A method for producing nicotinamide mononucleotide by dual enzyme "one-pot" catalysis

Abstract

The present invention discloses a method for producing nicotinamide mononucleotide by double enzyme "one-pot method". The method is carried out under the optimal conditions: 25 mg / mL EBY-NRK, 10 mg / mL EBY-PPK, 5mM NR, 1.5 mM ATP, 15 mM phosphate donor, 2 mM Mg-containing 2+ The material can catalyze the production of 82.8% NMN at 30°C and pH 6.5, and the ATP cost is reduced by 75%. The whole-cell enzyme preparation retains more than 50% enzyme activity after being reused 5 times. The present invention also developed a whole-cell catalyst displayed on the surface of recombinant yeast, which solves the problem of byproduct accumulation feedback inhibition conversion during NMN biosynthesis by coupling the ATP regeneration system, achieving a good NMN product generation rate while effectively reducing costs.

Description

Technical Field

[0001] The present invention relates to the technical field of nicotinamide mononucleotide synthesis, and in particular to a method for producing nicotinamide mononucleotide by double-enzyme "one-pot" catalysis. Background Art

[0002] β-Nicotinamide mononucleotide (NMN) is a core anti-aging molecule, nicotinamide adenine dinucleotide (NAD + ), the direct precursor of NMN, the mechanism of action of NMN is mainly to increase the NAD + level to improve mitochondrial function and increase the energy production level of cells; reduce cell damage and promote DNA repair; increase neuronal survival rate and maintain the level of signal conduction in the body, thereby delaying aging, repairing trauma and improving cognition.

[0003] At present, the methods for synthesizing NMN are mainly divided into chemical method, fermentation method and bio-enzyme method. Chemical synthesis has the disadvantages of complex pathways, difficulty in separating isomers, environmental pollution, and high synthesis cost; fermentation method for producing NMN has the disadvantages of substrate and product inhibition mechanism, poor bacterial growth, and difficulty in accumulating products in large quantities; while bio-enzyme synthesis has the advantages of high specificity, chiral selective catalysis, simple production process, and high catalytic efficiency, and is the preferred method for preparing NMN. However, the lack of efficient and stable enzyme preparations, expensive reaction substrates, and product purification costs still restrict the enzymatic synthesis of NMN.

[0004] The bioenzymatic method simulates the metabolic pathway of NMN in vivo, expresses the enzyme in vivo in vitro, realizes the in vitro enzyme catalytic reaction, and thus produces NMN. There are currently two main process routes for the enzymatic synthesis of NMN. The first route is to start from nicotinamide, and 5-phosphoribosyl pyrophosphate (PRPP) is used as a ribose-5-phosphate donor and converted into NMN under the action of nicotinamide phosphoribosyl transferase; however, the overall concentration of NMN synthesized by this pathway is low, and it depends on the use of excess PRPP as a ribose 5-phosphate donor, and PRPP is expensive and unstable. The use of cheap substrates to synthesize PRPP requires multiple enzymatic reactions, and the synthesis efficiency is low. Another route is the generation of NMN by nicotinamide ribose (NR) and ATP under the catalysis of nicotinamide riboside kinase, which is considered to be the most promising synthesis route for NMN. The Klm-NRK enzyme from Kluyveromyces marxii can catalyze 100 g / L (0.30M) NR within 8 hours, with a molar yield of 84.2% for NMN. However, Klm-NRK only retains 40% of its enzyme activity under the commonly used industrial conditions of 40-65°C and pH 5-8.5, resulting in a serious loss of catalytic efficiency. In addition, ATP is costly and consumes a lot of energy, and the accumulation of the generated byproduct ADP will inhibit the key enzymes in the biocatalytic reaction, which will reduce the conversion efficiency or cause the reaction to proceed in the reverse direction.

[0005] The present invention designs a brewer's yeast display system, prepares a NRK yeast surface-displayed whole-cell catalyst, and constructs a polyphosphate kinase (PPK)-type ATP regeneration system to catalyze the one-step synthesis of NMN from NR and ATP, thereby reducing the feedback inhibition of the byproduct ADP accumulation on the synthesis reaction and realizing the recycling of ATP. Summary of the invention

[0006] In order to solve the problems of unstable production enzyme properties and high synthesis cost in the existing NMN synthesis process, the dual enzyme method for catalytic synthesis of NMN can further increase the yield of NMN while reducing costs to meet production needs. The main purpose of the present invention is to provide a dual enzyme "one-pot" catalytic method for producing nicotinamide mononucleotide.

[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions.

[0008] A method for producing nicotinamide mononucleotide by dual enzyme "one-pot" catalysis, comprising the following steps:

[0009] S1. Construct two recombinant Saccharomyces cerevisiae surface display strains, which display nicotinamide riboside kinase to obtain EBY-NRK and polyphosphatase to obtain EBY-PPK respectively;

[0010] S2, culturing the two recombinant Saccharomyces cerevisiae surface display strains constructed in S1 respectively, wherein the culture conditions are as follows: after culturing in the culture medium, the bacterial cells are collected by centrifugation, and the EBY-NRK whole cell enzyme preparation and the EBY-PPK whole cell catalyst are obtained after freeze-drying respectively;

[0011] S3, EBY-NRK whole cell enzyme preparation, EBY-PPK whole cell catalyst, nicotinamide riboside NR, adenosine triphosphate ATP, phosphate donor and Mg-containing 2+ The substances are mixed and reacted to generate NMN. 2+ The substance is MgCl2.

[0012] Furthermore, in S1, in the construction of the two recombinant Saccharomyces cerevisiae surface display strains, plasmid pYD1 is used as a vector to overexpress nicotinamide riboside kinase and polyphosphate kinase.

[0013] Further, S1 specifically comprises: inserting the nicotinamide riboside kinase gene into the plasmid vector pYD1 to construct a recombinant plasmid pYD1-NRK, and transferring it into Saccharomyces cerevisiae EBY100 to realize the surface display of the recombinant nicotinamide riboside kinase on the surface of Saccharomyces cerevisiae to obtain the recombinant Saccharomyces cerevisiae EBY100 / pYD1-NRK, wherein the nicotinamide riboside kinase gene is shown in SEQ ID NO: 1;

[0014] The polyphosphatase gene was inserted into the plasmid vector pYD1 to construct a recombinant plasmid pYD1-PPK, and the plasmid was transferred into Saccharomyces cerevisiae EBY100 to display the recombinant polyphosphatase on the surface of Saccharomyces cerevisiae to obtain recombinant Saccharomyces cerevisiae EBY100 / pYD1-PPK. The polyphosphatase gene is shown in SEQ ID NO: 2.

[0015] Further, in S2, the culture medium is a Sc liquid culture medium, and the Sc liquid culture medium contains 1.5 wt%-2.5 wt% glucose or 2 wt%-2.5 wt% galactose, 0.67 wt%-1.34 wt% yeast amino-free nitrogen source and 2wt%-2.5 wt% acid-hydrolyzed casein.

[0016] Furthermore, in S2, the culture conditions are: after culturing in a glucose-containing Sc liquid culture medium at 28-30°C and 180-200 rpm for 18-22 h, transfer to a galactose-containing Sc liquid culture medium and induce culture at 20-25°C for 60-72 h.

[0017] Furthermore, in S2, the centrifugation condition is 5000-9000 rpm, preferably 9000 rpm, at 0-8°C for 8-10 min, preferably at 4°C for 10 min.

[0018] Further, in step S3, in the reaction system, the amount of EBY-NRK whole cell enzyme preparation added is 20-25 mg / mL; the amount of EBY-PPK whole cell catalyst added is 10-15 mg / mL; the amount of nicotinamide riboside NR added is 5-7 mM; the amount of adenosine triphosphate ATP added is 1-2 mM; the amount of phosphate donor added is 10-15 mM; and the amount of Mg-containing 2+ Substances were added in amounts of 2-5 mM.

[0019] Further preferably, in step S3, in the reaction system, the amount of EBY-NRK whole cell enzyme preparation added is 25 mg / mL; the amount of EBY-PPK whole cell catalyst added is 10 mg / mL; the amount of nicotinamide riboside NR added is 5 mM; the amount of adenosine triphosphate ATP added is 1.5 mM; the amount of phosphate donor added is 15 mM; and the amount of Mg-containing 2+ The amount of substance added was 2 mM. Specifically, nicotinamide riboside NR, adenosine triphosphate ATP, sodium hexaphosphate and magnesium chloride were used as substrates, 25 mg / mL EBY-NRK whole cell enzyme preparation and 10 mg / mL EBY-PPK whole cell catalyst were added, and the double enzyme "one pot method" was used at 30°C and pH 6.5 to achieve 4h catalytic synthesis of NMN up to 20.7 mM (6.91 g / L), with a molar yield of 82.80%.

[0020] Furthermore, in step S3, the phosphate donor is sodium hexaphosphate.

[0021] As a preferred technical solution, nicotinamide riboside NR, adenosine triphosphate ATP, and magnesium chloride are used as substrates, 20 mg / mL of EBY-NRK whole cell enzyme preparation is added, and nicotinamide mononucleotide is synthesized at 30° C. for 3 h.

[0022] As a preferred technical solution, adenosine diphosphate ADP, sodium hexaphosphate and magnesium chloride are used as substrates, 3 mg / mL EBY-PPK whole-cell catalyst is added, and the reaction is carried out at 30°C for 10 minutes to synthesize adenosine triphosphate ATP.

[0023] As a preferred technical solution, the present invention provides a method for synthesizing nicotinamide mononucleotide by an efficient enzymatic method, wherein the recombinant bacterial lyophilized powder is used as a whole-cell enzyme preparation, NR, ATP, MgCl2, and sodium hexaphosphate are used as substrates, and the enzyme preparation is added to catalyze the synthesis of nicotinamide mononucleotide. Among them, PPK catalyzes the conversion of ADP into ATP or catalyzes AMP into ADP, and then converts ADP into ATP, so that ATP is regenerated and circulated in the reaction system. NRK catalyzes NR and ATP to synthesize NMN.

[0024] Compared with the prior art, the present invention has the following advantages and technical effects:

[0025] 1. The present invention displays the NRK enzyme on the surface of Saccharomyces cerevisiae cells, constructs a new recombinant Saccharomyces cerevisiae EBY-NRK, and improves the enzyme activity by optimizing the expression conditions to achieve efficient synthesis of NMN.

[0026] 2. The present invention displays the PPK enzyme on the surface of Saccharomyces cerevisiae cells and constructs a new recombinant Saccharomyces cerevisiae EBY-PPK, which not only provides raw materials for NMN synthesis through continuous ATP regeneration, but also reduces the feedback inhibition of the synthesis reaction caused by the accumulation of byproduct ADP.

[0027] 3. The present invention co-reacts two recombinant yeast whole-cell enzyme preparations with the substrate to achieve a dual-enzyme "one-pot method" to catalyze the efficient synthesis of NMN, wherein the NRK enzyme is used to catalyze the synthesis of NMN from NR and ATP; the PPK enzyme is used to catalyze the cyclic regeneration of ATP in the system, which greatly reduces the reaction cost, reduces the generation of by-product ADP, and increases the NMN yield.

[0028] 4. The recombinant yeast enzyme preparation obtained by the present invention can be directly recovered after centrifugation and quickly put into the next reaction application, which improves the reusability of the enzyme. After 5 repeated recycling, the whole-cell enzyme preparation still has >50% enzyme activity, which greatly reduces the cost of the enzyme and provides a stable enzyme preparation basis for the industrial production of NMN.

[0029] In summary, the application of the nicotinamide riboside kinase displayed on the surface of Saccharomyces cerevisiae equipped with an ATP regeneration system to efficiently synthesize nicotinamide mononucleotide disclosed in the present invention has important application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the NMN standard curve measured at a wavelength of 260 nm in Example 2.

[0031] Figure 2 This is the reaction HPLC detection and mass spectrometry of the EBY-NRK whole cell catalyst in Example 2.

[0032] Figure 3 This is a verification diagram of the repeatable recovery times of the Saccharomyces cerevisiae EBY-NRK whole-cell enzyme preparation in Example 2.

[0033] Figure 4 This is a diagram showing the optimization results of the enzyme production conditions for EBY-NRK in Example 3.

[0034] Figure 5 This is a liquid phase result diagram of the catalytic synthesis of NMN by EBY-NRK under the optimal enzyme production conditions in Example 3.

[0035] Figure 6This is a standard curve of ATP and ADP measured at a wavelength of 260 nm in Example 4.

[0036] Figure 7 This is a diagram showing the results of liquid phase detection of catalytic activity of the EBY-PPK whole-cell enzyme in Example 4.

[0037] Figure 8 This is a graph showing the changes in the various components during the 4 h coupling reaction under the most suitable conditions in Example 5. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0039] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0040] Example 1 Construction and expression of recombinant Saccharomyces cerevisiae EBY-NRK

[0041] After optimizing the codon preference of Saccharomyces cerevisiae, the NRK enzyme gene (SEQ ID NO: 1) was added at both ends. EcoR I and Xol The restriction site of Ⅰ was inserted into plasmid pYD1 (plasmid vector pYD1) to construct recombinant plasmid pYD1-NRK. The recombinant plasmid was commissioned to be synthesized by Shenggong (Shanghai) Biological Company. The recombinant plasmid was transformed into Escherichia coli DH5α by electroporation and amplified and cultured. The recombinant plasmid was extracted by alkaline lysis and verified by double enzyme digestion. Saccharomyces cerevisiae EBY100 competent cells were prepared by LiAc method and transferred into the constructed recombinant plasmid pYD1-NRK. After transformation, samples were spread on MDL screening plates and inverted at 30℃ for 2-4 days until positive clones appeared. The EBY100 strain of Saccharomyces cerevisiae is a double-deficient type for leucine (Leu) and tryptophan (Trp) and cannot grow in a medium without leucine and tryptophan (Leu-, Trp-). The expression plasmid pYD1-NRK carries a tryptophan synthesis gene, so cells successfully transformed with the plasmid can grow in MDL medium (Leu+, Trp-) without tryptophan, thereby screening out recombinants.

[0042] The positive transformants on the MDL plate were picked, and the positive clone single colonies were picked for colony PCR according to the universal primers pYD1-F (5'CTGCTTGGCAAGTTATGA 3') and pYD1-R (5'AGATGGACCACCTCTGTA 3') of the pYD1 plasmid. The PCR results were observed by electrophoresis and the bands were recovered and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification.

[0043] The positive clones after colony PCR verification were picked and inoculated into Sc liquid medium (containing 0.67 wt% YNB, 2 wt% glucose, 2 wt% casamino acid (CAA)) and cultured at 30°C, 180 rpm for 18-22 h. The cells were collected by centrifugation, washed twice with sterile PBS, resuspended in Sc liquid medium (containing 0.67 wt% YNB, 2 wt% galactose, 2 wt% casamino acid) and induced at 20°C, 180 rpm for 60-72 h. The cells were collected by centrifugation, washed twice with physiological saline, and the supernatant was discarded. The cells were vacuum freeze-dried at -45°C for 48 h to obtain the freeze-dried cells, which were the EBY-NRK whole-cell catalysts and stored at 4°C for future use.

[0044] SEQ ID NO: 1 is:

[0045] ATGTACAAGGACGACGACGACAAGATGACAACTACTAAGGTTAAGCTAATTGCTATATCAGGTTGTTCATCTTCCGGTAAAACAACCTTGGCTAAATTCCTTGCCAACGCTATTCCAGGTTGTATACTTATTCATGAAGATGACTTTTACAAACCAGATTCAGAAATTCCAATCAATGAAAAATATGGTGTTGCCGACTGGGATTGTCCTGAGGCTCTGGACTTAGATGCCTTCAAAAGAGAACTTGATTTGATTAAGACTACTGGCTCCATTAAGACGAAGTTGATTCATAACGAGAATGTTGACGACATCGGTAAGTTTAATATAAAGCAAGAGGATTGGGACGCTCTTCGTGCCAAGTTATCCTCAGTTATTGAAAGTGATTTAAAAGTCGTACTAGTAGACGGATTTATGATCTTTAATGACGAAGAATTGATGAGAAAATTTGATATAAGGATATTTGTAAGAGCACCATACGAAGTTTTATCAAGAAGACGTCATGCAAGGGCCGGCTACAAAACACTAGAATCATTCTGGGTTGACCCACCATATTATTTCGATGAGTTCGTCTATAGAGCATATAGAGAAGAACATAAACACCTTTTCGTGAATGAAGACGTAGAAGGGTCATTGAGAAGTGATGCGGGTTTATTTGAATTAATCAATGACGACGAAACCGAAATAACTACTGCTCTAAACACCATTGCTGACTACATTGTTTCACACTTGGATGCTAATTAA。

[0046] Example 2 Enzyme Activity Verification of Recombinant Saccharomyces cerevisiae EBY-NRK

[0047] 20 mg / mL EBY-NRK whole cell catalyst (EBY-NRK whole cell enzyme preparation) was added to a 5 mL reaction bottle, and 5 mM NR, 6 mM ATP, and 5 mM MgCl2 were added in sequence. The reaction was carried out at pH 6.0 and 30°C. Enzyme-free Saccharomyces cerevisiae EBY100-pYD1 powder was used as a blank control. After 3 h of reaction, the supernatant was centrifuged and filtered through a 0.22 μM filter membrane to determine whether the product was generated by HPLC, and the molar production rate of NMN was calculated.

[0048]

[0049] Seven groups of standard solutions of 0.1, 0.2, 0.5, 1, 2, 5, and 10 mM were prepared using NMN standard. High performance liquid chromatography (HPLC) was used for detection and the peak area was recorded. Using data processing software, the experimental data were linearly regressed with concentration as the horizontal axis and the corresponding peak area in the chromatogram as the vertical axis to obtain the standard curve of NMN ( Figure 1 ).

[0050] The NMN in the HPLC detection system was performed under the following conditions:

[0051] Chromatographic column: Agilent ZORBAX Eclipse SB-C18 (4.6 mm×250 mm, 5 µm), mobile phase: methanol: water (pH 6.0) = 6:94, column temperature 30°C, flow rate 1 mL / min, and the concentration of NMN was determined by external standard method at 260 nm using a UV detector.

[0052] Figure 2 These are the reaction HPLC detection diagram and mass spectrum diagram of the EBY-NRK whole-cell catalyst in Example 2, wherein a) is the NMN standard; b) is the catalytic activity detection of the EBY-NRK surface-displayed whole-cell catalyst; and c) is the LC-MS analysis of the catalytic product.

[0053] The prepared recombinant EBY-NRK yeast surface-displayed whole-cell catalyst was used to catalyze NR and ATP to produce NMN. The reaction was carried out at pH 6.0 and 30°C for 3 h. The supernatant was taken for HPLC detection. The test results were as follows: Figure 2 According to the standard curve, the amount of NMN produced was calculated to be 1.109 g / L (3.32 mM), the mass conversion rate was 76.54%, and the molar production rate was 66.4%. The reaction mixture after the catalytic reaction of the EBY-NRK whole cell catalyst was analyzed by LC-MS to verify the production of NMN. Figure 2From c), we can see that NMN (molecular weight 334.2) corresponds to the 3.09-3.24 component of the total ion current, and the mass-to-charge ratio in positive ion mode is 336.16, corresponding to [NMN+2H] + Liquid chromatography and mass spectrometry results showed that the recombinant NRK enzyme was successfully anchored on the surface of Saccharomyces cerevisiae cells and had NMN catalytic activity.

[0054] An important function of enzymes is that they can be recycled, which is beneficial to their industrial application. In order to test the stability of the reuse of yeast whole cell enzyme preparations, multiple cycles of reactions were carried out and the molar production rate of ATP was determined by HPLC. The reaction system was the same as above. After the reaction, the whole cell catalyst and the reaction substrate were separated by centrifugation, washed once with PBS and then re-introduced into a new round of reaction. This was repeated 5 times, and the enzyme activity was measured after each reaction. The initial reaction enzyme activity was taken as 100% for conversion and plotting. Figure 3 The results showed that under the condition of a reaction time of 3 h per reaction, the whole-cell enzyme preparation retained 73.24% of the original enzyme activity after one recycling. The rate of decrease in catalytic activity slowed down from the 2nd to the 5th time, and the activity still remained >50% after the 5th recycling, indicating good reusability.

[0055] Example 3 Optimization of enzyme production conditions of recombinant Saccharomyces cerevisiae EBY-NRK

[0056] The enzymatic activity of the surface-displayed enzyme will be affected by the growth of the strain itself, the induced expression of the displayed enzyme, and the microenvironment of the reaction (temperature, pH value, substrate concentration, etc.). Therefore, in order to further improve the activity of the recombinant EBY-NRK whole-cell enzyme preparation, the induced expression conditions of the recombinant Saccharomyces cerevisiae surface display were further optimized to improve the NMN synthesis efficiency.

[0057] Figure 4 These are the results of optimizing the enzyme production conditions for EBY-NRK in Example 3, wherein a) is a CAA concentration diagram; b) is a YNB concentration diagram; c) is an initial induced biomass diagram; d) is an inducer concentration diagram; e) is an induction temperature diagram; and f) is a diagram showing the effect of induction pH on enzyme production by Saccharomyces cerevisiae EBY-NRK.

[0058] 1. Optimization of culture medium conditions: The nutrients in the culture medium have a great influence on the growth and enzyme production of the strain. The effect of CAA concentration on the growth and enzyme production of the strain was studied in the range of 0.2-1.2%. The results are as follows: Figure 4 As shown in a), the biomass of the strain increased with the increase of CAA concentration, but the specific enzyme activity was the highest at 0.8% CAA concentration, which was 0.538 U / mg. The effect of the increase of YNB concentration on the growth of the strain was less than that of CAA, and the specific enzyme activity was the highest at 10.1 g / L YNB concentration ( Figure 4b)), which is 0.489 U / mg. CAA and YNB are the main nutrients in the culture medium. Appropriate increase in concentration has a positive effect on the enzyme production of the strain. However, as the concentration continues to rise, it will inhibit the enzyme production of the strain. The possible reason is that the oxygen consumption caused by excessive biomass inhibits the enzyme production of the strain.

[0059] 2. Optimization of initial induced biomass. When other conditions are the same, too low or too high initial biomass is not conducive to the enzyme production of the strain. If the induction starting point is too low, the EBY-NRK whole-cell catalyst obtained is less; and if the induction starting point is too high, the strain biomass is too high, which affects the enzyme production of the strain. 600 =0.8, the highest specific enzyme activity of the whole cell catalyst was 0.450 U / mg ( Figure 4 c). Therefore, the initial resuspension OD should be controlled in subsequent induction. 600 =0.8.

[0060] 3. Optimization of inducer concentration. pYD1 controls the expression of the target gene through the galactose promoter. Its expression is inhibited in the presence of glucose. At the same time, galactose is also the main carbon source in the culture medium. Therefore, appropriately increasing the galactose concentration is beneficial to the growth and enzyme production of the strain. When the mass content of galactose in the culture medium is 2.5%, the specific enzyme activity is the highest, which is 0.516U / mg ( Figure 4 d)). However, if the galactose concentration is further increased, the enzyme production capacity of the strain will decrease. Therefore, both too high and too low inducer concentrations are not conducive to the induction of enzyme production of the strain.

[0061] 4. Optimization of induction temperature. The results of strain culture and enzyme production at different temperatures are as follows: Figure 3-5 As shown in the figure, within the range of 15-30℃, as the temperature increases, the biomass accumulation of the strain also continues to increase, but the enzyme production trend of the strain is not completely consistent with the growth trend of the strain. When the culture temperature is 20℃, the specific enzyme activity of the EBY-NRK whole cell catalyst obtained is the highest, which is 0.456 U / mg ( Figure 4 e)), so the subsequent experiments should choose to induce EBY-NRK to produce enzyme at 20℃.

[0062] 5. Optimization of induction pH. Saccharomyces cerevisiae can grow in a wide pH range (2.5-8.0) and is acidophilic. The optimal growth pH is about 4-6. The growth and enzyme production of Saccharomyces cerevisiae EBY-NRK strain were studied in the pH range of 4.5-8.0. The results showed that the engineered bacteria can grow well in the range of 4.5-7.0, and the enzyme production effect is best in the pH range of 5.5-6.0 ( Figure 4 (f)).

[0063] In summary, the optimal enzyme production conditions for EBY-NRK were: 0.8% CAA, 1.01% YNB, initial induced biomass OD 600 =0.8, 2.5% galactose, induction temperature 20℃, induction pH between 5.5-6.0. Under the optimal conditions, the expression of EBY-NRK was induced, and the optimal enzyme activity was 0.559 U / mg, which was 22.39% higher than the enzyme activity before optimization of 0.460±0.004 U / mg. The optimized EBY-NRK was used to catalyze the production of NMN, with a production of 4.13 mM (1.38 g / L), and the molar production rate increased from the initial 60.40% to 82.60% (such as Figure 5 ).

[0064] Example 4 Construction and expression of recombinant Saccharomyces cerevisiae EBY-PPK

[0065] After the PPK enzyme gene (SEQ ID NO: 2) was optimized for codon preference in Saccharomyces cerevisiae, the two ends were added EcoR I and Xol The restriction site of Ⅰ was inserted into plasmid pYD1 (plasmid vector pYD1) to construct recombinant plasmid pYD1-PPK. The recombinant plasmid was commissioned to be synthesized by Shenggong (Shanghai) Biological Co., Ltd. The transformation of the recombinant plasmid and the screening and cultivation steps of the recombinant Saccharomyces cerevisiae were the same as in Example 1.

[0066] The positive clones after colony PCR verification were picked and inoculated into Sc liquid medium (containing 0.67 wt% YNB, 2 wt% glucose, 2 wt% CAA) and cultured at 30°C, 180rpm for 18-22h. The cells were collected by centrifugation, washed twice with sterile PBS, resuspended in Sc liquid medium (containing 0.67 wt% YNB, 2 wt% galactose, 2 wt% CAA) and induced at 20°C, 180rpm for 60-72h. The cells were collected by centrifugation, washed twice with physiological saline, and the supernatant was discarded. The cells were vacuum freeze-dried at -45°C for 48h to obtain the freeze-dried cells, which were the EBY-PPK whole-cell catalysts and stored at 4°C for future use.

[0067] Add 3 mg / mL EBY-PPK enzyme to a 5 mL reaction bottle, and add 6 mM ADP, 9 mM sodium hexaphosphate (phosphate donor), and 5 mM MgCl2 in sequence. After reacting for 10 min at pH 6.0 and 30°C, centrifuge and filter the supernatant through a 0.22 μm filter membrane to determine whether a product is generated by HPLC, and calculate the molar generation rate of ATP.

[0068] The molar generation rate is calculated as follows:

[0069] .

[0070] Prepare ATP / ADP standard solutions with concentrations of 0.05, 0.5, 1, 2, 5, and 6 mM, respectively, and detect them by HPLC. Plot the concentration of ATP / ADP as the horizontal axis and the corresponding peak area as the vertical axis to plot the ATP ( Figure 6 a)) / ADP( Figure 6 b) Standard curve.

[0071] ATP and ADP in the detection system were detected by HPLC under the same conditions as in Example 2, and the concentrations of ATP and ADP were determined by external standard method at 260 nm using a UV detector.

[0072] Figure 7 It is a liquid phase detection result diagram of the catalytic activity of the whole cell enzyme of EBY-PPK in Example 4; wherein a) is a diagram of the ATP standard; b) is a 0 min reaction control diagram; and c) is a diagram of the EBY-PPK reaction result after 10 min.

[0073] The HPLC detection spectrum of the catalytic activity of the crude EBY-PPK enzyme is as follows: Figure 7 As shown in the figure (reaction system: 3 mg / mL whole cell catalyst, 6 mM ADP, 9 mM sodium hexaphosphate as phosphate donor and 5 mM MgCl2 at 30°C for 10 min), 3 mg / mL crude enzyme converted 6 mM ADP into 5.54 mM ATP within 10 min by HPLC detection and calculation, and the ATP molar yield was 90.33%. Liquid phase results showed that the recombinant PPK enzyme was successfully anchored on the surface of Saccharomyces cerevisiae cells and had the activity of catalyzing the synthesis of ATP.

[0074] SEQ ID NO:2 is:

[0075] ATGAACGTTAATAAATATAAGATAGAAGGGAATAAGGAAATTAAGTTAAAAAACTACCCAACCTCCGAAGATCATGGCTTTTCTGAAGAGGAATTGTTGGACCATCATATCCCTGAGTCAATTTCAAAATTGAAAGATTTGCATTGGAAACTGCATGCAGATGAGAAAAAAGGGATAGTGGTCGTTCTGCAGGCGATGGACGCCGCCGGTAAGGACGAGGCGATTTCATATATCTTCTCAAACCTAAATGCACAGGGTTTGAAAACTACTAGCTTTCAAAAGCCTTCCGACACTGAAAGAAACCACGATTATTTGTGGCGTATTCGTGAAGGTTTACCTGAACGTGGCCAGGTAGGTATTTTAAATAGATCTCATTATGAAGATGTGATTGCTCCAAGGGTTCATGATTTGCTTGAAGAAGGAACTATTCCCGACGACAAGGACGAACACGAAGTTTGGAAGATGAGATACAGACAGATCAAAGATTTCGAAAGATATATGGTGGAAAACGGATTCGAAGTCGTCAAATTCTTTTTCAATATGAGCAAAGAAGAACAAAAAAACAGGTTGTTGGAAAGAATGAAAAATCCTAAAAAGAATTGGGAATTTAGTTTCTCTGACGTAGAAGAAAGGGAGCACTGGGATTCTTATCAGCATATCTTTGAGGATATGTTGAACAATACCAGCACCGAATATGCCCCATGGCACATATTGCCGGCCGACGACGAATGGTACAGCCGTTATATAATCACTGAGACCATGATCGAATGTCTAGAGAAAATCGATCCTCAATTTCCTGAGATATCTGAGGAAAACAGAAAAAAGTTGGACGAATATATT GAAAAATTGGAGAAAGAG。

[0076] Example 5 Dual-enzyme Coupled "One-pot" Catalytic Synthesis of NMN

[0077] The ability of the EBY-NRK whole-cell catalyst-coupled ATP regeneration system to synthesize NMN was preliminarily verified by adding 20 mg / mL EBY-NRK, 5 mg / mL EBY-PPK, 5 mMNR, 9 mM sodium hexaphosphate, and 2 mMMgCl2 in sequence. The initial ATP addition amount was 1.2 mM. The reaction was carried out at 30°C and pH 6.5 for 4 h, and the molar yield of NMN was 55.50%. During the reaction, part of the ATP was converted into AMP, resulting in a lower amount of ATP actually circulating.

[0078] The addition ratio between substrate and enzyme was properly adjusted. When the NR concentration was 5mM and the concentrations of other substrates remained unchanged, the addition amount of EBY-NRK enzyme was increased to 25 mg / mL, and the addition amount of EBY-PPK enzyme was increased to 10 mg / mL, and the molar generation rate of NMN was increased to 68.35%; on the basis of appropriately increasing the amount of enzyme, in order to ensure the efficient reaction and smooth regeneration of ATP, the substrate concentration ATP concentration was increased to 1.5mM, and the phosphate donor concentration was increased to 15mM, and the molar generation rate of NMN was increased to 73.7%. Under the above conditions, the initial addition amount of NR was increased to 25mM, and the concentrations of other substrates were increased in proportion. After 4 hours of reaction, the concentration of NMN was 20.7mM (6.91g / L), and the molar generation rate of NMN was 82.80% ( Figure 8 , Figure 8 The optimal conditions are: 25 mg / mL EBY-NRK, 10 mg / mL EBY-PPK, 5mM NR, 1.5 mM ATP, 15 mM phosphate donor, 2 mMMgCl2, 30°C, pH 6.5). After the introduction of the ATP regeneration system, the amount of ATP added was reduced by 75% compared with the initial conditions, and the cost was significantly reduced. The results show that after the EBY-NRK whole-cell catalyst is coupled with the ATP regeneration system, the synthesis of NMN can be more efficiently catalyzed at a lower cost.

[0079] In summary, the dual-enzyme surface display strategy disclosed in the present invention not only efficiently catalyzes NR to synthesize NMN, but also develops a whole-cell catalyst displayed on the surface of recombinant yeast, and also solves the problem of by-product accumulation and feedback inhibition transformation in the biosynthesis process of NMN by coupling the ATP regeneration system, thereby achieving a good NMN product generation rate while effectively reducing costs, and has a high reference value for the industrial production and application of NMN.

[0080] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for producing nicotinamide mononucleotide by dual enzyme "one-pot" catalysis, characterized in that: The following steps are involved: S1. Construction of two recombinant Saccharomyces cerevisiae surface display strains; S2, culturing the two recombinant Saccharomyces cerevisiae surface display strains constructed in S1 respectively, collecting bacterial cells by centrifugation after culturing in the culture medium, and lyophilizing to obtain EBY-NRK whole cell enzyme preparation and EBY-PPK whole cell catalyst respectively; S3, EBY-NRK whole cell enzyme preparation, EBY-PPK whole cell catalyst, nicotinamide riboside NR, adenosine triphosphate ATP, phosphate donor and Mg-containing 2+ The substances mix and react to produce NMN; In S1, in the construction of two recombinant Saccharomyces cerevisiae surface display strains, plasmid pYD1 was used as a vector to overexpress nicotinamide riboside kinase and polyphosphate kinase; S1 specifically comprises: inserting the nicotinamide riboside kinase gene into the plasmid vector pYD1 to construct a recombinant plasmid pYD1-NRK, and transferring the recombinant nicotinamide riboside kinase into Saccharomyces cerevisiae EBY100 to realize the surface display of the recombinant nicotinamide riboside kinase on the surface of Saccharomyces cerevisiae to obtain the recombinant Saccharomyces cerevisiae EBY100 / pYD1-NRK, wherein the nicotinamide riboside kinase gene is shown in SEQ ID NO: 1; Inserting the polyphosphatase gene into the plasmid vector pYD1 to construct a recombinant plasmid pYD1-PPK, and transferring the plasmid into Saccharomyces cerevisiae EBY100 to display the recombinant polyphosphatase on the surface of Saccharomyces cerevisiae to obtain recombinant Saccharomyces cerevisiae EBY100 / pYD1-PPK, wherein the polyphosphatase gene is shown in SEQ ID NO: 2; In step S3, the amount of EBY-NRK whole cell enzyme preparation added to the reaction system is 20-25 mg / mL; the amount of EBY-PPK whole cell catalyst added is 10-15 mg / mL; the amount of nicotinamide riboside NR added is 5-7 mM; the amount of adenosine triphosphate ATP added is 1-2 mM; the amount of phosphate donor added is 10-15 mM; and the amount of Mg-containing 2+ The amount of the substance added is 2-5 mM, and the Mg-containing 2+ The substance is MgCl2; In step S3, the amount of EBY-NRK whole cell enzyme preparation added to the reaction system is 25 mg / mL; the amount of EBY-PPK whole cell catalyst added is 10 mg / mL; the amount of nicotinamide riboside NR added is 5 mM; the amount of adenosine triphosphate ATP added is 1.5 mM; the amount of phosphate donor added is 15 mM; and the amount of Mg-containing 2+ The amount of the substance added was 2 mM, and the Mg-containing 2+ The substance is MgCl2; In step S3, the phosphate donor is sodium hexaphosphate; In step S3, the reaction is carried out at 25-30° C., 180-200 rpm, and pH 6.0-7.0 for 3-6 hours; In S2, the culture medium is a Sc liquid culture medium, wherein the Sc liquid culture medium contains 1.5 wt %-2.5 wt % glucose or 2 wt %-2.5 wt % galactose, 0.67 wt %-1.34 wt % yeast-amino-free nitrogen source, and 2 wt %-2.5 wt % acid-hydrolyzed casein; In S2, the culture conditions are: in a glucose-containing Sc liquid medium, culture at 28-30°C and 180-200 rpm for 18-22 h, then transfer to a galactose-containing Sc liquid medium, and induce culture at 20-25°C for 60-72 h; In S2, the centrifugation is: 5000-9000 rpm, 0-8°C for 8-10 min.

Images