molybdate dihydrate 0.2g / L, boric acid 0.02g / L, cobalt chloride hexahydrate 0.5g / L, zinc chloride 20.0g / L, ferrous sulfate 65.0g / L, biotin 0.2g / L, concentrated sulfuric acid 5.0ml / L.

[0038] Example 1 Cloning of collagenase gene almanase

[0039] The amino acid sequence of the S8 family serine protease Almanase from the marine Alteromonas sp. is shown in SEQ ID NO: 1. The nucleotide sequence of the almanase gene was optimized and synthesized by Beijing Liuhe BGI Gene Technology Co., Ltd., as shown in SEQ ID NO: 2. The shuttle integration plasmid pST501 (Paox1.a-factor SS.zeoR) was used as a vector to construct the recombinant plasmid pST502 (pST501-almanase) by enzyme-free cloning.

[0040] Using the synthesized gene fragment as a template, the gene almanase fragment was amplified using primers 502.alm-F and primer 502.alm-Rv and gel recovered.

[0041] 502.alm-F:ggggtatctctcgagaaaagagaggctgaagcaatgaagaccaagccattcaagac (SEQ ID NO: 3)

[0042] 502.alm-Rv:ctattcagatcctcttctgagatgagtttttgtttacaaggaaacagaaactggag (SEQ ID NO: 4).

[0043] The vector pST501 was digested with restriction endonucleases SphI / XbaI, reacted at 37° for 2h, and the double-cut vector pST501 was recovered by gel. Cloning was performed according to the TaKaRa In-Fusion kit operating instructions, with a molar ratio of vector to fragment in a 10μL reaction system of 1:5, a temperature of 50°C, and a reaction time of 30min; the entire reaction solution was transformed into 100μL competent E. coli, coated on an LB plate containing 100μg / ml ampicillin, and cultured at 37°C for 12h.

[0044] The transformants were sent to a sequencing company, and the plasmid with the correct sequence was named pST502.

[0045] Example 2 Construction of recombinant bacteria Pichia pastoris ST502

[0046] 1. Preparation of competent cells of Pichia pastoris: Streak and activate host bacteria X-33 on YPD solid plates and culture at 30℃ for 48h. Pick a single colony into 5mL YPD liquid medium and culture overnight at 30℃ and 220r / min. Take 2mL of culture solution and transfer it to 50mL YPD liquid medium and culture at 30℃ and 220r / min for 6-7h until OD600 is ~ 1.5. Ice bath for 10min, 4℃, 9000r / min, 2min, centrifuge to collect the cells. Resuspend the cells with sterile water, 9000r / min, 2min, centrifuge to collect the cells. Repeat the above steps. Resuspend the cells with 1M sorbitol solution, 9000r / min, 2min, centrifuge to collect the cells. Finally, resuspend the cells with 5mL 1M sorbitol solution, 100μL per tube, which is the electroporation competent cells.

[0047] 2. The recombinant plasmid pST502 was linearized by digestion with restriction endonuclease SacI.

[0048] 3. Take 5μg of linearized DNA and mix it with 100μL competent cells, put it in an ice bath for 5min, transfer it to a 2mm electroporation cup for click transformation, quickly add 1mL of 1M sorbitol solution to the electroporation cup, mix it, and transfer all the bacterial liquid to a 2mL centrifuge tube, and let it recover at 30℃ for 30min. At room temperature, centrifuge to collect the bacteria, resuspend the bacteria in 1mL YPD liquid culture medium, and culture it at 30℃, 220r / min for 1h, spread it on a YPD solid plate containing 100μg / mL bleomycin, and culture it at 30℃ for 72h.

[0049] 4. Prepare a sterile 48-well plate with 1 mL of glycerol liquid culture medium in each well. Pick up large transformants from the transformation plate and place them in a 48-well plate. Each transformant is placed in 3 wells for parallel fermentation. High-speed shaking shaker, 30°C, 500r / min for 72 hours. At 24h and 48h, methanol induction promoter Paox1 is added to each well culture medium at a final concentration of 2% to start gene expression. Centrifuge the supernatant on the well plate for 72h and determine the extracellular collagenase activity by microassay.

[0050] 5. The transformants with high absorbance values ​​screened from the well plate were streaked and activated on YPD solid plates with a bleomycin concentration of 100 μg / mL. Single colonies were picked into 20 mL glycerol liquid culture medium and cultured at 30°C, 220 r / min for 72 hours. At 24 hours and 48 hours, methanol with a final concentration of 2% was added to the culture medium to induce the promoter Paox1 to start gene expression. The supernatant was collected by centrifugation and the extracellular collagenase activity was determined.

[0051] Collagenase activity unit: Using type I insoluble collagen from bovine Achilles tendon as substrate, the amount of enzyme required to degrade the substrate to produce 1 μmol of leucine per hour at 37°C and in the enzyme's optimal pH buffer is 1 activity unit, i.e. 1U (unit).

[0052] The collagenase activity in the shake flask supernatant was measured using type I insoluble collagen from bovine Achilles tendon as a substrate. The highest activity measured was 5879.62 U / mL. The corresponding strain was named Pichia pastoris ST502, and the production titer of the strain was evaluated in a 30L reactor.

[0053] Example 3 30 L small tank fermentation of recombinant bacteria Pichia pastoris ST502

[0054] Pichia pastoris ST502 was streaked and activated on a YPD solid plate with a levomycin concentration of 100 μg / mL, cultured at 30°C for 72 hours, and 5-6 single colonies were picked and inoculated into 50mL of a first-level seed YPD liquid culture medium, cultured at 30°C, 220r / min for 24 hours. Then 10% of the inoculum was inoculated into 450mL of a second-level seed culture medium, cultured at 30°C, 220r / min for 24 hours, and all were connected to a 30L tank. The 30L tank was pre-filled with 80% of the volume of the culture medium, and the culture medium formula used for fermentation was: calcium sulfate 0.93g / L, potassium sulfate 18.2g / L, magnesium sulfate heptahydrate 14.9g / L, potassium hydroxide 4.13g / L, phosphoric acid 36g / L, ammonia 26.6g / L, glucose 20g / L, PTM1 4.4ml / L, defoamer 0.3ml / L.

[0055] Fermentation conditions: temperature 30℃, stirring rate 400r / min, ventilation volume 1.8-2.0m3 / h, dissolved oxygen controlled at 20%-50%, ammonia water and 0.5mol / L phosphoric acid were automatically added during the fermentation process to maintain the pH value of the fermentation liquid at 4.5-5.0. Samples were taken every 12 hours, the bacterial morphology was observed under a microscope, and the wet weight of the bacterial cell and the enzyme activity were determined. The results are as follows: Figure 1 shown.

[0056] The results showed that after 168 hours of fermentation, the collagenase activity in the fermentation broth of Pichia pastoris ST502 was 49027.43 U / mL using bovine type I insoluble collagen as substrate, achieving a good production effect.

[0057] Example 4 Preparation of collagen tripeptide by enzymatic hydrolysis of tilapia skin using marine collagenase Almanase

[0058] (1) Cleaning: Soak the tilapia skin in clean water for 2 h, then rinse with running water to remove excess water.

[0059] (2) Degreasing: Add 0.05 M NaOH solution, soak for 16 h, and wash with water until neutral.

[0060] (3) Ash removal: Add to 0.3M hydrochloric acid, stir and soak for 5 hours, and wash with water until neutral.

[0061] (4) Enzymatic hydrolysis: add purified water to the tilapia skin obtained in step (3) at a ratio of skin: water = 1:3 (weight: volume), heat the resulting solution to 50°C, and adjust the pH to 10.0-11.0 with calcium hydroxide. Add alkaline protease Alcalase (4000U / g), maintain the temperature at 50°C, stir at 50r / min, and perform enzymatic hydrolysis for 2h; adjust the pH to 8.0-9.0, add a composite enzyme of amylolytic neutral protease (2000U / g) and collagenase Almanase (2000U / g) at a ratio of 1:1, maintain the temperature at 50°C, stir at 50r / min, and perform enzymatic hydrolysis for 2h.

[0062] (5) Inactivation of enzyme: The enzymatic hydrolyzate obtained in step (4) was heated to 85°C and maintained for 30 min to inactivate the enzyme.

[0063] (6) Decolorization and deodorization: After the temperature of the enzymatic hydrolyzate obtained in step (5) is lowered to 75°C-80°C, the pH is adjusted to 5.5 with phosphoric acid, and activated carbon is added in an amount of 2%, stirred for 40 minutes, and finally the pH is adjusted to 6.0-7.0.

[0064] (7) Filtration: Filter the enzymatic hydrolyzate obtained in step (6) to remove activated carbon and residue.

[0065] (8) Spray drying: spray drying the clarified enzymatic hydrolyzate obtained in step (7) to obtain peptide powder rich in tilapia skin collagen tripeptide.

[0066] The distribution of peptides in peptide powder was detected by liquid chromatography. Figure 2 As shown in Table 1. In the product of Alcalase hydrolysis for 4 hours, the proportion of peptides with a molecular weight of <1000Da was 89.13%, and the proportion of peptides with a molecular weight of <500Da was 62.29%. In the product after Almanase complex hydrolysis, the proportion of peptides with a molecular weight of <1000Da increased to 95.81%, and the proportion of peptides with a molecular weight of <500Da was 76.64%, an increase of 7.5% and 23.0% respectively.

[0067] Table 1 Proportion of peptides with different molecular weights in the hydrolysate

[0068]

[0069] At the same time, the collagen tripeptide content was determined using GPH (Gly-Pro-Hyp) as the standard. The results are as follows Figure 3 As shown in Table 2. The content of collagen tripeptide was improved from 15.11% to 30.66%, an increase of 2.03 times, which is of great significance for further improving the enzymatic preparation efficiency and industrial application of tilapia skin collagen tripeptide.

[0070] Table 2 Content of collagen tripeptide in enzymatic hydrolysate

[0071]

[0072]

[0073] The sequence of the present invention

[0074] Almanase amino acid sequence (SEQ ID NO: 1)

[0075] MKTKPFKTGLSALSLALLPLMVSSHAHAAKAEIFDDSVIVVYKENVSKAEKMRARSSVGARISDVNRDEVDDRFSNLLNGRIAKLELRGKSVKDAIEILKKNPAVKIAEPNFLYRKALVPNDPSYGDLWGLNNTGQAGGTADVDIDAPEAWDITTGDSDVVIGVIDTGVDYNHEDLAANAWINPGEIAGNGIDDDGNGYIDDVYGIDAFNGDSDPMDDDSHGTHVAGTIGAVGGNGIGVVGVNHEVSIAACKFLGPDGGSTAGAIECIDYFTDLKQNRGINIKATNNSWGGGGYSEALETAIEVAGQAGILFVAAAGNSGSNNDNVDNYPSNYTTTTNSLMAVASHTRTDGDSGYSYGIETVDIAAPGSSILSTVPGNGYATYSGTSMATPHVVGAAALVWSLNPELTPSEMKELLMATGETSLWAEGRTVSGNRLNVLNALEEADPTPGFKLGITPGSAEIEAGETYTFTIEVGSIAGYEEEVQLSLAEPSDIASLSASTALPGDTVTLTVETTEDTPWGSYSFTVNGVSGEIEKSKSANLYVYPQGLNEFPYAYSGDPVPTLPNEEDPDDVGVDLVINIPDELTVFGMQASVDITHTYSGDLVLSLTSPQGTTTVLRQNQGGGTDDIVESYNTAAFNGEVATGDWTLNVLDTFNGDNGTVNTWSLVVTGIGEVGPTPPNSAFTYDASGLSVSFTNNSNDVNDDIVSYSWDFGDGSSSTEENPTHVYPSTGAYDVTLTVTDSEGQTGVSTQTVSVSDSNIVAEIDRALLSRFGSLRVDLSYSGSMADTVMIYRNGELLEEVSNTGRYRDRSRGVQPGVYTYMVCDETSACSAPVSVSL

[0076] Almanase nucleotide sequence (SEQ ID NO:2):

[0077]

[0078] 502.alm-F (SEQ ID NO: 3):

[0079] ggggtatctctcgagaaaagagaggctgaagcaatgaagaccaagccattcaagac

[0080] 502.alm-Rv (SEQ ID NO: 4):

[0081] ctattcagatcctcttctgagatgagtttttgtttacaaggaaacagaaactggag

[0082] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention and do not constitute a limitation on the content of the present invention. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A marine collagenase Almanase, characterized in that Its amino acid sequence is shown as SEQ ID NO: 1, or the coding sequence of the marine collagenase Almanase is shown as SEQ ID NO:

2.

2. A strain producing marine collagenase Almanase, characterized in that: The chromosome of the strain contains the expression cassette of the marine collagenase Almanase according to claim 1.

3. A strain for producing marine collagenase Almanase as claimed in claim 2, characterized in that: The strain is Pichia pastoris.

4. Use of the marine collagenase Almanase according to claim 1 in the preparation of collagen tripeptides by enzymatic hydrolysis of fish skin.

5. The use according to claim 4, characterized in that The fish skin is tilapia skin.

6. A method for preparing fish skin collagen tripeptide, characterized in that: include: The fish skin is pretreated, water is added to the pretreated fish skin, alkaline protease is used to enzymolyze the fish skin for a certain time, neutral protease and the marine collagenase Almanase described in claim 1 are added to enzymolyze for a certain time, the enzyme is inactivated by heating, impurities are removed, filtered and dried to obtain peptide powder rich in fish skin collagen tripeptide; the alkaline protease is alkaline protease Alcalase, the neutral protease is Bacillus amyloliquefaciens neutral protease, and the fish skin is tilapia skin.

7. A method for preparing fish skin collagen tripeptide according to claim 6, characterized in that: The pretreatment includes cleaning, degreasing and deashing.

8. The method for preparing fish skin collagen tripeptide according to claim 6, characterized in that: The process parameters of alkaline protease enzymolysis of fish skin are as follows: pH is 10.0-11.0, enzymolysis temperature is 40-60° C., the amount of alkaline protease used per gram of fish skin is 2000-6000 U / g, and the enzymolysis time is 1-4 hours.

9. A method for preparing fish skin collagen tripeptide according to claim 6, characterized in that: The process parameters of enzymolysis of the neutral protease and the marine collagenase Almanase are as follows: pH is 8.0-9.0, enzymolysis temperature is 40-60°C, the amount of the neutral protease per gram of fish skin is 1000-3000U / g, the amount of the marine collagenase Almanase per gram of fish skin is 1000-3000U / g, and the enzymolysis time is 1-4h.

10. A method for preparing fish skin collagen tripeptide according to claim 6, characterized in that: The impurity removal is to add activated carbon for decolorization and deodorization, and the drying is spray drying.

Images