Preparation and application of a CD56 protein-specific nanobody-HRP fusion protein

By genetically engineering the CD56 protein-specific nanoantibody-HRP fusion protein, a single molecular hybridization was achieved, which solved the time-consuming and cumbersome operation problems of traditional enzyme-linked immunosorbent assay, improved the accuracy of the test and simplified the operation process, and has broad prospects for marketization and clinical application.

CN118852433BActive Publication Date: 2025-09-16SHANDONG LIFEI BIOLOGICAL IND CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410746419.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-11
Publication Date
2025-09-16
Estimated Expiration
2044-06-11

AI Technical Summary

Technical Problem

Traditional enzyme-linked immunosorbent assay (ELISA) methods are time-consuming, cumbersome to operate, require high equipment, are costly, and are prone to contamination, and therefore cannot meet market demand.

Method used

Through genetic engineering, a CD56 protein-specific nanoantibody-HRP fusion protein was constructed to achieve one-time molecular hybridization and simplify the operation process. The CD56 protein-specific nanoantibody was screened using phage display technology and combined with the HEK293 cell expression system to prepare it for ELISA detection.

Benefits of technology

It greatly shortens the enzyme-linked immunosorbent assay (ELISA) time, improves detection accuracy, and simplifies the operating procedures, and has broad prospects for market and clinical application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118852433B_ABST
    Figure CN118852433B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biotechnology, and in particular to the preparation and application of a CD56 protein-specific nanoantibody-HRP fusion protein. The present application discloses a CD56 protein-specific nanoantibody-HRP fusion protein and a preparation method thereof, as well as the application of the fusion protein in preparing a product for detecting CD56 protein-specific antibodies in serum. The HRP-fused nanoantibody prepared in the present application constructs a fusion protein of a primary antibody and a labeled HRP through genetic engineering, converting two molecular hybridizations into one molecular hybridization, which can greatly shorten the duration of enzyme-linked immunosorbent assay and improve the accuracy. Compared with traditional antibodies, nanoantibodies are easier to genetically manipulate and can be coupled with a variety of labeled enzymes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the preparation and application of a CD56 protein-specific nanobody-HRP fusion protein. Background Art

[0002] CD56 (NACM1) is a neural cell adhesion molecule and a transmembrane protein primarily found in most neuroectodermal cells, tissues, and tumors. It is widely used in the study of tumors such as retinoblastoma, medulloblastoma, astrocytoma, and neuroblastoma, and in the identification of natural killer (NK) cells. In clinical pathology, it is often used as an immunological marker to assist in the diagnosis of NK / T cell lymphoma and myeloma. Currently, it is widely used in the diagnosis and differential diagnosis of small cell carcinoma, lung cancer, thyroid tumors, prostate cancer, non-Hodgkin's malignant lymphoma, hematopoietic diseases, and in anti-tumor research.

[0003] Nanobodies are a new type of antibody characterized by low molecular weight, excellent stability, strong solubility, excellent antigen-binding properties, and low immunogenicity. Compared to conventional antibodies, nanobodies have a smaller molecular weight, simpler structure, and are amenable to genetic modification. They are compact, have excellent antigen specificity, strong tissue penetration, and are highly stable. Nanobodies possess strong and rapid penetration, enabling them to penetrate solid tumors and exert their effects. Furthermore, their ability to cross the blood-brain barrier offers a new approach for brain drug delivery, holding broad application prospects in disease diagnosis and treatment.

[0004] Traditional enzyme-linked immunosorbent assay (ELISA) involves two molecular hybridizations, which takes a long time in practical applications such as clinical testing, increases the labor intensity of operators, and traditional detection methods have problems such as cumbersome operation, high equipment requirements, high cost, and easy contamination, which cannot meet market demand.

[0005] Therefore, how to effectively shorten the duration of enzyme-linked immunosorbent assay and improve its accuracy has become an urgent problem to be solved. Summary of the Invention

[0006] To address the challenges of traditional detection methods, such as long detection times, cumbersome procedures, high equipment requirements, high costs, and contamination, this application provides the preparation and application of a CD56-specific nanobody-HRP fusion protein. The HRP-fused nanobody prepared in this application utilizes genetic engineering to construct a fusion protein of a primary antibody and labeled HRP, reducing two molecular hybridizations to a single one. This significantly shortens enzyme-linked immunosorbent assay (ELISA) time and improves accuracy. Compared to traditional antibodies, nanobodies are easier to genetically manipulate and can be coupled to a variety of labeled enzymes.

[0007] To achieve the above objectives, this application provides the following solutions:

[0008] The present application provides a CD56 protein-specific nanobody, the amino acid sequence of which is shown in SEQ ID No: 2.

[0009] The present application also provides a nucleic acid molecule encoding a CD56 protein-specific nanobody, the nucleotide sequence of which is shown in SEQ ID No: 1.

[0010] The present application also provides a method for preparing a CD56 protein-specific nanobody, the steps of which are as follows:

[0011] (1) Select the CD56 sequence, construct the PCDNA3.1(+) expression vector, and transfect the expression vector into host cells to induce the expression of CD56 protein;

[0012] (2) Mix CD56 protein with adjuvant and inject it into alpacas for immunization, with four consecutive injections, each with an interval of 21 days;

[0013] (3) One week after the fourth immunization, peripheral blood was collected to isolate lymphocytes and construct a nanobody gene library;

[0014] (4) Phage display technology was used to eliminate non-binding phages, and CD56 protein-specific nanoantibodies were obtained by screening and sequencing.

[0015] Preferably, the host cell in step (1) is HEK293 cell.

[0016] The present application also provides a CD56 protein-specific nanobody-HRP fusion protein, wherein the fusion protein is composed of a CD56 protein-specific nanobody and HRP in series.

[0017] The present application also provides a method for preparing a CD56 protein-specific nanobody-HRP fusion protein, the steps of which are as follows:

[0018] (1) Using double enzyme, the sequence of CD56 protein-specific nanobody was connected to the HRP vector to obtain a positive plasmid;

[0019] (2) After the positive plasmid in step (1) is transfected into the host cells, the CD56 protein-specific nanobody and HRP fusion protein are expressed.

[0020] Preferably, the host cell in step (2) is HEK293 cell.

[0021] The present application also provides a detection reagent, which includes a CD56 protein-specific nanobody-HRP fusion protein, or a fusion protein prepared using the above method.

[0022] The present application also provides a detection kit, which includes a CD56 protein-specific nanobody-HRP fusion protein, or a fusion protein prepared by the above method.

[0023] The present application also provides a use of the CD56 protein-specific nanobody-HRP fusion protein in the preparation of a product for detecting CD56 protein-specific antibodies in serum.

[0024] Preferably, the detection method comprises the following steps:

[0025] (1) coating the ELISA plate with CD56 protein to obtain an ELISA plate coated with CD56 protein;

[0026] (2) incubating the serum sample to be tested with the ELISA plate coated with CD56 protein in step (1);

[0027] (3) adding the CD56 protein-specific nanobody-HRP fusion protein to the ELISA plate in step (2) and incubating;

[0028] (4) Rinse the ELISA plate after the reaction in step (3) with a washing buffer, add a color developing solution and react in the dark, terminate the reaction with 2M sulfuric acid and observe the color. If the sample to be tested contains CD56 protein-specific antibodies, the reaction well will be light yellow or colorless; if the sample to be tested does not contain CD56 protein-specific antibodies, the reaction well will be darker yellow.

[0029] In the present application, a fusion protein of a primary antibody (monoclonal antibody) and a labeling enzyme such as horseradish peroxidase (HRP) is constructed through genetic engineering, and two molecular hybridizations are converted into one molecular hybridization, which can greatly shorten the time of enzyme-linked immunosorbent assay.

[0030] The CD56 protein-specific nanobody-HRP fusion protein prepared in this application has extremely high homology with human antibody genes, weak immunogenicity to the human body, good compatibility, and a small amount of humanization can achieve extremely low rejection, greatly reducing the difficulty of humanization of antibody drugs at the molecular level.

[0031] This application utilizes phage display technology to screen CD56 protein-specific nanobodies and successfully expresses a CD56-specific nanobody-HRP fusion protein in HEK293 cells. The HEK293 expression system facilitates large-scale, low-cost production of this enzyme-labeled nanobody. Using this enzyme-labeled nanobody as a sensitive probe, an ELISA for detecting CD56 serum antibodies was established. Compared to traditional ELISAs, this ELISA offers advantages such as simple operation and accurate results, and has broad prospects for market and clinical application.

[0032] In a specific embodiment, a method for preparing a CD56 protein-specific nanobody-HRP fusion protein comprises the following steps:

[0033] 1. Preparation of CD56 antigen;

[0034] 1. Select the CD56 sequence and construct the PCDNA3.1(+) mammalian cell expression vector;

[0035] 2. HEK293 cell gene transfection, expression, and antigen purification;

[0036] 3. Immune antigen quality analysis, ELISA, SDS;

[0037] 2. Construction of Nanobody Immune Antibody Gene Library;

[0038] 1. Immunize alpacas with CD56 antigen;

[0039] 2. ELISA titer evaluation;

[0040] 3. Extract total RNA from peripheral lymphocytes and reverse transcribe cDNA;

[0041] 4. Storage capacity determination;

[0042] 3. Phage display panning of nanoantibody genes;

[0043] 1. Phage display and panning;

[0044] 2. Phage ELISA screening;

[0045] 3. Gene sequencing to obtain the target sequence;

[0046] 4. Construction of CD56-specific nanobody-HRP fusion protein;

[0047] 1. Synthesize HRP gene sequence;

[0048] 2. Construct HRP-PCDNA3.1 universal vector and load the anti-CD56 VHH sequence;

[0049] 3. HEK293 cell gene transfection, expression, purification, SDS;

[0050] 5. Application of recombinant antibodies

[0051] Comparison of experimental procedures between ELISA and commercially available kits.

[0052] In summary, this application includes at least one of the following beneficial technical effects:

[0053] This application uses phage display technology to screen CD56 protein-specific nanoantibodies, and successfully expresses CD56-specific nanoantibody-HRP fusion protein using HEK293 cells; the CD56-specific nanoantibody-HRP fusion protein is used to establish an ELISA for detecting CD56 serum antibodies; compared with traditional ELISA detection methods, this ELISA has the advantages of simple operation and accurate results, and has broad market and clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 Construct vectors for CD56 molecular cloning;

[0055] Figure 2 The SDS electrophoresis results of CD56 protein;

[0056] Figure 3 This is a schematic diagram of the antibody titer in the serum of alpacas after four immunizations. Figure 3 A is the immune titer of three alpacas after the fourth immunization. Figure 3 B is the P / N value of the immune titer of 3 alpacas;

[0057] Figure 4 Schematic diagram of SDS electrophoresis results of VHH genes in the peripheral lymphocyte antibody library;

[0058] Figure 5 Schematic diagram of the colony of the nanobody gene library;

[0059] Figure 6 This is a schematic diagram of the nanobody gene phage ELISA results;

[0060] Figure 7 This is a schematic diagram of the construction of the HRP-PCDNA3.1(+) vector, wherein: Figure 7 A shows that the HRP target gene is 900 bp and the HRP-PCDNA3.1(+) vector is constructed, and the new HRP-PCDNA3.1(+) vector is obtained; Figure 7 B is the nucleic acid electrophoresis showing that the clone C10 nanobody gene has been completely loaded into the newly constructed HRP-PCDNA3.1(+) vector;

[0061] Figure 8 Schematic diagram of SDS results of HRP nanobody expression. DETAILED DESCRIPTION

[0062] The technical solution of the present application is further illustrated below through specific embodiments. The specific embodiments do not limit the scope of protection of the present application; some non-essential modifications and adjustments made by others based on the concept of the present application still fall within the scope of protection of the present application.

[0063] The raw materials involved in this application are all commercially available products, among which:

[0064] Serum-free culture medium was purchased from Biogen, Hyber-B1001L / bottle.

[0065] The formula of 2×YT-AG medium is: tryptone 16 g / L, yeast extract 10 g / L, sodium chloride 5 g / L and agar powder 15 g / L.

[0066] HRP-labeled secondary antibodies were purchased from Beijing Solebow Technology Co., Ltd. SE131;

[0067] HRP-labeled mouse anti-M13 secondary antibody was purchased from Abcam ab235228;

[0068] In this embodiment, a camel peripheral blood lymphocyte separation solution kit was used for lymphocyte separation. The camel peripheral blood lymphocyte separation solution kit was purchased from Bangjing, BJ-S0199;

[0069] The present application is further described in detail below with reference to the following examples and comparative examples.

[0070] Example 1: Preparation of CD56 recombinant protein

[0071] 1. Molecular cloning

[0072] 1.1. The CD56 gene (gene accession number: NM_001076682.3) was synthesized by Gene Corporation. The sequence is shown in SEQ ID No: 3:

[0073] 1.2. Use homologous recombination to seamlessly clone into the PCDNA3.1(+) vector and transform into TOP10 competent cells.

[0074] 2. Expression of CD56 recombinant protein

[0075] Positive clones with good growth were selected and inoculated into LB-AG medium and cultured overnight at 37°C and 200 rpm. After plasmid extraction, HEK293 cells were transfected and serum-free medium was added to the cells and the cells were expressed on a shaker for 5 days. The cells were centrifuged at 10,000 rpm and 4°C for 10 min, and the supernatant was collected.

[0076] 3. Purification of CD56 recombinant protein

[0077] The Ni chromatography column was first washed with ultrapure water to remove ethanol, and then washed with equilibration buffer (20mM phosphate buffer, 150mM NaCl, pH 7.4-8.5) to equilibrate the Ni column, and then the sample was loaded onto the column at a flow rate of 0.5mL / min; after washing the column with the equilibration buffer, elution buffer (0.25M imidazole, pH7.4) was added to elute and collect the protein; after equilibration of the Ni column to neutrality with the equilibration buffer, the Ni column was washed with 1M NaCl, pure water, and 20% ethanol by volume, and the Ni column was stored at 4-8°C; the protein purified by Ni affinity chromatography was further purified again by dialysis tape and dialyzed with PBS at 4°C to remove imidazole ions.

[0078] 4. SDS electrophoresis

[0079] Prepare a separation gel with a mass concentration of 5% and a stacking gel with a mass concentration of 15%. After loading the protein, perform electrophoresis at a constant voltage of 200 V. Stop the electrophoresis when the bromophenol blue reaches 1 cm from the bottom edge of the separation gel. Remove the film and place it in Coomassie brilliant blue staining solution for 30 minutes. Finally, decolorize it with a decolorizing solution 2-3 times until the background is colorless.

[0080] 5. Results Analysis

[0081] 5.1 Conversion Results

[0082] according to Figure 1 It shows that the vector was constructed by CD56 molecular cloning, the target band of the empty vector (5428bp), the target fragment band (1809bp), and the constructed vector band (7237bp) are of correct size, and the expression vector was successfully constructed.

[0083] 5.2 SDS electrophoresis results

[0084] according to Figure 2 The results showed that the molecular weight of recombinant human CD56 (NCAM1) protein was about 75KD. Due to the glycosylation, the protein molecular weight was greater than the predicted protein molecular weight. The purity was above 95%, which met the requirements of immunology.

[0085] Example 2: Construction of Nanobody Immune Antibody Gene Library

[0086] 1. Alpaca immunization: 0.3 mg of CD56 protein was mixed with 300 μL of the new immune adjuvant squalene and injected subcutaneously at the back of the neck. Each immunization was 0.3 mg of CD56 protein (the emulsified volume of the antigen was fixed at 2 mL, injected at 4 points, 500 μL / point), with an interval of 21 days between each immunization, for a total of four immunizations.

[0087] 2. Potency testing

[0088] One week after the fourth immunization, alpaca blood was collected to detect the antibody titer in the serum; first, 10 μg / mL LCD56 protein was used to coat a 96-well ELISA plate at 4°C for 24 hours, followed by blocking with 1% BSA at 37°C for 1 hour, then adding a sample diluted at a ratio of 1:3000 and incubating at 37°C for 1 hour, followed by adding HRP-labeled secondary antibody and incubating at 37°C for 1 hour, then adding TMB substrate solution, reacting at room temperature in the dark for 15 minutes, and finally terminating the reaction with 2M sulfuric acid, and reading the OD value at 450nm. The highest dilution factor with a P / N ≥ 2.1 was used as the serum titer; the results are shown in Figure 3 .

[0089] 3. Lymphocyte separation

[0090] Collect 20 mL of peripheral blood from immunized alpacas and add an equal amount of sample diluent to mix; add 5 mL of lymphocyte separation solution and 5 mL of the above sample to each of 8 15 mL centrifuge tubes, centrifuge at 3500 g for 20 min, and then take the second layer of circular milky white lymphocytes into a new 15 mL centrifuge tube; add 10 mL of washing solution and mix, centrifuge at 250 g for 10 min, and discard the supernatant; resuspend the cells, centrifuge at 250 g for 10 min, discard the supernatant, resuspend the cells again, centrifuge at 250 g for 10 min, discard the supernatant, and count under a microscope; according to the number of cells per 2.5 × 10 7 Add the corresponding reagent in the ratio of 1 mL of Tipure Isolation Reagent to 1 cell, take 1 mL for RNA extraction, and store the rest at -80℃.

[0091] 4. RNA extraction and reverse transcription synthesis of cDNA

[0092] Total RNA was extracted according to the operating procedures of the Thermo Fisher Scientific RNA extraction kit; the obtained total RNA was used as a template and reverse transcribed into cDNA according to the instructions of the Thermo Fisher Scientific reverse transcription kit.

[0093] 5. Amplification of Nanobody (VHH) Gene Fragments

[0094] 5.1. First round of amplification

[0095] The first round of PCR amplification was carried out using the synthesized cDNA as a template and primers CALL001 (5′-GTCCTGGCTGCTCTTCTACAAGG-3′) and CALL002 (5′-GGTACGTGCTGTTGAACTGTTCC-3′). The reaction conditions were as follows: pre-denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s → 57°C for 30 s → 72°C for 30 s, and finally maintaining at 72°C for 7 min.

[0096] Use a 2% agarose gel for electrophoresis and use a gel recovery kit to recover a band of about 400 bp, which is the first round of PCR amplification of the VHH gene; electrophoresis identification see Figure 4 .

[0097] 5.2. Second round of amplification

[0098] The second round of nested PCR amplification was performed using the VHH gene product amplified in the first PCR as a template and primers VHH-Bac [5′-GATGTGCAGCTGCAGGAGTCTGGRGGAGG-3′ (PstI)] and VHH-For [5′-CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT-3′ (BstE II)]. The reaction conditions were: pre-denaturation at 95°C for 5 min, followed by 15 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, and finally maintaining at 72°C for 7 min. Finally, the PCR product was purified using the Pure Cycle kit (OMEGA).

[0099] 6. Vector construction and electroporation

[0100] 3 μg of pMES4 phage display plasmid and 3 μg of nested PCR product were digested with restriction endonucleases Pst I-HF and BstEII-HF. The digestion products were separated by 1.5% agarose gel electrophoresis, and the approximately 5000 bp vector fragment and the approximately 400 bp VHH band were recovered using a Gel Extraction Kit (manufacturer: OMEGA) and ligated. 10 μL of the purified ligation product was added to 100 μL of TG1 competent cells, mixed well, and placed in a precooled electroporation cuvette (0.2 cm) for electrotransformation. The electroporation conditions were: 2.5 kV, 200 Ω, 2.5 u. Immediately after electrotransformation, 1 mL of 37°C preheated 2×YT culture medium was added to the cuvette, and the cells were shaken at 37°C, 200 rpm, and recovered for 1.5 h.

[0101] Table 1 pMES4 vector double enzyme digestion system

[0102] Reagents volume Pst I-HF 1.5 μL BstE II-HF 2.0 μL 10x CutSmart Buffer 5.0μL pMES4 3.0 μg Sterile water Add to 50 μL

[0103] 7. Storage capacity determination

[0104] 100 μL of the resuscitated bacterial solution was diluted 10-fold in series, and 100 μL of each dilution was spread on LB-AG solid culture plates and cultured overnight at 37°C. Twenty-four single clones were randomly selected, and positive clones were identified by colony PCR using pMES primers (pMES-F: GCCGCTGGATTGTTATTACTC; pMES-R: CTTTCAACAGTGGAACCGTAG). The reaction conditions were: pre-denaturation at 95°C for 5 min, followed by 25 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, and finally maintained at 72°C for 7 min. Electrophoresis was performed using 1.5% agar powder gel, and the reservoir capacity was calculated (reservoir capacity = number of clones × dilution factor × positive rate × 10).

[0105] 8. Results and Analysis

[0106] 8.1 Analysis of Immune Effects

[0107] Figure 3 A shows that after the fourth immunization, all three alpacas produced corresponding immune titers, among which the immune titer P / N value (OD value of immune alpacas / OD value of non-immunized alpacas) of alpaca 2 was the highest at the same dilution ( Figure 3 B), select it as the next experimental object.

[0108] 8.2 VHH gene retrieval

[0109] Figure 4 It showed that the VHH gene (400bp) of the peripheral lymphocyte antibody library was successfully retrieved.

[0110] 8.3 Antibody Library Capacity Calculation

[0111] like Figure 5 As shown in the figure, 22 single colonies were obtained on the plate after the 7th dilution. The reservoir capacity was calculated as 22*10 7 *83.3%*10≈1.8*10 9 PFU / mL, meeting the requirements for the next step of screening; (library capacity = number of clones × dilution factor × positive rate × 10).

[0112] Example 3: Phage display panning of nanoantibody genes

[0113] 1. Phage amplification

[0114] First, 500 μL of the bacterial solution recovered after electroporation in step 6 of Example 2 was inoculated into 50 mL of 2×YT-AG medium and cultured at 37°C for 3 hours; then, 10 mL of the bacterial solution was added to 4×10 10pfu VCSM13 helper phage was allowed to stand at room temperature for 30 minutes and centrifuged for 10 minutes. The centrifuged cell suspension was resuspended in 50 mL 2×YT-AK (100 μg / mL ampicillin and 50 μg / mL kanamycin) medium and cultured overnight. After another 15-minute centrifugation, the supernatant was collected and the amplified phage was precipitated with 10 mL PEG8000 / NaCl (20% / 2.5 M) solution. The precipitated phage was dissolved in PBS solution.

[0115] 2. Phage panning

[0116] The recombinant protein was diluted to 10 μg / mL with PBS, and 100 μL per well was coated on the ELISA plate and incubated at 4°C overnight. The next day, 250 μL of 5% BSA was added to each well and blocked at 37°C for 2 h. After discarding the blocking solution, 90 μL of amplified phage (10 11 cfu / well) and 10 μL 5% BSA blocking solution were added and incubated at 37°C for 2 h. After washing away unbound phage with PBST, 100 μL 0.2M Gly (pH 2.2) was added to each well and incubated at room temperature for 15 min on a horizontal shaker. The eluate was transferred to a centrifuge tube pre-added with 15 μL 1M Tris (pH 9.1) and infected with TG1 in the logarithmic growth phase to produce and purify phage for the next round of screening. The same screening steps were repeated 3-4 times.

[0117] 3. Phage ELISA screening

[0118] From the last round of phage-containing cell culture dishes, 96 clones were randomly selected and inoculated into 250 μL 2YT-AG medium, cultured at 37°C for 3 h, and 1 μL VCSM13 helper phage (10 9 pfu), incubated at 37°C for 30 min, centrifuged at 4000 rpm for 10 min, the supernatant was removed, and 1 mL of 2YT-AK medium was added to resuspend the pellet, and cultured at 37°C overnight; after centrifugation at 8000 rpm for 10 min, the supernatant was placed on an antigen-coated ELISA plate and incubated at 37°C for 1 h; unbound antibodies were washed away with PBST, and HRP-labeled mouse anti-M13 secondary antibody was added, and incubated at 37°C for 1 h; unbound antibodies were washed away with PBST, and TMB solution was added, incubated at room temperature in the dark for 15 min, 100 μL of 2M sulfuric acid stop solution was added to each well, and the plate was read at 450 nm using a microplate reader; the sample with the highest OD value was selected for sequencing.

[0119] 4. Experimental results

[0120] 4.1 Phage ELISA results

[0121] Figure 6The results of 96-well plate phage ELISA screening are shown. Among them, the C10 clone has the highest OD value, indicating that it has the highest affinity. C10 was selected for the next step of HRP fusion nanoantibody preparation.

[0122] 4.2 Gene Sequencing Results

[0123] After sequencing by a gene company, the amino acid sequence of the nanoantibody gene with clone number C10 was obtained as shown in SEQ ID No: 2; the nucleotide sequence was shown in SEQ ID No: 1: After GENBANK alignment, it belonged to the natural camel-derived single-domain heavy chain antibody variable region, namely the VHH region.

[0124] IMGT analysis is as follows

[0125] CDR1:GRAFFYSG

[0126] CDR2:INGSGSNTCDR3:SASGWYELVTAPQNYWG;

[0127] Example 4: Expression and purification of HRP-fused nanobodies

[0128] 1. Construction of HRP-PCDNA3.1(+) vector

[0129] 1.1. The sequence of the HRP gene (gene accession number: J05552.1) synthesized by Gene Corporation is shown in SEQ ID No: 4:

[0130] 1.2. Use homologous recombination to seamlessly clone into the PCDNA3.1(+) vector to obtain the constructed vector HRP-PCDNA3.1(+).

[0131] 1.3. Loading the target VHH gene: Use EcoRI and HandIII to double-digest HRP-PCDNA3.1(+), and T4 ligase to ligate the target VHH gene overnight, and transform it into TOP10 competent cells.

[0132] 2. Antibody Expression

[0133] Select well-growing positive clones and inoculate them into LB-AG medium. Culture them at 37°C and 200 rpm overnight. After extracting the plasmid, transfect HEK293 cells. Add serum-free medium and place them on a shaker for expression for 5 days. Centrifuge at 10,000 rpm and 4°C for 10 minutes, and collect the supernatant.

[0134] 3. Antibody Purification

[0135] The VHH immunoaffinity chromatography column was first washed with ultrapure water to remove ethanol, and then washed with equilibration buffer (20 mM phosphate buffer, 150 mM NaCl, pH 7.4-8.5) to equilibrate the column, and then the sample was loaded onto the column at a flow rate of 0.5 mL / min; after washing the column with the equilibration buffer, elution buffer (0.25 M imidazole, pH 7.4) was added to elute and collect the protein; the eluted and collected sample was neutralized to neutrality with neutralization buffer (1 M Tris-Cl, pH 9.0); after equilibration of the column to neutrality with the equilibration buffer, the VHH immunoaffinity chromatography column was washed with 1 M NaCl, pure water, and 20% ethanol in sequence; the column was stored at 4-8°C; the collected samples were combined, passed through a dialysis tape, and dialyzed using PBS at 4°C to remove Tris ions.

[0136] 4. SDS electrophoresis

[0137] Prepare 5% separation gel and 15% stacking gel, load the protein and perform electrophoresis at a constant voltage of 200V; stop electrophoresis when bromophenol blue reaches 1 cm from the bottom edge of the separation gel; remove the film and place it in Coomassie Brilliant Blue staining solution for 30 minutes, and finally decolorize it with decolorizing solution 2-3 times until the background is colorless.

[0138] 5. Results Analysis

[0139] 5.1. Vector Construction Results

[0140] Figure 7 A. The HRP target gene was 900 bp after nucleic acid electrophoresis, and the HRP-PCDNA3.1(+) vector was constructed to obtain the new HRP-PCDNA3.1(+) vector. Figure 7 B. Nucleic acid electrophoresis showed that the clone C10 nanobody gene was completely loaded into the newly constructed HRP-PCDNA3.1(+) vector.

[0141] 5.2 SDS results

[0142] Figure 8 Protein electrophoresis showed that the HRP-fused nanobody was successfully expressed with a purity of ≥95%.

[0143] Example 5. Establishment of ELISA detection method for CD56 protein specific nanobody-HRP fusion protein (1) Different concentrations of CD56 recombinant protein were added vertically into 96-well ELISA plates at 100 μL / well and coated overnight at 4°C. Different dilution ratios of CD56 nanobody fused to HRP cell culture supernatant were added and direct ELISA detection was performed. When OD 450 When the value is 1.0, it is determined to be the optimal CD56 protein coating concentration and CD56 nanobody fused to HRP dilution ratio.

[0144] (2) Antigen coating: Coat the plate with the optimal coating concentration of CD56 recombinant protein at 4°C overnight.

[0145] (3) Blocking: Discard the coating solution and wash three times with 200 μL / well PBST, 4 min / time; add 200 μL skim milk powder to each well and block at 37°C for 2 h.

[0146] (4) Incubation of serum: discard the blocking solution, wash three times with 200 μL / well PBST, 4 min / time; dilute human serum with PBST gradient, add 100 μL per well horizontally to a 96-well ELISA plate, and establish the optimal incubation time for serum at 37°C.

[0147] (5) Incubation of antibodies: Add the optimal dilution ratio of CD56 nanoantibody fused with HRP cell culture supernatant to the reaction wells, 100 μL / well, and establish the optimal antibody incubation time at 37°C.

[0148] (6) Color development: Wash 4 times with 200 μL / well PBST, 4 min / time; add 100 μL TMB single-component color development solution to each well vertically, and develop in the dark at 37°C to establish the optimal color development time.

[0149] (7) Stop color development: Add 2M H2SO4 stop solution to stop the reaction and set the microplate reader to read the OD 450nm The numerical value of .

[0150] The conditions for the test to be established are: the average OD of the negative control wells 450nm Value>1.04, average OD of positive control wells 450nm Value ≤ 0.334.

[0151] Calculate the blocking rate (1-S / N) of the sample to be tested, where S is the OD of the sample to be tested. 450nm N is the average OD of negative control samples. 450nm If the blocking rate is ≥39.16%, it is judged as positive; if the blocking rate is <25.56%, it is judged as negative; if the blocking rate is greater than 25.56% and less than 39.16%, it is judged as suspicious and needs to be retested.

[0152] The optimal reaction conditions for blocking CD56 fusion HRP nanoantibody ELISA were finally determined as follows: the CD56 antigen coating amount was 640 ng / well; the optimal dilution ratio of human serum was 1:80, and the optimal serum incubation time was 30 min; the optimal dilution ratio of CD56 nanoantibody fusion HRP cell supernatant was 1:40, and the optimal antibody incubation time was 1 h; the optimal TMB color development time was 15 min.

[0153] Example 6: Comparison of HRP-fused nanobody and traditional monoclonal antibody ELISA experiment

[0154] 78 clinical serum samples were tested using the ELISA method established in Example 5 and a traditional commercially available serum antibody ELISA kit.

[0155] 1. Traditional monoclonal antibody experiments:

[0156] Use a traditional commercially available CD56 detection kit and follow the kit's instructions to detect CD56 protein-specific antibodies. The steps are as follows:

[0157] (1) coating the ELISA plate with CD56 protein to obtain an ELISA plate coated with CD56 protein;

[0158] (2) incubating the serum sample to be tested with an ELISA plate coated with CD56 protein;

[0159] (3) Add CD56 monoclonal antibody to the ELISA plate prepared in step (2) and incubate for 1 h;

[0160] (4) Discard the primary antibody, dilute the commercial HRP-labeled secondary antibody as required, and incubate at 37°C for 1 h;

[0161] (5) After washing the plate with PBST, add TMB substrate solution and react at room temperature in the dark for 15 min;

[0162] (6) After stopping the reaction with 2M sulfuric acid, observe the color. If there is no CD56 protein-specific antibody in the sample to be tested, the reaction well will be dark yellow; if there is CD56 protein-specific antibody in the sample to be tested, the reaction well will be light yellow or colorless.

[0163] 2. HRP nanobody fusion experiment:

[0164] (1) Coating the ELISA plate with CD56 protein (640 ng / well) to obtain an ELISA plate coated with CD56 protein;

[0165] (2) incubating the serum sample to be tested with an ELISA plate coated with CD56 protein;

[0166] (3) Add the HRP-fused nanobody to the ELISA plate of step (2) and incubate for 1 h;

[0167] (4) After washing the plate with PBST, add TMB substrate solution and react at room temperature in the dark for 15 min;

[0168] (5) After stopping the reaction with 2M sulfuric acid, observe the color. If there is no CD56 protein-specific antibody in the sample to be tested, the reaction well will be dark yellow; if there is CD56 protein-specific antibody in the sample to be tested, the reaction well will be light yellow or colorless.

[0169] 3. Test results

[0170] Table 2 Test results

[0171]

[0172] 4. Analysis of experimental results

[0173] The ELISA test results with optimized detection conditions established by CD56 protein-specific nanoantibody-HRP fusion protein showed that among 78 serum samples, 32 were CD56 antibody-positive serum samples and 46 were CD56 antibody-negative serum samples; the test results of traditional commercially available test kits showed that among 78 serum samples, 30 were CD56 antibody-positive serum samples and 48 were CD56 antibody-negative serum samples; compared with the commercial test kit, the positive coincidence rate of CD56 protein-specific nanoantibody-HRP fusion protein was 96.67%, the negative coincidence rate was 93.75%, and the overall coincidence rate was 94.87%; the sensitivity of CD56 protein-specific nanoantibody-HRP fusion protein was 96.67%, and the sensitivity of the commercial test kit was 90.63%.

[0174] 5. Process comparison:

[0175] The experimental process of fusion HRP nanobody and traditional monoclonal antibody is compared, and the results are as follows:

[0176] Table 3 Process comparison

[0177]

[0178] As shown in Table 3, the HRP-fused nanoantibody is easy to operate, reduces the incubation steps of the secondary antibody, and has higher sensitivity, making it easier for clinical application.

Claims

1. A CD56 protein-specific nanobody, characterized in that: The amino acid sequence of the nanobody is shown in SEQ ID No:

2.

2. A nucleic acid molecule encoding the CD56 protein-specific nanobody according to claim 1, characterized in that: The nucleotide sequence of the nanobody is shown in SEQ ID No:

1.

3. A CD56 protein-specific nanobody-HRP fusion protein, characterized in that: The fusion protein is composed of the nanobody according to claim 1 and HRP in series.

4. A method for preparing the CD56 protein-specific nanobody-HRP fusion protein according to claim 3, characterized in that: Here are the steps: (1) Using double enzyme, the sequence of CD56 protein-specific nanoantibody was connected to the vector containing HRP to obtain a positive plasmid; (2) The positive plasmid in step (1) is transfected into host cells to induce the expression of CD56 protein-specific nanobody-HRP fusion protein.

5. The preparation method according to claim 4, characterized in that: In step (2), the host cells are HEK293 cells.

6. A detection reagent or detection kit, characterized in that: The detection reagent or detection kit comprises the CD56 protein-specific nanobody-HRP fusion protein according to claim 3, or the CD56 protein-specific nanobody-HRP fusion protein prepared by the method according to claim 4 or 5.

7. Use of the CD56 protein-specific nanobody-HRP fusion protein according to claim 3 in the preparation of a product for detecting CD56 protein-specific antibodies in serum.

8. The use according to claim 7, characterized in that The detection method includes the following steps: (1) Coating the CD56 protein on the ELISA plate to obtain an ELISA plate coated with the CD56 protein; (2) Incubate the serum sample to be tested with the ELISA plate coated with CD56 protein; (3) adding the CD56 protein-specific nanobody-HRP fusion protein described in claim 3 to the ELISA plate in step (2) and incubating; (4) Rinse the ELISA plate after the reaction in step (3) with the washing buffer, add TMB substrate solution and react in the dark. Terminate the reaction with 2M sulfuric acid and observe the color. If the sample to be tested contains CD56 protein-specific antibodies, the reaction well will be light yellow or colorless; if the sample to be tested does not contain CD56 protein-specific antibodies, the reaction well will be darker yellow.

Citation Information

Patent Citations

  • Anti-CD56 protein monoclonal antibody hybridoma cell, anti-CD56 monoclonal antibody generated by same and application

    CN105254759A

  • Anti-CD56 antibody and application thereof

    CN107488231A