A Penicillium oxalicum strain capable of degrading fumonisin and its application

Abstract

The present invention provides a strain of Penicillium oxalicum that can degrade fumonisins and its application, which belongs to the technical field of biological strains. The Penicillium oxalicum strain is named FJ284, with a deposit number of CGMCC No.41242. It was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration Committee on May 27, 2024, and the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. Preferably, the Penicillium oxalicum strain is isolated from corn stalks. Application of the Penicillium oxalicum strain, the Penicillium oxalicum strain is resistant to Fusarium pseudo-verticillium. The Penicillium oxalicum strain of the present invention can inhibit the growth of plant endophytes of Fusarium pseudo-verticillium to reduce the production of corn pathogens, and at the same time reduce the production of mycotoxins to improve the quality of corn, using plant and microbial improvement in biological improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of biological strains, and particularly relates to a Penicillium oxalicum strain capable of degrading fumonisin and an application thereof. Background Art

[0002] With the continuous expansion of corn planting area and the increasing speed of corn variety renewal, the development speed of corn diseases has also accelerated. Most corn diseases and corn toxins are caused by corn pathogens during corn growth, storage and transportation.

[0003] Common corn pathogens mainly include fungi such as Fusarium graminearum, Fusarium pseudoverticillium, and Pseudomonas syringae. These fungi will grow with the corn during its growth stage, and some pathogens will continuously produce toxic mycotoxins through metabolism during their growth. Fusarium disease is currently one of the most common and most harmful fungal diseases in grain crops such as corn and wheat. At the same time, the harmful fungal toxins produced by the metabolism of pathogens are enriched in corn grains and straws, which can easily cause poisoning and cancer in humans and livestock and even death after consumption. The fungi contained in the genus Fusarium are complex and diverse and have a wide distribution area. Their lifestyle is mainly facultative parasitic or saprophytic. At present, there are hundreds of Fusarium species that have been studied and reported.

[0004] Fusarium verticillioides is a type of Fusarium, a plant pathogen belonging to the Fusarium spp. family. Corn ear rot caused by Fusarium verticillioides and its mycotoxin contamination are one of the limiting factors restricting the healthy development of my country's corn industry. Corn ear rot is caused by pathogens infecting the top of the cob or near the worm holes, and the kernels turn gray-black with a white or purple mold layer on the surface. Infection by Fusarium verticillioides not only reduces corn yields, but also produces toxic secondary metabolites, fumonisins, during the plant growth stage, which seriously affects corn quality.

[0005] At present, the prevention and control of corn Fusarium disease mainly include agricultural prevention and control and chemical prevention and control. The country has also stipulated corresponding methods and standards for the detection of mycotoxins. In addition, studying the impact of environmental factors and the interaction between pathogens and hosts on the occurrence of diseases is also a way to formulate effective prevention and control strategies.

[0006] Agricultural prevention and control mainly includes planting disease-resistant varieties, crop rotation, timely removal of diseased and residual plants, and field management. In order to effectively prevent and control corn Fusarium disease, choosing disease-resistant varieties suitable for the local area is a key measure. In addition, attention should be paid to the planting density, which should not be too sparse or compact. It can also be rotated with some crops appropriately; strengthen field management measures, loosen the soil on time, remove weeds on time to prevent them from competing for nutrients and sunlight, and dry the harvested corn as soon as possible in the sun to prevent the corn kernels from being further contaminated by residual Fusarium and reduce losses.

[0007] Chemical control mainly includes seed treatment, soil treatment, spraying and resistance induction. Seed treatment can reduce the initial infection of pathogens. Selecting a suitable compound agent to coat corn seeds can reduce the probability of corn Fusarium disease. Selecting a suitable biological agent or chemical agent for soil treatment can also effectively prevent and control the occurrence of Fusarium disease. In the early stage of the disease, use a suitable fungicide for spraying and control, and adopt methods such as spraying alcohol to reduce the occurrence of diseases and pests, providing a suitable growth environment for corn growth.

[0008] In summary, each control measure is aimed at reducing or inhibiting the production of Fusarium, and the production of Fusarium spp. cannot be directly inhibited through control measures, and there are certain limitations.

[0009] Endophytic fungi generally refer to a type of fungi that live in the host plant but do not affect the normal growth and development of the host. Endophytic fungi are commonly found in monocotyledonous, woody and herbaceous plants. Endophytic fungi accompany the host plant for part of the growth stage or the entire growth stage, and can maintain the physiological and ecological characteristics of the host plant. Endophytic fungi parasitize in plant tissues and have established a mutually beneficial symbiotic relationship with plants in long-term co-evolution. As a result, these fungi have a unique metabolic mode and can produce secondary metabolites with novel structures and excellent activity.

[0010] Therefore, in view of the defects of existing control measures, the present invention aims to screen a strain isolated from corn that can inhibit the growth of Fusarium pseudoverticularis, inhibit the growth of Fusarium pseudoverticularis from the source, and thus reduce the production of fumonisin, and use a simple and fast resistance induction method based on the existing control methods to screen endophytic fungi with certain resistance to Fusarium pseudoverticularis. Make a certain contribution to the future resistance control of toxin production in corn. Summary of the invention

[0011] The purpose of the present invention is to solve the shortcomings of the prior art, provide a Penicillium oxalicum strain that can degrade fumonisin and reduce the production of corn pathogenic bacteria.

[0012] The technical solution adopted by the present invention is:

[0013] A strain of Penicillium oxalicum that can degrade fumonisin, the Penicillium oxalicum strain is named FJ284 (Penicillium oxalicum), the preservation number is CGMCC No.41242, and it was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 27, 2024, and the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0014] Preferably, the Penicillium oxalicum strain is isolated from corn stalks.

[0015] Use of a Penicillium oxalicum strain which is resistant to Fusarium pseudoverticillium.

[0016] Application of Penicillium oxalicum strains in the degradation of fumonisins produced by Fusarium oxysporum.

[0017] The application of Penicillium oxalicum strains in reducing the production of corn pathogens and increasing corn yields.

[0018] The beneficial effects obtained by the present invention are as follows: the Penicillium oxalicum strain of the present invention can inhibit the growth of Fusarium pseudo-verticillium and degrade the fumonisin produced by Fusarium pseudo-verticillium, thereby achieving the purpose of inhibiting plant endophytic fungi, reducing the production of corn pathogenic bacteria Fusarium pseudo-verticillium, and simultaneously reducing the production of mycotoxins, thereby improving the quality of corn. The present invention belongs to the plant and microbial improvement technology in biological improvement, and is safer to use. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a physical picture of the strain FJ284 of the present invention;

[0020] Figure 2 Front view of the inhibition zone of the coating antibacterial test of the strain FJ284 of the present invention against Fusarium spp.

[0021] Figure 3 The back view of the inhibition zone of the coating antibacterial test of the strain FJ284 of the present invention against Fusarium spp.

[0022] Figure 4 The antibacterial test diagram of the strain FJ284 of the present invention against Fusarium spp.

[0023] Figure 5 A comparison chart of the absorbance of the Pseudomonas verticillium bacterial solution and the mixed bacterial solution of the present invention. DETAILED DESCRIPTION

[0024] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0025] Plant sample: Corn, collected from Chaoyangpo, Gongzhuling City, Changchun City, Jilin Province in October 2023.

[0026] A strain of Penicillium oxalicum that can degrade fumonisin was isolated from the inner core of corn stalks. The strain was named FJ284 and stored at low temperature in the Microbial Chemistry Laboratory of Changchun Normal University.

[0027] 1. Screening and identification of antibacterial strains

[0028] Native corn plant samples were collected from Chaoyangpo, Gongzhuling City, Changchun City, Jilin Province, and strains resistant to Fusarium spp. were isolated and screened. The screened strains were identified by morphological observation and 18S rDNA sequence analysis.

[0029] 1. Test materials

[0030] Martin agar medium: 1% peptone, 1% glucose, 0.1% potassium dihydrogen phosphate, 0.05% hydrated magnesium sulfate, 2% agar, and 0.02% nalidixic acid.

[0031] Potato dextrose agar medium (PDA medium): 4% potato dextrose broth, 2% agar.

[0032] Sabouraud agar medium: peptone 1%, glucose 4%, chloramphenicol 0.02%, agar 2%.

[0033] Malt extract medium: 30 g malt extract, 5 g tryptone, 20 g agar, 0.02 g nalidixic acid.

[0034] Potato dextrose broth (PDB medium): potato dextrose broth 4%.

[0035] All the above culture media need to be sterilized at 121℃ for 90 min and cooled for later use.

[0036] 2. Research content

[0037] 2.1 Isolation and purification of strains

[0038] After drying at room temperature, place it in a clean bench. Perform surface disinfection according to the following steps: spray the plant sample with 75% ethanol for 30 seconds, and then wash the sample with distilled water for 3 to 5 times.

[0039] Use clean tap water to thoroughly rinse the collected plant samples to remove the soil and other attachments on the surface. Peel off the corn stalk epidermis, wash it and place it at room temperature to dry. Then, in the clean bench, use a sterilized knife to cut the corn stalk core into small pieces of about 0.5 cm. First, wash it with sterile water for 3 times, then soak it in 75% alcohol for 30 seconds, and then wash it with sterile water for 3 times. Use sterilized filter paper to absorb the moisture on the surface of the corn stalk core. Use sterilized tweezers to pick up small pieces of corn stalk core and inoculate them on the plate. Culture it at 28 °C, place it in a biological incubator, and observe it every day.

[0040] Under the sterile clean bench operating environment, these strains were preliminarily classified by observing the colony boundaries, colors, and heights of endophytic fungi growing around tissue blocks. If the cultured strain is a single colony, a sterilized inoculation loop is used to select a small amount of hyphae from different hyphae tops onto a new PDA medium, and then cultured again in a 28°C incubator. After the hyphae grow up, the strain preservation step is performed. If the colony is complex, the plate streak method is used to separate and purify the complex colony until a single colony is obtained growing on the plate.

[0041] For preservation of strains, transfer the purified strains into glycerol tubes (glycerol concentration is about 10%-30%), number them and store them in a -20℃ refrigerator.

[0042] 2.2 Screening of antibacterial strains

[0043] 2.2.1 Preparation of Fusarium spp. culture solution

[0044] Under sterile conditions, use a sterilized knife to cut 1 / 4 of the PDA culture medium of Fusarium spp. into small pieces and inoculate them into PDB liquid culture medium. Shake and culture at 37°C for 24 h to obtain the Fusarium spp. liquid.

[0045] 2.2.2 Antibacterial coating test

[0046] First, the knife, gun tip, and coating rod to be used are sterilized under high pressure, and the antibacterial experiment is carried out in a clean bench.

[0047] Use a sterilized pipette tip to absorb 200µl of Fusarium pseudoverticillium liquid and drop it into the center of an empty PDA plate. Use a sterilized coating rod to gently spread it evenly on the surface of the culture medium. After spreading, cut a purified plant endophytic fungus block with a side length of about 0.5cm and invert it to the center of the coated culture medium. Place it in a 28℃ constant temperature incubator and observe whether there is an inhibition zone for 3-5 days.

[0048] 2.2.3 Antibacterial confrontation experiment

[0049] Use a sterilized knife to cut FJ284 and Pseudomonas verticillasteri fungi with a side length of about 0.5 cm, invert them and inoculate them on the left and right ends of the same culture medium, and culture them in a constant temperature incubator at 28℃. After 3-5 days, observe whether there is a clear boundary. Figure 4 shown.

[0050] 2.3 Identification of strain species

[0051] 2.3.1 Morphological identification of strains

[0052] The purified fungal strain was inoculated into PDA medium and cultured under appropriate conditions for 7 days. After the culture, the colony size, hyphae growth rate, color, surface characteristics, etc. were observed. The growth was further observed by the glass slide wet chamber culture method and stained and fixed. Finally, the hyphae and spore morphological characteristics were observed under an optical microscope. Combined with relevant literature such as "Fungal Taxonomy", the isolated fungi were preliminarily identified.

[0053] This experiment was based on the instructions of the Ezup column fungal genomic DNA extraction kit to extract the genomic DNA of the isolated strain, and used this DNA as a template for PCR amplification detection. The primers used were NS1 (GTAGTCATATGCTTGTCTC) and NS6 (GCATCACAGACCTGTTATTGCCTC).

[0054] Subsequent sequencing work was completed by Sangon Biotechnology Co., Ltd. The obtained sequences were submitted to the database for homology comparison analysis to find the most similar sequence information, construct a phylogenetic tree, and combine morphological identification with 18s rDNA sequence identification results to determine the taxonomic status of the strain (order, family or genus level).

[0055] 3. Research Results

[0056] 3.1 Isolation results of strains

[0057] A total of 13 strains were isolated from corn samples (including 9 strains isolated from corn stalks and 4 strains isolated from soil).

[0058] 3.2 Preliminary screening results of strains resistant to Fusarium spp.

[0059] A strain with obvious anti-Fusarium spp. activity was selected and named FJ284. Figure 1 As shown in Figure 2. This strain can grow on a plate coated with the bacterial solution of Fusarium spp. and produce an inhibition zone. Figure 2-3 shown.

[0060] 3.3 Morphological identification results of endophytic fungi FJ284

[0061] The strain FJ284 with antibacterial ability was selected as the research object of this experiment, and the morphology of strain FJ284 was identified.

[0062] The colonies of FJ284 are relatively flat, velvety dark green colonies and grow faster on PDA plates.

[0063] The sequencing work was completed by Sangon Biotechnology Co., Ltd. The 18s rDNA gene sequence of the fungus FJ284 is as follows:

[0064]

[0065] Combining morphological analysis and 18s rDNA sequence identification results, strain FJ284 was preliminarily identified as Penicillium, and was classified and named Penicillium oxalicum. It was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration with the deposit number CGMCC No.41242.

[0066] 2. Spectroscopic detection of the ability of strain FJ284 to degrade fumonisins produced by Fusarium spp.

[0067] 1. Test materials

[0068] 1.1 Test strain: FJ284 strain isolated from corn samples from Chaoyangpo, Gongzhuling, Changchun, Jilin Province.

[0069] 1.2 Test species: Fusarium spp. and strain FJ284 obtained by mycelial culture provided by Jilin Academy of Agricultural Sciences.

[0070] 1.3 Culture medium: Potato dextrose broth (PDB): 4% potato dextrose broth, sterilized at 121℃ and cooled for use.

[0071] 2. Cultivation of antimicrobial strains

[0072] Under sterile conditions, take the purified FJ284 strain and Pseudomonas aeruginosa strain, use a sterilized knife to cut 1 / 4 of the culture medium into small pieces, inoculate them into 100 ml PDB liquid culture medium that has been sterilized and cooled to room temperature, seal it with a silicone stopper, place it in a constant temperature incubator, and culture it at 37°C for 24 h.

[0073] 3. Antibacterial experiments based on spectroscopy methods

[0074] 3.1 Preparation of FJ284 bacterial suspension

[0075] Take the PDA medium of FJ284 strain after culturing for 4 days, cut 1 / 4 of the medium into small pieces with a sterilized knife, and add it to the PDB medium that has been cooled to room temperature. Place it in a constant temperature shaker and culture it at 37℃ for 1 day for later use.

[0076] 3.2 Determination of absorbance

[0077] Preparation of mixed bacterial solution: Under sterile conditions, 100 ml of each of the FJ284 bacterial solution and the Fusarium spp. bacterial solution after 1 day of culture were mixed, and then continued to be cultured at 37°C. After 1 day of culture, a certain amount of the mixed bacterial solution was taken out, and a certain amount of the mixed bacterial solution was sucked out with a disposable sterile syringe, and filtered through a 0.45 μm filter membrane to obtain a mixed bacterial solution.

[0078] Absorbance determination: Take 300 μl of the mixed bacterial solution and the pseudo-verticillium spp. bacterial solution into a sterile 96-well plate and measure the absorbance at multiple wavelengths. The experimental results show that the inhibition rate is best at 450nm, so only the wavelength of 450nm is described.

[0079] The above operation was also performed after culturing for 2d, 3d, 4d, 5d, 6d and 7d, and the absorbance at the same wavelength was measured.

[0080] Fumonisin inhibition rate IR (%) = (A1-A2) / (A1-A3) × 100

[0081] A1-absorbance of Fusarium pseudoverticillium liquid;

[0082] Absorbance of the mixed bacterial solution of A2-FJ284 and Pseudomonas verticillasters;

[0083] Absorbance of A3-PDB culture medium.

[0084] 3.3 Verification of measurement results

[0085] The fumonisin enzyme-linked immunosorbent assay kit produced by Nanjing Maojie Microbiological Technology Co., Ltd. was used to quickly detect the mixed bacterial liquid and the Fusarium spp. liquid to verify the method in 3.2.

[0086] 4. Research Results

[0087] Figure 5 It shows that Fusarium pseudo-verticillium can continuously produce fumonisin through metabolism, and the amount of fumonisin is increasing. Although the absorbance of the mixed bacterial solution of FJ284 and Fusarium pseudo-verticillium also shows a certain upward trend, the absorbance of the mixed bacterial solution is significantly reduced compared with the Fusarium pseudo-verticillium bacterial solution, which means that adding FJ284 bacterial solution to the Fusarium pseudo-verticillium bacterial solution can greatly reduce the absorbance of the mixed bacterial solution, which also proves that FJ284 has a certain inhibitory effect on Fusarium pseudo-verticillium. Table 1 shows that the absorbance of the mixed bacterial solution decreases most significantly within 1-2 days of co-culture, and the inhibition rate of fumonisin reaches 70.59%.

[0088] Table 1 Absorbance of Fusarium pseudoverticillium culture liquid and mixed culture liquid at different culture times and fumonisin inhibition rate at corresponding time

[0089] Days (d) Absorbance of Fusarium pseudoverticillium liquid (L / (g·m)) Absorbance of mixed solution of FJ284 and Fusarium spp. (L / (g·m)) Inhibition rate 1 0.371 0.367 66.67% 2 0.399 0.375 70.59% 3 0.424 0.399 42.37% 4 0.441 0.406 46.05% 5 0.464 0.423 41.41% 6 0.477 0.433 39.29% 7 0.488 0.451 30.08%

[0090] FJ284 bacterial solution has a certain inhibitory effect on Fusarium spp. and can inhibit the production of fumonisin to a certain extent, and this inhibitory effect is most obvious in the first 2 days.

[0091] The method in 3.2 was tested using an ELISA kit. According to the ELISA kit instructions, the absorbance value of the sample was negatively correlated with the content of fumonisins contained therein, and the absorbance of the mixed bacterial solution was higher than that of the Fusarium spp., proving that the experimental results were valid, and the strain FJ284 had an anti-Fusarium spp. effect and could reduce the content of fumonisins.

[0092] Conclusion

[0093] Native corn plants were collected at Chaoyang Slope, Gongzhuling, Jilin Province, and endophytic fungi were isolated and purified from them. Antimicrobial coating and confrontation antimicrobial experiments were conducted to screen strains resistant to Fusarium oxalicum. It was found that the endophytic fungus FJ284 from corn stalks had a certain resistance to Fusarium oxalicum, so FJ284 was selected as the research strain in this experiment. The target strain was identified by morphological and molecular biological methods, combined with the determination of 18s rDNA sequences, and BLAST comparative analysis was performed to determine the species classification of the target strain. The strain FJ284 was identified as Penicillium, Penicillium oxalicum.

[0094] Based on the fact that FJ284 has a certain resistance to the strain of Fusarium pseudo-verticillium, a method for detecting the degradation of fumonisin produced by Fusarium pseudo-verticillium using a spectroscopy method was established. There are many traditional antibacterial methods, but the traditional method can only observe the effect of the antibacterial experiment by observing with the naked eye whether an inhibition zone is produced. The method established by the present invention can show through data whether a certain strain has an inhibitory effect on harmful Fusarium pseudo-verticillium that can produce fumonisin.

[0095] After 7 days of continuous cultivation under the same experimental conditions, it was found that the absorbance of the mixed bacterial solution of FJ284 and Pseudo-verticillium spp. was significantly lower than that of the Pseudo-verticillium spp., and the absorbance of the mixed bacterial solution decreased most significantly in the first 2 days. This once again proved that strain FJ284 had a certain inhibitory effect on Pseudo-verticillium spp., and this method is a method that can detect whether a certain fungus can degrade fumonisins produced by Pseudo-verticillium spp. by spectroscopy.

[0096] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A strain of Penicillium oxalicum, characterized in that: The oxalicum Penicillium strain was named FJ284, with a preservation number of CGMCC No.41242. It was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on May 27, 2024, and the preservation address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

2. Use of the Penicillium oxalicum strain according to claim 1 in resisting Fusarium pseudoverticillium.

Images