Application of DsHAD gene in regulation and control of growth, reproduction, pathogenicity and adversity resistance of Didymeria segeticola

Abstract

The invention discloses an application of a DsHAD gene in regulation and control of the growth, the reproduction, the pathogenicity and the stress resistance of Ddymeria segeticola. The DsHAD gene is derived from Ddymeria segeticola, and a knockout mutant is obtained by constructing a knockout gene segment of the DsHAD gene of the D. segeticola and introducing the knockout gene segment into a D. segeticola protoplast. It is found through experiments that the DsHAD gene plays a role in the growth, reproduction and adversity resistance of D.segeticola, and the pathogenicity of D.segeticola to tea tree leaves is remarkably reduced. Therefore, the DsHAD can be used as a bactericide target and a key protein of a disease pathogenic mechanism, is used for researching and developing medicaments for diseases caused by D.segeticola infection and cultivating new varieties of disease-resistant plants, and has a wide application prospect in prevention and treatment of plant pathogenic fungal diseases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of a DsHAD gene in regulating the growth, reproduction, pathogenicity and resistance to adversity of Didymella segeticola. Background Art

[0002] Didymella belongs to the family Didymellaceae, class Dothideomycetes, order Pleosporales, phylum Ascomycota. Many fungi in this genus are pathogenic to a variety of plants (Crous, PW, Gams, W., Stalpers, JA, Robert, V., Stegehuis, G. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology, 2004, 50(1): 19-22; Chen, Q., Hou, LW, Duan, WJ, Crous, PW, Cai, L. Didymellaceae revisited. Studies in Mycology, 2017, 87: 105-159).For example, Didymella segeticola is a new pathogencausing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science,2022,51:694-703), tobacco leaf spot (Guo,ZN,Xie,HL,Wang,HC,Huang,Y.,Chen,QL,Xiang,LG,Yu,ZH,Yang,XHLeaf spot caused by Didymella segeticola on tobacco in China.Plant Disease, 2019, 104(5): 1559-1560), tea leaf spot disease (Deng, X., Yang, J., Wan, Y., Han, Y., Tong, H., Chen, Y. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113(3): 516-527) D. segeticola var. camelliae strain GZSQ-4 (sent to China General Microbiological Culture Collection Center, strain collection number CGMCC3.20152) was isolated and identified by the inventor's research group from tea leaf spot disease in Shiqian County, Guizhou Province. The pathogen can infect new shoots, young leaves and mature leaves of tea trees, causing serious impact on the quality and yield of tea leaves. It is necessary to formulate technical measures for the disease (Zhao Xiaozhen, Wang Yong, Li Dongxue, Ren Yafeng, Chen Zhuo. Pathogen of new tea tree disease Phoma Morphological characteristics and systematic analysis of segeticola var. camelliae. Acta Phytopathologica Sinica, 2018, 48(4): 556-559).

[0003] The haloacid dehalogenase (HAD) superfamily is the largest of the enzyme superfamily and is mainly composed of phosphatases, ATPases, phosphoacylases and sugar phosphomutases (Kaur, H., Rode, S., Sandra, KP, Mahto, JK, Alam, MS, Gupta, DN, Kar, B., Singla, J., Kumar, P., Sharma, AKCharacterization of haloacid dehalogenase superfamily acid phosphatasefrom Staphylococcus lugdunensis. Archives of Biochemistry and Biophysics, 2024, 753, 109888.) The current research focuses on the structural characteristics, catalytic properties and potential of the enzyme in industrial applications (Kuznetsova, E., Nocek, B., Brown, G., Makarova, KS, Flick, R., Wolf, YI, Khusnutdinova, A., Evdokimova, E., Jin, K., Tan, K., Hanson, A.D., Hasnain, G., Zallot, R., de Crécy-Lagard, V., Babu, M., Savchenko, A., Joachimiak, A., Edwards, A.M., Koonin, E.V., Yakunin, AFFunctional diversity of haloacid dehalogenase superfamily phosphatases from Saccharomyces cerevisiae: biochemical, structural, and evolutionary insights. Journal of Biological Chemistry,2015,290(30):18678-18698;Yang,L.,Lu,Y.,Tian,W.,Feng,Y.,Bai,J.,Zhang,H.Insights into the functional divergence of the haloacid dehalogenase superfamily from phosphomonoesterase to inorganic pyrophosphatase.Archives of Biochemistry and Biophysics, 2021, 705, 108896; Wang, Y., Xiang, Q., Zhou, Q., Xu, J., Pei, D. Mini review: advances in 2-haloacid dehalogenases. Frontiers in Microbiology, 2021, 12, 758886.). .

[0004] So far, the molecular biology research on D. segeticola pathogens at home and abroad is still relatively weak, especially the lack of reports on the pathogenic mechanism of pathogens. Therefore, fully exploring the pathogenicity-related genes of D. segeticola and conducting functional studies will help to fully understand the pathogenicity of D. segeticola and the prevention and control of the diseases caused by it. The present invention obtains a monohaloacid dehydrogenase superfamily gene (named DsHAD) from D. segeticola, which is related to the pathogenicity and growth and reproduction of D. segeticola. Therefore, the DsHAD gene will have important significance and application prospects in the prevention and control of diseases caused by D. segeticola and the breeding of new plant disease-resistant varieties. Summary of the invention

[0005] In view of this, one of the objects of the present invention is to provide a new use of the DsHAD protein derived from D. segeticola, namely, the use of the DsHAD protein in regulating the pathogenicity and / or growth rate and / or reproductive ability and / or resistance to adversity of D. segeticola, wherein the DsHAD protein is a protein with an amino acid sequence as shown in the sequence SEQ ID NO.2 or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein as shown in the sequence SEQ ID NO.2.

[0006] The second object of the present invention is to provide a biological material related to the DsHAD protein for use in regulating the pathogenicity and / or growth rate and / or reproductive ability and / or resistance to adversity of D. segeticola. The biological material includes a nucleic acid molecule encoding the DsHAD protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule. For example, the biological material can also be a recombinant vector or a recombinant microorganism containing the expression cassette.

[0007] Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO. 1. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA. The vector may be a plasmid, cosmid, phage or viral vector; the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0008] The third object of the present invention is to provide the application of the above-mentioned DsHAD protein as a target in the design and screening of antifungal drugs.

[0009] A fourth object of the present invention is to provide the use of the above-mentioned DsHAD protein or the above-mentioned biological material in cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced growth rate and / or reduced reproductive capacity and / or reduced resistance to adversity.

[0010] The fifth object of the present invention is to provide a method for cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced growth rate and / or reduced reproductive capacity and / or reduced resistance to adversity, comprising the step of reducing the expression amount and / or activity of the above-mentioned DsHAD protein in the recipient D. segeticola to obtain transgenic D. segeticola (such as DsHAD knockout mutant). The pathogenicity and / or growth rate and / or reproductive capacity and / or resistance to adversity of the transgenic D. segeticola are lower than those of wild-type D. segeticola.

[0011] Preferably, the method for reducing the expression level and / or activity of the DsHAD protein in the receptor D. segeticola is achieved by knocking out, inhibiting or silencing the expression of the gene encoding the DsHAD protein in the receptor D. segeticola.

[0012] Preferably, the knockout method is to use a homologous recombination method to knock out the gene encoding the DsHAD protein in the receptor D. segeticola.

[0013] Preferably, the method using homologous recombination is to introduce the homologous recombination fragment used for homologous recombination into the protoplasts of the recipient DsHAD.

[0014] The sixth object of the present invention is to provide the application of the above method in preventing and treating diseases caused by the bacterium DsHAD.

[0015] The present invention provides a DsHAD protein derived from D. segeticola and an application of its encoding gene in regulating the pathogenicity, growth rate, reproductive ability and stress resistance of the plant pathogenic fungus D. segeticola. After knocking out the DsHAD protein encoding gene in the wild-type D. segeticola, it was found that the pathogenicity, growth rate, reproductive ability and stress resistance of the knocked-out D. segeticola were significantly reduced. Therefore, DsHAD can be used as a fungicide target and a key protein in the pathogenic mechanism of the disease to develop agents for diseases caused by D. segeticola infection and cultivate new disease-resistant varieties, and has broad application prospects in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the DsHAD gene knockout and mutant screening strategy of D. segeticola of the present invention;

[0017] Figure 2 is a map of the plasmid pct74 of the present invention;

[0018] Figure 3 This is the PCR electrophoresis diagram for the verification of the transformant of the present invention;

[0019] Figure 4 Figure 2 is a diagram showing the colony growth of the wild type and mutant ΔDsHAD of the present invention on PDA;

[0020] Figure 5 It is a statistical graph of the colony growth rate of the wild type and mutant ΔDsHAD of the present invention on PDA;

[0021] Figure 6 The figure is a statistical graph of spore production and spore germination rate of the wild type and mutant ΔDsHAD of the present invention;

[0022] Figure 7 Figure 2 is a diagram showing the colony growth of the wild type and mutant ΔDsHAD of the present invention under different stress conditions;

[0023] Figure 8 It is a statistical graph of the colony growth inhibition rate of the wild type and mutant ΔDsHAD of the present invention under different stress conditions;

[0024] Fig. 9 The results are the pathogenicity test results of the wild type and mutant ΔDsHAD of the present invention on tea leaves. DETAILED DESCRIPTION

[0025] The present invention will be described in detail below in conjunction with examples, which are merely illustrative and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations made without violating the spirit of the present invention should be included within the scope of the present invention. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0026] In the following example, the wild-type strain GZSQ-4 of D. segeticola was isolated and identified from tea leaf spot disease in the tea base of Datun Village, Longtang Town, Shiqian County, Guizhou Province, and sent to the China General Microbiological Culture Collection Administration Center for preservation, with the culture collection number CGMCC3.20152. The genomic DNA sequence and CDS sequence of the DsHAD gene in the strain are both shown in SEQ ID NO.1. After sequence alignment, the gene should belong to the Haloacid dehalogenase (HAD) superfamily gene; the amino acid sequence of the DsHAD protein encoded by the gene is shown in SEQ ID NO.2.

[0027] Example 1D. DsHAD gene knockout in segeticola

[0028] 1. Construction of knockout gene fragments

[0029] 1) Amplification of upstream and downstream homologous sequences of the target gene: Using the genomic DNA of the wild-type strain CGMCC3.20152 of D. segeticola as a template, primers 1F and 2R were used to amplify the upstream A fragment, and primers 3F and 4R were used to amplify the downstream B fragment, and a reverse complementary sequence of primer HYG-F was added to the 5' end of primer 2R, and a reverse complementary sequence of primer HYG-R was added to the 5' end of primer 3F. The sequences of primers 1F, 2R, 3F, 4R, HYG-F and HYG-R (5' to 3') are:

[0030] 1F:TACGAAGTTTGGAAGAACCGC

[0031] 2R: ACCTCCACTAGCTCCAGCCAAGTACGTAGAGCTTCCTTACGATCG 3F: GAATAGAGTAGATGCCGACCGGGGGAAGATCAAGAAGCCTACAGTG 4R: AGAATCGTGACGGTGCTTTTC

[0032] HYG-F:CTTGGCTGGAGCTAGTGGAGGT

[0033] HYG-R:CCCGGTCGGCATCTACTCTATTC

[0034] 2) Amplification of the hygromycin resistance gene hph: Plasmid pCT74 (map as shown Figure 1 The first half of the hygromycin resistance gene H1 (1094 bp) was amplified using primers HYG-F and HYG-1R; the second half of the hygromycin resistance gene H2 (748 bp) was amplified using primers HYG-1F and HYG-1R. The sequences of primers HYG-1F and HYG-1R (5' to 3') are: HYG-1F: CGTTGCAAGACCTGCCTGAA; HYG-1R: GGATGCCTCCGCTCGAAGTA.

[0035] 3) Fusion of upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A and B fragments with the H1 and H2 fragments to obtain A-H1 connection fragments and H2-B connection fragments. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify A-H1 and H2-B fragments, respectively, and the knockout fragments were purified to a concentration of 500 ng / μL.

[0036] 2. Preparation of D. segeticola protoplasts

[0037] 1) Inoculate D. segeticola into potato dextrose broth (PDB) medium, culture at 25°C for 36 hours, collect mycelia into a 2 mL centrifuge tube, break the mycelia with a grinder, transfer the bacterial suspension to CM liquid medium and shake culture for 36 hours, and collect fresh mycelia of D. segeticola by filtration;

[0038] 2) Using 10 mL of 0.8 mol / L potassium chloride solution as an osmotic pressure stabilizer, a mixed enzymatic solution of Drislase, Lysozyme and Snailase was prepared to lyse 5 g of suspended mycelium, and the enzymatic hydrolysis was carried out at 30°C and 100 rpm for 4 h;

[0039] 3) Filter through 2-3 layers of sterilized lens paper (pore size of the fiber mesh is 45±12μm), rinse with 0.8mol / L potassium chloride, collect the filtrate, centrifuge the filtrate at 4°C and 4000rpm for 6min, and resuspend with 15mL 1.2mol / L sorbitol buffer (STC) solution;

[0040] 4) Discard the supernatant and resuspend the protoplast pellet in 1 mL STC buffer to a concentration of 1×10 7 The protoplast suspension of 100 g / mL was placed on ice for later use.

[0041] 3. D. segeticola protoplast transformation

[0042] 1) Take 200 μL of protoplast suspension and add it to a 50 mL centrifuge tube. Add 10-20 μg of A-H1 and H2-B knockout transformation fragments, mix gently, and let stand on ice for 20 min.

[0043] 2) Add 1.4 mL of 40% polyethylene glycol 4000 buffer (PTC) twice, gently invert and mix, let stand at room temperature for 20 min, add 5 mL of TB3 liquid culture medium, invert and mix, and culture at 25°C, 120 rpm for 12 to 16 h.

[0044] 3) Centrifuge at room temperature, 4000 rpm / min for 6 min, discard the supernatant, and resuspend the remaining 1 mL of resuspension with the regenerated protoplasts.

[0045] 4) Add to 50 mL of warm TB3 regeneration solid medium, mix well and prepare plates. After inverted culture at 25°C for 24 hours, cover with PDA medium containing 30 μg / mL hygromycin B and culture at 25°C for about 2 to 4 days until transformants grow, and then subculture and screen for 3 generations.

[0046] 4. PCR verification of transformants

[0047] After three generations of subculture on PDA medium containing hygromycin, transformants of ΔDsHAD can be obtained. DNA was extracted from the transformant colonies using the CTAB method, and PCR amplification was performed using primers. The primer pair HYGF / HYGR was used to amplify fragment P1 to detect the hph gene; the primer pair 5F / 6R was used to amplify the fragment to detect whether the target gene was knocked out. The sequences of primers 5F and 6R (5' to 3') are:

[0048] 5F:CCGCTATGTACCCTTCGCAA

[0049] 6R:CACATGGTCTCGTCTGCACT

[0050] The gene knockout fragment was transferred into D. segeticola protoplasts by homologous recombination, and hygromycin-positive transformants were obtained. PCR verification analysis was performed on the positive transformants using hph gene-specific primers. The results are as follows: Figure 3 As shown, the hph gene, the occurrence of upstream homologous recombination and the occurrence of downstream homologous recombination were detected in the transformant, and the DsHAD gene was not amplified in the electrophoresis diagram, then the corresponding positive transformant was screened, that is, the ΔDsHAD knockout mutant was obtained.

[0051] Example 2 Phenotypic observation and stress resistance analysis of D. segeticola wild type and ΔDsHAD knockout mutant

[0052] 1. Colony morphology observation and growth rate determination

[0053] The wild type and knockout mutant ΔDsHAD of D. segeticola were inoculated on PDA medium, cultured at 25°C in the dark for 8 days, and then the colony diameter was measured by the cross method, and the colony morphology was observed; 3 replicates were set for each treatment.

[0054] The results of colony morphology observation and growth rate determination of D. segeticola wild type and knockout mutant ΔDsHAD on PDA medium are shown in Figure 4 and Figure 5 As shown, Figure 4 This is a graph of colony growth; Figure 5 The figure is a statistical graph of colony growth rate, the ordinate is the colony diameter, and the value is the mean based on 3 independent experiments, and the data were analyzed by Duncan's new multiple range method (p < 0.05). Figure 4 and 5 It can be seen that the colony morphology and growth rate of the D. segeticola knockout mutant ΔDsHAD on PDA medium were significantly lower than those of the D. segeticola wild type, indicating that the ΔDsHAD gene affects the growth of D. segeticola.

[0055] 2. Determination of spore production and spore germination

[0056] The wild type and knockout mutant ΔDsHAD of D. segeticola were inoculated on oatmeal medium (OA) and cultured at 25°C in the dark. After 14 days, the mycelium was washed with sterile water and the spores were collected by sterile 3-4 layer filtration. The supernatant was discarded by centrifugation and the spores were counted by a hemocytometer after being suspended in 0.1% Tween water. Three replicates were set for each treatment. The spores were diluted to a concentration of 10 5 , take 100 μL and spread it evenly on 1% water agar medium, and count the germination after 14 to 16 hours.

[0057] The results of spore production and spore germination assays of wild-type and knockout mutant ΔDsHAD of D. segeticola on OA medium were presented in Figure 6 It can be seen that the spore production and spore germination rate of the DsHAD gene knockout mutant ΔDsHAD of D. segeticola were significantly lower than those of the wild type, indicating that after knocking out the DsHAD gene, the pathogenicity, growth and reproduction ability of D. segeticola were inhibited.

[0058] 3. Analysis of stress resistance

[0059] 1) High osmotic pressure stress analysis

[0060] The wild type and knockout mutant ΔDsHAD of D. segeticola were inoculated on PDA medium containing 1 mol / L KCl, 1.0 mol / L NaCl, and 1.0 mol / L sorbitol, respectively, and cultured upside down in a 25°C incubator for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type strain was observed.

[0061] The colony diameters of all strains were measured (cross method) and photographed and recorded. The growth inhibition rate of strains was calculated as (colony diameter of control strain - colony diameter of treated strain) / colony diameter of control strain * 100%.

[0062] 2) Oxidative stress analysis: The wild type and knockout mutant ΔDsHAD of D. segeticola were inoculated on PDA medium containing 20 mmol / L H2O2, respectively, and cultured upside down in a 25°C incubator for 8 days. The colony growth of the knockout mutant ΔDsHAD and the wild type was then observed.

[0063] 3) Cell wall integrity analysis

[0064] The wild type and knockout mutant ΔDsHAD of D. segeticola were inoculated on PDA medium containing 200 μg / mL Congo red, respectively, and cultured upside down in a 25°C incubator for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type strain was observed.

[0065] 4) Cell membrane integrity analysis

[0066] The wild type and knockout mutant ΔDsHAD of D. segeticola were inoculated on PDA medium containing 0.005% sodium dodecyl sulfate (SDS), respectively, and cultured upside down in a 25°C incubator for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type strain was observed.

[0067] Growth of the DsHAD knockout mutant ΔDsHAD and wild type of D. segeticola under different stress conditions Figure 7 As shown (wherein, A to F are the growth conditions of D. segeticola wild-type strains on culture media under different stress conditions; Figure 7G~L, are the growth conditions of D. segeticola mutant strain ΔDsHAD on culture medium under different stress conditions; 1mol / L KCl: containing a final concentration of 1mol / L KCl; 1mol / L NaCl: containing a final concentration of 1mol / LNaCl; 0.005% SDS: containing a final concentration of 0.005% SDS; 200μg / mL Congo red: containing a final concentration of 200μg / mL Congo red; 20mmol / L H2O2: containing a final concentration of 20mmol / L H2O2; 1mol / L sorbitol: containing a final concentration of 1mol / L sorbitol); the relative growth inhibition rate of the colonies under different stress conditions is shown in the following table. Figure 8 As shown, the ordinate is the relative growth inhibition rate, the values ​​are the means based on 3 independent experiments, and the data were analyzed by Duncan's new multiple range method (p < 0.05). Figure 8 From left to right in the figure are the relative growth inhibition rates of the wild type and knockout mutants under NaCl, KCl, sorbitol, H2O2, SDS and Congo red stress; data analysis was performed using Duncan's new multiple range method (p < 0.05). Figure 7 and Figure 8 It can be seen that in the medium containing 20mmol / L H2O2, the relative growth inhibition rate of the knockout mutant ΔDsHAD was significantly higher than that of the wild type, indicating that the knockout of the DsHAD gene increased the sensitivity to H2O2. In summary, the knockout of the DsHAD gene significantly reduced the tolerance to oxidative stress.

[0068] Example 3D. Virulence analysis of segeticola knockout mutants

[0069] The wild type and knockout mutant ΔDsHAD of D. segeticola were inoculated on PDA culture medium, respectively, and cultured upside down in an incubator at 25°C for 7 days. A sterile cork puncher with a diameter of 4 mm was used to punch several bacterial cakes at the edge of the colony, which were then inoculated on the surface of tea leaves with puncture wounds. The disease status of the tea leaves was investigated after 3 days.

[0070] The results of the pathogenicity test of the DsHAD gene knockout mutant ΔDsHAD of D. segeticola to tea leaves are shown in Fig. 9 As shown, Fig. 9 A is the lesion picture of wild-type strain of D. segeticola and mutant strain ΔDsHAD inoculated on tea leaves 3 days later; Fig. 9 B is the measurement result of the lesion area of ​​D. segeticola wild-type strain and mutant strain ΔDsHAD inoculated on tea leaves 3 days later. The ordinate is the lesion measurement area, and the value is the mean value based on 20 independent experiments. The data were analyzed by Duncan's new multiple range method (p < 0.05). Fig. 9 It can be seen that on tea leaves, the lesion area of ​​the knockout mutant ΔDsHAD was significantly reduced compared with the wild type, indicating that the pathogenicity of D. segeticola was inhibited after the DsHAD gene was knocked out.

[0071] In summary, the DsHAD gene provided by the present invention can be used for the prevention and treatment of diseases caused by D. segeticola and can be used as a target for drugs used for the prevention and treatment of plant diseases. Those skilled in the art can follow this specification to develop fungicides for the prevention and treatment of plant diseases, especially diseases caused by D. segeticola.

[0072] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, so they will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical scheme of the present invention can be subjected to a variety of simple modifications, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Application of DsHAD protein in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of Didymella segeticola, It is characterized in that The DsHAD protein is a protein with an amino acid sequence as shown in SEQ ID NO.2 or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein with an amino acid sequence as shown in SEQ ID NO.

2.

2. Use of a biological material related to the DsHAD protein described in claim 1 in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or resistance to adversity of D. segeticola, It is characterized in that The biological material is a nucleic acid molecule encoding a DsHAD protein or an expression box, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

3. The use according to claim 2, It is characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

1.

4. Use of the DsHAD protein described in claim 1 as a target in the design and screening of antifungal drugs.

5. Use of the DsHAD protein described in claim 1 or the biomaterial described in claim 2 or 3 in cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced growth rate and / or reduced reproductive capacity or reduced resistance to adversity.

6. A method for cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced growth rate and / or reduced reproductive capacity and / or reduced resistance to adversity, It is characterized in that The method comprises the steps of reducing the expression level and / or activity of the DsHAD protein described in claim 1 in the receptor D. segeticola to obtain transgenic D. segeticola.

7. The method according to claim 6, It is characterized in that The method for reducing the expression level and / or activity of the DsHAD protein described in claim 1 in the receptor D. segeticola is achieved by knocking out, inhibiting or silencing the expression of the gene encoding the DsHAD protein in the receptor D. segeticola.

8. The method according to claim 7, It is characterized in that The knockout method is a homologous recombination method.

9. The method according to claim 8, It is characterized in that The method using homologous recombination is to introduce the homologous recombination fragment used for homologous recombination into the protoplasts of the recipient D. segeticola.

10. Use of the method according to any one of claims 6 to 9 in preventing and controlling diseases caused by D. segeticola.

Images