A molecular marker in cattle ADAM18 gene and its application

Abstract

The present application provides a molecular marker in the ADAM18 gene of cattle and its application. The molecular marker is one or more of g.34873341T>A, g.34874222C>T and g.34877973C>G in the cattle genome. The molecular marker or the material used to detect the single nucleotide polymorphism of the molecular marker of cattle provided by the present application can be used in cattle genetic breeding to reduce the hemoglobin concentration of the offspring of Tibetan improved cattle and solve the low oxygen bottleneck problem faced by the breeding of plateau cattle.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to molecular markers in cattle ADAM18 genes and applications thereof. Background Art

[0002] When cattle from low altitude areas migrate to the low oxygen environment of high altitude areas, the hemoglobin concentration will increase to increase the oxygen carrying capacity and meet the body's oxygen supply needs. However, too high a hemoglobin concentration may increase blood viscosity, increase cardiovascular risks, hinder microcirculation, and cause diseases such as high altitude polycythemia. The Tibetan improved cattle (Holstein cattle ♂×Tibetan cattle ♀) began in the 1980s, and the progressive hybridization has been carried out to the F3 generation or above. Therefore, in the selection and breeding process of Tibetan improved cattle on the plateau, an appropriate hemoglobin concentration is more conducive to the adaptation of Tibetan improved cattle to the plateau environment.

[0003] Hemoglobin concentration is a complex and comprehensive trait that is regulated by multiple genes. However, the molecular markers currently reported to be related to bovine hemoglobin concentration lack more reliable sites for exploring gene changes under hypoxic environments. In addition, gene-gene or gene-environment interactions can also affect the physiological characteristics of plateau cattle.

[0004] Therefore, it is urgent to screen new molecular markers related to the bovine hemoglobin concentration trait to provide new molecular marker resources for molecular marker-assisted selection of plateau dairy cows, which can promote the process of breeding and improvement of plateau dairy cows. Summary of the invention

[0005] The purpose of the present invention is to discover the molecular marker in the cattle ADAM18 gene, and to provide a new molecular marker for the detection of cattle hemoglobin concentration or auxiliary molecular marker breeding in Tibetan improved cattle breeding.

[0006] In a first aspect, the present application provides a molecular marker in the bovine ADAM18 gene, wherein the site of the molecular marker is one or more of g.34873341T>, A; g.34874222C>, T and g.34877973C>, G in the bovine genome.

[0007] Further, g.34873341T>, A means there is a T>, A base mutation at the 101bp in the sequence shown in SEQ ID NO.1; g.34874222C>, T means there is a C>, T base mutation at the 64bp in the sequence shown in SEQ ID NO.2; g.34877973C>, G means there is a C>, G base mutation at the 95bp in the sequence shown in SEQ ID NO.3.

[0008] The second aspect of the present application provides a method for detecting the concentration of bovine hemoglobin, the method comprising the steps of:

[0009] 1) Detect at least one of the base type at the 101 bp in the SEQ ID NO:1 sequence; the base type at the 64 bp in the SEQ ID NO:2 sequence; and the base type at the 95 bp in the SEQ ID NO:3 sequence;

[0010] 2) When 1) the base type at the 101 bp in the SEQ ID NO:1 sequence is A, the cattle individual is an AA type individual at the 101 bp; when 1) the base type at the 101 bp in the SEQ ID NO:1 sequence is T, the cattle individual is a TT type individual at the 101 bp or an AT type individual at the 101 bp; the hemoglobin concentration of the AA type individual is lower than that of the TT type individual at the 101 bp and the AT type individual at the 101 bp;

[0011] When the base type at the 64th bp in the sequence shown in SEQ ID NO:2 in 1) is T, the cattle individual is a TT type individual at the 64th bp; when the base type at the 64th bp in the sequence shown in SEQ ID NO:2 in 1) is C, the cattle individual is a CC type individual at the 64th bp or a CT type individual at the 64th bp; the hemoglobin concentration of the TT type individual is lower than that of the CC type individual at the 64th bp and the CT type individual at the 64th bp;

[0012] When the base type at the 95th bp in the sequence shown in SEQ ID NO:3 in 1) is G, the cattle individual is a GG type individual at the 95th bp; when the base type at the 95th bp in the sequence shown in 1) is GC, the cattle individual is a CC type individual at the 95th bp or a CG type individual at the 95th bp; the hemoglobin concentration of the GG type individual is lower than that of the CC type individual at the 95th bp and the CG type individual at the 95th bp.

[0013] The third aspect of the present application provides an application of molecular markers in the successive breeding of Tibetan improved cattle, and the specific steps include:

[0014] Determine the gene type at the locus of the above molecular markers in Tibetan improved cattle, and carry out successive breeding according to the gene type of the locus:

[0015] Select cattle for successive breeding with individuals whose base at the 101 bp in the sequence SEQ ID NO.1 is type A, and eliminate individuals whose base at the 101 bp is type T; and / or,

[0016] Select cattle for successive breeding, and select individuals whose base at the 64th bp in the sequence of SEQ ID NO.2 is T-type, and eliminate individuals whose base at the 64th bp is C-type; and / or,

[0017] The cattle are selected for successive breeding with individuals whose base at the 95th bp in the SEQ ID NO.3 sequence is G type, and individuals whose base at the 95th bp is C type are eliminated.

[0018] Furthermore, the hemoglobin concentration of individuals with the gene type of the molecular marker AA-TT-GG is the lowest, and individuals with the gene type of the molecular marker AA-TT-GG are selected during the successive breeding of Tibetan improved cattle.

[0019] Beneficial effects of the present invention:

[0020] 1. The present invention has discovered molecular markers associated with hemoglobin concentration in the bovine ADAM18 gene, wherein the molecular markers include g. 34873341T>A, g. 34874222C>T and g. 34877973C>G; the above three molecular markers can be used as molecular markers of bovine hemoglobin concentration respectively, and the haplotype individual composed of the above three molecular markers, namely, the AA-TT-GG individual has the lowest hemoglobin concentration.

[0021] 2. The present invention verifies the effects of the above three molecular markers on the hemoglobin concentration of cattle, and can be applied to the successive breeding of Tibetan improved cattle to reduce the hemoglobin concentration. Individuals with the gene type of g. 34873341T> of AA, the gene type of g. 34874222C> of TT or the gene type of g. 34877973C> of GG can be selected. Individuals with these three gene types have lower hemoglobin concentrations. Haplotype individuals of AA-TT-GG can also be selected, and the hemoglobin concentration of AA-TT-GG individuals is the lowest. Thereby improving the hypoxia adaptability of the offspring of Tibetan improved cattle.

[0022] 3. The present invention provides a new molecular marker for molecular marker-assisted breeding of the hemoglobin concentration trait of Tibetan improved cattle, which realizes the early detection of the hemoglobin concentration trait of Tibetan improved cattle. The detection method is fast and accurate, and is not affected by breeding environment conditions. The selection and breeding of Tibetan improved cattle through the molecular marker can greatly shorten the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Manhattan plot for HGB indicator GWAS.

[0024] Figure 2 It is the HGB indicator QQ chart. DETAILED DESCRIPTION

[0025] The molecular markers screened by the present invention can be applied to the genotype association analysis of bovine hemoglobin concentration-related genes, providing a new molecular marker resource for molecular marker-assisted selection of bovine hemoglobin concentration traits. In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is described in detail below in conjunction with the embodiments, but they should not be understood as limiting the scope of protection of the present invention. Unless otherwise specified, the materials used in the following embodiments are purchased from the market.

[0026] Example 1 Screening of hypoxia-resistant sites in Tibetan cattle

[0027] 1. Blood sample collection of cattle distributed at different altitude gradients

[0028] The present invention selects Tibetan cattle (3500m) and Yunnan local cattle (altitudes are: 3000m, 2500m, 1500m and 500m, respectively) distributed at different altitude gradients, 20 heads at each altitude, a total of 100 heads, specific sample information is that 20 heads were collected in Gongbu Gyamda County (GB) of Tibet Autonomous Region at an altitude of 3500m; 20 heads were collected in Diqing Tibetan Autonomous Prefecture (DQ) of Yunnan Province at an altitude of 3000m; 10 heads were collected in Laojun Mountain (JS) of Wenshan Prefecture of Yunnan Province and Lijiang City (LJ) of Yunnan Province at an altitude of 2500m; 10 heads were collected in Tengchong City (TC) of Yunnan Province and Wuding County (WD) of Yunnan Province at an altitude of 1500m; 10 heads were collected in Damaidi Town (SB) of Shuangbai County of Yunnan Province and Yingjiang County (YJ) of Yunnan Province at an altitude of 500m. Use a high-altitude vacuum blood collection tube containing EDTA anticoagulant to collect 5 ml of blood from the bovine jugular vein. Place the anticoagulant tube in an ice box with a large number of ice packs and bring it back to the laboratory, where it will be stored in a -80°C refrigerator for subsequent DNA extraction for whole genome resequencing.

[0029] 2. Genomic DNA Extraction and Whole Genome Resequencing

[0030] Bovine genomic DNA was extracted using a blood genomic DNA extraction kit (Tiangen Biochemical Technology, DP348) according to the instructions. The specific method is described in the instructions. The genomic DNA that passed the quality inspection was sent to Beijing Berry Genomics Biotech Co., Ltd. (Beijing, China) for secondary quality inspection and library construction, and paired-end whole-genome resequencing was performed using the Illumina HiSeq2500 platform. The sequencing coverage of 100 individual genomes was about 5X, and the sequencing data volume was not less than 15G. The entire sequencing process was controlled by Illumina HiSeq Control Software.

[0031] 3.SNP calling and sequence alignment

[0032] First, the quality control of the original sequencing data was performed, and the bases with sequencing quality less than 20 (i.e., sequencing accuracy less than 99%) were removed from the reads, and the reads with a length of less than 35bp after trimming were discarded. For the quality-controlled data, the Burrows-Wheeler-Alignment (BWA) software (Li & Durbin, 2010) was used to align to the corresponding reference genome (Bos taurus UMD 3.1) to obtain the alignment result bam file, and the samtools software was used to sort and mark the repeated sequences. Next, the Genome Analysis Toolkit (GATK) v3.7 standard process was used for SNP calling to obtain a high-quality gene variation information set. First, the HaplotypeCaller in GATK was used to perform variants calling to generate an individual mutation information set g.vcf file. The g.vcf files of all individuals were merged, and GenotypeGVCFs was used for joint calling to obtain the variation information of this group and the accurate genotype of each individual. Next, the variant information was quality controlled. Due to the lack of high-quality known variant sets as references, hard filtering was used. The SelectVariants command was used to split SNP (single nucleotide polymorphism) and InDel (Insertion-Deletion). For the initial SNP file, the VariantFiltration command was used to filter out the SNP information that did not meet the quality conditions and generate the final VCF file. The filtering parameters were "-cluster 3 -window 20; QD<2.0; QUAL<30; MQ<40.0; FS>60.0; SOR>3.0; MQRankSum<-12.5; ReadPosRankSum<-8.0; DP<10; --missing-values-evaluate-as-failing true". For VCF files, PLINK v1.90b was used for further SNP quality control. SNPs with multiple alleles, missing rates greater than 10%, and a minimum allele frequency of 0 were eliminated. Individuals with a SNP missing rate greater than 20% were eliminated. The data after quality control will be used for subsequent analysis.

[0033] Then download the cattle genome gff file from Ensemble and use ANNOVAR software to perform SNP annotation.

[0034] 4. Screening of hypoxia-tolerant sites in Tibetan cattle

[0035] (1) Based on population genetics methods, the MEMEA method was established using likelihood estimation, and the multivariate normal distribution was used to identify molecular markers whose allele frequencies were selected by environmental factors. By introducing the random effect u between sites, adjacent sites were allowed to be subject to different selection intensities. At the same time, this method fully takes into account the genetic piggyback effect and uses a sliding window model to detect sites subject to environmental selection pressure. In the present invention, the altitude gradient of cattle is used as an environmental variable to calculate the P value of each molecular marker in the model related to the molecular mechanism of adaptation to the plateau environment. Then, the -log(P) values ​​are sorted from large to small, and the top 1% of molecular markers are selected as candidate signals;

[0036] (2) Based on population genomic data, BayPass was used for regression analysis to screen molecular markers that were highly correlated with the changing trends of environmental factors;

[0037] (3) Select Tibetan cattle at 3500 m and cattle at 500 m altitude, and calculate the F of each molecular marker using vcftools software. ST , the top 1% of molecular markers are taken as candidate signals;

[0038] (4) Combining MEMEA and BayPass analysis methods to detect genetic polymorphic loci that are selected for environmental adaptability among populations at continuous altitude gradients, and then combining the single locus F ST The analysis results verified and supplemented each other, and the candidate sites of the three analysis methods were intersected. The F ST Sliding window results (20 kb window, 5 kb step size), merge the top 1% Fst windows into regions (overlapping or distance < 20 kb), and combine BayPass, MEMEA, and single-site F ST The intersection sites falling within the regional range were selected as SNPs related to hypoxia adaptation, and finally 11,637 molecular markers related to the hypoxia tolerance trait of cattle were screened.

[0039] Example 2: Application of low-density liquid phase chip

[0040] 1. Synthesis of Probes

[0041] As described in Example 1, 11,637 molecular markers related to the hypoxia tolerance trait of cattle were analyzed and screened from the whole genome sequencing data of cattle distributed at continuous altitude gradients. The target site information was checked, and then probes were designed and synthesized, tested and adjusted, and the final probes and capture sites were determined. 10KSNP liquid phase chips were prepared at Shijiazhuang Boredy Biotechnology Co., Ltd.

[0042] 2. Detection of Tibetan Improved Cattle Plateau Adaptation Breeding Chip

[0043] 1550 Tibetan improved cattle were selected as the test cattle, and blood physiological indicators were measured, and whole genome DNA was extracted. After passing the quality inspection, genotyping was performed using a 10K SNP liquid phase chip, and the results were used for subsequent association analysis between genotypes and physiological indicators.

[0044] 3. GWAS Analysis

[0045] (1) Use fastp software (version 0.20.0, parameters: -n 10 -q 20 -u 40) to filter the raw reads obtained by sequencing, and finally obtain clean reads, which are used for subsequent analysis;

[0046] (2) Use the BWA software to align the clean reads after quality control with the reference genome (Bos taurus UMD3.1) sequence; use the UnifiedGenotyper module of the GATK software (version v3.5-0-g36282e4) to perform variation detection;

[0047] (3) The VariantFiltration module was used for filtering, and the comparison results and variant results were extracted from the genotyping information of molecular markers using a self-written Perl script;

[0048] (4) Functional annotation of molecular markers using ANNOVAR;

[0049] (5) GWAS analysis was performed using the general linear model (GLM) in Tassel software. The model is as follows:

[0050] y=Wα+xβ+ε

[0051] In the formula:

[0052] y represents the phenotypic traits to be studied, i.e., the blood routine and blood rheology indicators in this study;

[0053] Wα is the fixed effect (age, sex and feeding level), other factors affecting y, mainly referring to the group structure;

[0054] xβ is the labeling effect;

[0055] ε represents the residual.

[0056] GWAS results showed that the HGB index was annotated to ADAM metallopeptidase domain 18 at the selection signal site on chromosome 27. ADAM 18) ( Figure 1 and Figure 2 ), the selected signal is the strongest, and the selection interval is 4≤-Log 10 (P)<6.

[0057] Example 3: Correlation analysis and application of molecular markers and hemoglobin concentration

[0058] In order to further determine whether the ADAM18 gene g. 34873341T>;A, g. 34874222C>;T and g.34877973C>;G sites are related to the difference in hemoglobin concentration of Tibetan improved cattle, the GLM program in SAS statistical analysis software was used to perform association analysis between the traits of individuals with different genotypes of molecular markers. The model used was:

[0059] Yijk= μ + Gi + Hj+Sk +eijkl

[0060] Among them, Y ijk is the observed value of physiological index, µ is the group mean, G i is the genotype effect of ADAM18 gene, H j is the jth age effect, S k is the kth gender effect, e ijkl is a random error and follows a normal distribution.

[0061] According to the above model, the least square means of the corresponding physiological indicators of each genotype of molecular markers were calculated using the GLM procedure of SAS (Ver. 9.4), and the significance test of the difference was performed.

[0062] The results of statistical analysis are shown in Table 1: g.34873341T>; The hemoglobin concentration of AA genotype in the A site was significantly lower than that of TT genotype and TA genotype (P<0.05); g.34874222C>; The hemoglobin concentration of TT genotype in the T site was significantly lower than that of CC genotype and CT genotype (P<0.05); g.34877973C>; The hemoglobin concentration of GG genotype in the G site was significantly lower than that of CC genotype and CG genotype (P<0.05).

[0063] Table 1 Association analysis between ADAM18 gene polymorphisms and hemoglobin concentration in Tibetan improved cattle

[0064]

[0065] Note: The values ​​in the table are expressed as mean ± standard error. Different lowercase letters in the same row indicate significant differences (P<0.05), and the same letters indicate insignificant differences (P>0.05).

[0066] The results of genetic association analysis showed that the molecular marker at the g.34873341T>A site (the 101bp in the sequence shown in SEQ ID NO.1) was significantly correlated with the bovine hemoglobin concentration. The hemoglobin concentration of individuals with genotype A at the 101bp in the sequence shown in SEQ ID NO.1 was significantly lower than that of individuals with genotype T at the 101bp in the sequence shown in SEQ ID NO.1, indicating that genotype A at the 101bp in the sequence shown in SEQ ID NO.1 is an allele that is beneficial to reducing the hemoglobin concentration.

[0067] g.34874222C>; The molecular marker at the T site (the 64th bp in the sequence shown in SEQ ID NO.2) was significantly correlated with the bovine hemoglobin concentration. The hemoglobin concentration of individuals with the genotype T at the 64th bp in the sequence shown in SEQ ID NO.2 was significantly lower than that of individuals with the genotype C at the 64th bp in the sequence shown in SEQ ID NO.2, indicating that the genotype T at the 64th bp in the sequence shown in SEQ ID NO.2 is an allele that is beneficial to reducing the hemoglobin concentration.

[0068] g.34877973C>; The molecular marker at the G site (95bp in the sequence shown in SEQ ID NO.3) was significantly correlated with the bovine hemoglobin concentration. The hemoglobin concentration of individuals with genotype G at the 95bp in the sequence shown in SEQ ID NO.3 was significantly lower than that of individuals with genotype C at the 95bp in the sequence shown in SEQ ID NO.3, indicating that genotype G at the 95bp in the sequence shown in SEQ ID NO.3 is an allele that is beneficial to reducing the hemoglobin concentration.

[0069] This molecular marker can be used as a molecular marker for detecting bovine hemoglobin concentration, and when the genotype at the 101bp in the sequence shown in SEQ ID NO.1 is A, the genotype at the 64bp in the sequence shown in SEQ ID NO.2 is T, and the genotype at the 95bp in the sequence shown in SEQ ID NO.3 is G (AA-TT-GG), it is more conducive to reducing the hemoglobin concentration of Tibetan improved cattle. It can solve the hypoxia bottleneck problem faced by plateau cattle breeding, provide a rapid and accurate molecular means for breeding plateau tolerant individuals, and provide a reliable technical platform for carrying out related genetic breeding work such as cattle stress resistance breeding, promote the development of my country's plateau cattle industry, and also provide theoretical reference and method guidance for the breeding of other plateau animals.

[0070] Example 4: Linkage disequilibrium analysis of ADAM18 gene polymorphism sites

[0071] Haploview software was used to analyze the linkage disequilibrium of the three molecular markers of ADAM18 gene. The three loci g.34873341T>A, g.34874222C>T and g.34877973C>G were closely linked (r 2 =1). Three combined genotypes were detected in the Tibetan improved cattle population: TA-CT-CG (the genotype at the 101 bp in the sequence shown in SEQ ID NO.1 is T, the genotype at the 64 bp in the sequence shown in SEQ ID NO.2 is C, and the genotype at the 95 bp in the sequence shown in SEQ ID NO.3 is G), TT-CC-CC (the genotype at the 101 bp in the sequence shown in SEQ ID NO.1 is T, the genotype at the 64 bp in the sequence shown in SEQ ID NO.2 is C, and the genotype at the 95 bp in the sequence shown in SEQ ID NO.3 is C), and AA-TT-GG (the genotype at the 101 bp in the sequence shown in SEQ ID NO.1 is A, the genotype at the 64 bp in the sequence shown in SEQ ID NO.2 is T, and the genotype at the 95 bp in the sequence shown in SEQ ID NO.3 is G). The results of the association analysis between different combined genotypes and hemoglobin concentration in Tibetan improved cattle are shown in Table 2: The hemoglobin concentration of individuals with AA-TT-GG genotype was significantly lower than that of individuals with TA-CT-CG genotype and TT-CC-CC genotype (P<0.05).

[0072] Table 2 Association analysis between ADAM18 gene haplotype and hemoglobin concentration in Tibetan improved cattle

[0073]

[0074] Note: The values ​​in the table are expressed as mean ± standard error. Different lowercase letters in the same row indicate significant differences (P<0.05), and the same letters indicate insignificant differences (P>0.05).

[0075] The above-mentioned ADAM18 gene g. 34873341T>;A, g. 34874222C>;T and g. 34877973C>;G loci can be used as new molecular markers for genetic improvement of hemoglobin concentration trait in Tibetan improved cattle.

[0076] Example 5 Application of the molecular markers in the ADAM18 gene in subgeneration breeding

[0077] First, the gene type of the Tibetan improved cattle at the molecular marker site in the above embodiment is determined, and then successive breeding is carried out according to the gene type of the site.

[0078] It was determined that the base at 101 bp in SEQ ID NO.1 was A-type, the base at 64 bp in SEQ ID NO.2 was T-type, and the base at 95 bp in SEQ ID NO.3 was G-type. The hemoglobin concentration of these three base types was significantly lower than that of other base types.

[0079] Therefore, the individuals whose base at the 101bp in the sequence of SEQ ID NO.1 is A-type (the individuals of the cattle are AA-type individuals at the 101bp), and the individuals whose base at the 101bp in the sequence of SEQ ID NO.1 is T-type (the individuals of the cattle are TT-type individuals at the 101bp or AT-type individuals at the 101bp); and / or, the individuals whose base at the 64bp in the sequence of SEQ ID NO.2 is T-type (the individuals of the cattle are TT-type individuals at the 64bp), and the individuals whose base at the 64bp in the sequence of SEQ ID NO.2 is C-type (the individuals of the cattle are CC-type individuals at the 64bp or CT-type individuals at the 64bp); and / or, the individuals whose base at the 95bp in the sequence of SEQ ID NO.3 is G-type (the individuals of the cattle are GG-type individuals at the 95bp), and the individuals whose base at the 95bp in the sequence of SEQ ID NO. Individuals whose base at the 95th bp in the NO.3 sequence is of type C (for cattle, the base at the 95th bp is CC or the base at the 95th bp is CG).

[0080] The gene type of the molecular marker of the Tibetan improved cattle is that the hemoglobin concentration of the AA-TT-GG genotype individual is the lowest. During the successive breeding of the Tibetan improved cattle, the AA-TT-GG genotype individual is selected.

[0081] The present invention screened out genes and sites associated with altitude by whole-genome resequencing of cattle genomic DNA distributed at different altitude gradients, and created a low-cost and high-throughput genotyping liquid phase chip (10K) based on these altitude-associated sites. According to the existing high-generation hybrid segregation populations of backcross and crosscross of Tibetan improved cattle, hypoxia-related blood physiological indicators were systematically measured. The 10K SNP chip was used to perform a genome-wide association study (GWAS) of hypoxia physiology, and molecular markers g.34873341T>A, g.34874222C>T and g.34877973C>G on the ADAM18 gene associated with hemoglobin concentration were obtained.

[0082] In the embodiment of the present invention, Tibetan cattle (3500 m) and Yunnan local cattle (3000 m, 2500 m, 1500 m and 500 m above sea level) with different altitude gradients were selected for whole genome resequencing, and the resequencing data were compared with the cattle reference genome (Bos taurus UMD 3.1).ST , MEMEA and BayPass analysis methods, and finally screened out 11,637 molecular markers related to the hypoxia tolerance trait of cattle. Then the target site information was screened and checked, and then the probes were designed and synthesized, tested and adjusted, and the final probes and capture sites were determined, creating a low-cost and high-throughput genotyping liquid phase chip (10K). Finally, based on the existing high-generation hybrid segregation populations of backcross and cross-cross of Tibetan improved cattle, the hypoxia-related blood physiological indicators were systematically determined, and the 10K SNP chip was used to implement a genome-wide association analysis (GWAS) of hypoxia physiology, and three molecular markers related to hemoglobin concentration on the cattle ADAM18 gene were screened: g.34873341T>;A, g.34874222C>;T and g.34877973C>;G. (Bold and underlined in the sequence)

[0083] g. Molecular marker of 34873341T>;A site: The nucleotide sequence of the fragment is shown in SEQ ID NO:1, and there is a T>;A base mutation at the 101 bp position in the sequence;

[0084] SEQ ID NO.1:

[0085] TGTGTGTCTTTGATTGGGTCCCTTTGAGTTTATCCTACTTGGAGTTCATTAAGCTTCTTGGATGTTTAATTTTTTCATGAGATTTAGGAACATTTTGGCC T TTAGTTCTTTGAAGCTCCTTTTTGCCCTTTTTATCTATCTCCTCCCTATTACCTCCACTGTATACATGTCGGTGTGCTTGAAAATGCCCCATAGGAAAAG.

[0086] g. Molecular marker of 34874222C>;T site: The nucleotide sequence of this fragment is shown in SEQ ID NO:2, and there is a C>;T base mutation at the 64 bp in the sequence;

[0087] SEQ ID NO.2:

[0088] AAATCAGCATCTCAGTATATACACATTTAAGAGGCATGCATAGTTTACTTCCCTGTGAAAATG CAAACCTAGGCTCTACCAGTTGAATCCAGTTTCTTTGTTTTGCTTGTTTATAGTAAGCTATACTATTTTGTGGGGCTTCCCTGCTGGCTCAGTGGTAAAGACTTCA.

[0089] g. Molecular marker of 34877973C>G site: The nucleotide sequence of the fragment is shown in SEQ ID NO:3, and there is a C>G base mutation at the 95th bp in the sequence;

[0090] SEQ ID NO.3:

[0091] TGCCATTGTACATGTACTGTACTAAGTCGCTTTAGTTGTGTCCAACTCTTTGCAACACTATGGATTTTAGCCCACCAGGTTCCTCTGTCCATAG C ATTCTCCAGGTAAGAACACTGGAGTGGATTGCCAGGCCCTCCTCCCATTGTGCATAAATACCACTTTTTTCTGTTCTTTCATCTTTGACG.

[0092] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A method for detecting bovine hemoglobin concentration, characterized in that: The steps of the method include: 1) Detect at least one of the base type at the 101 bp in the SEQ ID NO:1 sequence; the base type at the 64 bp in the SEQ ID NO:2 sequence; and the base type at the 95 bp in the SEQ ID NO:3 sequence; There is an A>T base mutation at the 101 bp in the sequence shown in SEQ ID NO.1; there is a T>C base mutation at the 64 bp in the sequence shown in SEQ ID NO.2 and there is a G>C base mutation at the 95 bp in the sequence shown in SEQ ID NO.3; 2) The hemoglobin concentration of individuals whose base at the 101 bp in the sequence shown in SEQ ID NO.1 is AA type is lower than that of individuals whose base is TT type and AT type; When the hemoglobin concentration of an individual whose base at the 64th bp in the sequence shown in SEQ ID NO: 2 is TT type is lower than that of individuals whose base is CC type and CT type; When the base at the 95th bp in the sequence shown in SEQ ID NO: 3 is GG type, the hemoglobin concentration of the individual is lower than that of CC type and CG type individuals.

2. An application of molecular markers in the successive breeding of improved Tibetan cattle, characterized in that: The specific steps include: Determine the gene type at the site of the molecular marker in the Tibetan improved cattle, and carry out successive breeding according to the gene type at the site: The sites of the molecular markers are: an A>T base mutation at the 101 bp in the sequence shown in SEQ ID NO.1; a T>C base mutation at the 64 bp in the sequence shown in SEQ ID NO.2; and a G>C base mutation at the 95 bp in the sequence shown in SEQ ID NO.3; Select cattle for successive breeding, and select individuals with AA type base at the 101 bp in the sequence of SEQ ID NO.1, and eliminate individuals with TT type and AT type; and / or, Select cattle for breeding, and select individuals with TT type base at the 64 bp in the sequence of SEQ ID NO.2, and eliminate CC type individuals and CG type individuals; and / or, In the subsequent breeding of cattle, the individuals with the GG type base at the 95bp position in the SEQ ID NO.3 sequence were selected, and the CC type individuals and the CG type individuals were eliminated.

3. The use according to claim 2, characterized in that: The hemoglobin concentration of individuals whose gene type of the molecular marker is AA-TT-GG is the lowest. During the successive breeding of Tibetan improved cattle, individuals whose gene type of the molecular marker is AA-TT-GG are selected.

Images