Molecular marker and breeding method for breeding eggshell color of Liuyang black-bone chicken

Abstract

The invention provides a molecular marker and a breeding method for breeding the eggshell color of a Liuyang black-bone chicken, and particularly relates to the field of molecular breeding. The invention finds that a missense mutation (C21R) in the ABCG2 gene is associated with the eggshell color variation of the Liuyang black-bone chicken brown shell egg, so that the ABCG2 gene can be used for molecular-assisted breeding of the eggshell color of the Liuyang black-bone chicken brown shell egg. The C21R is a missense mutation occurring on the 21th cysteine of ABCG2 protein, and the C21R is a missense mutation occurring on the 21th cysteine of ABCG2 protein; c, causing. According to the breeding method, the genotype of the C21R locus of an individual to be detected is detected through PCR (Polymerase Chain Reaction) amplification and Sanger sequencing. According to a detection result, CC type individuals are selected and reserved for breeding, and a new black-bone chicken strain capable of laying deep brown shell eggs can be bred in an auxiliary mode; tT type individuals are selected and reserved for breeding, and the new black-bone chicken strain capable of producing light brown shell eggs can be bred in an auxiliary mode. The method provided by the invention solves the problem of inconsistent egg color caused by gene mutation of the existing Liuyang black-bone chickens, can greatly shorten the breeding time of a new black-bone chicken strain for laying eggs with specific brown shell color, and reduces the breeding cost.

Description

Technical Field

[0001] The invention relates to the field of molecular breeding, and in particular to a molecular marker and a breeding method for breeding the shell color of Lueyang black chicken eggs. Background Art

[0002] Lueyang black-bone chicken is a local poultry breed unique to Shaanxi Province. This breed has the advantages of large size, good egg and meat quality, rich nutrition, therapeutic health care function, and strong adaptability to woodland grazing. Due to the lack of hybrid breeding, the average annual egg production of Lueyang black-bone chicken is 150.3±32.8 eggs, the average egg weight is 48.2±12.3g, and the feed-egg ratio at 26-30 weeks of age is 2.85±0.41. Its egg-laying performance is much lower than that of current commercial laying chicken breeds. In addition to poor egg-laying performance, Lueyang black-bone chicken also has large variability in egg-laying performance and egg quality indicators. Taking eggshell color as an example, Lueyang black-bone chicken mainly produces brown-shelled eggs, but in terms of brown tones, there are multiple color variations such as brown, light brown, brown-brown, brown-green, and gray-brown. If sold as ordinary black-bone chicken eggs with mixed egg colors, the price is about 6 yuan / jin, the cost is 4.8 yuan / jin, and the net profit is 1.2 yuan / jin. If the black-egg eggs with uniform egg color, egg weight and egg shape are manually selected and sold as branded eggs, the price is about 10 yuan per catty, and the net profit increases by more than 4 times. However, this sales model increases labor costs, and the remaining eggs are still sold as ordinary eggs. On the basis of identifying molecular markers significantly associated with brown shell color variation, establishing a molecular-assisted breeding program and cultivating a new Lueyang black-egg chicken strain with uniform egg color is an effective way to solve the above-mentioned egg production problems.

[0003] In summary, how to identify a new strain of Lueyang black-bone chicken that is significantly correlated with eggshell color and can be used for molecular-assisted breeding of uniform egg color is a difficult problem that needs to be overcome in this application. Summary of the invention

[0004] The main purpose of the present invention is to provide a molecular marker and breeding method for the egg shell color selection of Lueyang black chickens, so as to obtain a new Lueyang black chicken strain with uniform egg color through molecular breeding, so as to solve the problem that the sales profit of Lueyang black chickens is affected by the egg color variation.

[0005] In order to achieve the above-mentioned purpose, the present invention provides a molecular marker and breeding method for the egg shell color selection of Lueyang black chicken, so as to obtain a new Lueyang black chicken strain with uniform egg color through molecular breeding.

[0006] In the first aspect, the present invention provides a molecular marker C21R for the eggshell color selection of Lueyang black-bone chicken brown-shell eggs, wherein the molecular marker C21R is a missense mutation occurring at the 21st cysteine ​​of the ABCG2 protein, wherein the missense mutation is caused by SNP g.17548092T>C, the ABCG2 protein is encoded by the ABCG2 gene, the position of the SNP in the chicken galGal5.0 reference genome is Chr6:17548092, the T of the SNP g.17548092T>C is a wild-type allele, the T is used to encode the 21st cysteine ​​(C), C is a mutant allele, and the C is used to encode the 21st arginine (R).

[0007] Specifically, the C forms a CC genotype, and the T forms a TT genotype, wherein the CC genotype is associated with dark brown shells, and is used for the molecular assisted breeding of a new strain of Lueyang black-bone chicken that produces dark brown shell eggs; the TT genotype is associated with light brown shells, and is used for the molecular assisted breeding of a new strain of Lueyang black-bone chicken that produces light brown shell eggs.

[0008] In a second aspect, the present invention provides a primer pair for detecting the molecular marker C21R in the first aspect, wherein the primer pair is used to specifically amplify a DNA fragment containing a C21R mutation site.

[0009] In a third aspect, the present invention provides a method for detecting the C21R genotype in the ABCG2 gene of Lueyang black-bone chicken using the primer pair described in the second aspect, the detection method comprising the following steps:

[0010] Step S1: using the DNA of Lueyang black-bone chicken as a template, using the primer pair to perform PCR amplification, and using the DNA fragment containing the C21R mutation site obtained by PCR amplification as a PCR amplification product;

[0011] Step S2: performing agarose gel electrophoresis on the PCR amplification product obtained in step S1 to confirm the specificity and concentration of the PCR amplification product;

[0012] Step S3: Determine whether the specificity and concentration of the PCR amplification product meet the Sanger sequencing requirements. If yes, execute step S4; if not, return to execute step S1;

[0013] Step S4: The PCR amplification product obtained in step S1 is sequenced by the Sanger sequencing, and the genotype of the individual to be tested at the C21R site is detected according to the sequencing result, so as to distinguish CC type, CT type and TT type individuals.

[0014] In a fourth aspect, the present application provides a method for breeding brown-shell eggshell color based on the molecular marker C21R described in the first aspect, the breeding method comprising the following steps:

[0015] Step T1: using the primer pair described in the second aspect and the detection method described in the third aspect to detect the genotype of C21R in the ABCG2 gene of the black-bone chicken individual;

[0016] Step T2: According to the test results, CC-type individuals are selected for breeding to obtain a new strain of black-bone chickens that lay dark brown shell eggs; or TT-type individuals are selected for breeding to obtain a new strain of black-bone chickens that lay light brown shell eggs.

[0017] Optionally, the breeding method is implemented at the chick stage.

[0018] The present application provides a molecular marker, a primer pair, a detection method and a breeding method for brown-shell egg shell color selection. The breeding method detects the genotype of C21R in the ABCG2 gene of a black-bone chicken individual through PCR amplification and Sanger sequencing based on the primer pair and the molecular marker C21R; based on the detection result, CC-type individuals are selected for breeding to obtain a new black-bone chicken strain that lays dark brown-shell eggs; or TT-type individuals are selected for breeding to obtain a new black-bone chicken strain that lays light brown-shell eggs, wherein the molecular marker C21R is a missense mutation on the 21st cysteine ​​in the ABCG2 gene, and the primer pair includes a forward primer sequence 5'-GTCACCTCAGAAACCCTCAT-3' and a reverse primer sequence 5'

[0019] -CCACAGTCTTCCGTCTACAT-3'. The present invention provides a molecular-assisted breeding method for the egg shell color breeding of Lueyang black chickens, significantly shortens the breeding process of a new Lueyang black chicken strain with uniform egg color, and reduces the breeding cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0021] Figure 1 A schematic diagram of the genotype results of the C21R locus of the molecular marker detected by Sanger sequencing provided in this application;

[0022] Figure 2 A schematic flow chart of a detection method for detecting the C21R genotype in the ABCG2 gene of Lueyang black-bone chicken using a primer pair provided in the present application;

[0023] Figure 3 A schematic diagram of the process of breeding brown-shell eggshell color based on the molecular marker C21R provided in this application;

[0024] Figure 4 A schematic diagram of the comparison of the three colorimetric indices provided in this application between C21R genotypes;

[0025] Figure 5 The present application provides a schematic diagram of the agarose gel electrophoresis detection results of the PCR amplification products of the C21R site.

[0026] The above drawings have shown clear embodiments of the present application, which will be described in more detail later. These drawings and text descriptions are not intended to limit the scope of the present application in any way, but to illustrate the concept of the present application to those skilled in the art by referring to specific embodiments. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of this application clearer, the technical solutions in this application will be clearly and completely described below in conjunction with the drawings in this application. Obviously, the described embodiments are part of the embodiments of this application, not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0028] In the present invention, words such as "exemplary" or "for example" are used to indicate examples, illustrations or descriptions. Any embodiment or design described as "exemplary" or "for example" in this application should not be interpreted as being more preferred or more advantageous than other embodiments or designs. Specifically, the use of words such as "exemplary" or "for example" is intended to present related concepts in a specific way.

[0029] Lueyang black-bone chicken is a local poultry breed unique to Shaanxi Province. This breed has the advantages of large size, good egg and meat quality, rich nutrition, therapeutic health care function, and strong adaptability to woodland grazing. Since no foreign blood has been introduced to improve egg-laying performance using hybrid advantages, Lueyang black-bone chickens lay an average of 150.3±32.8 eggs per year, with an average egg weight of 48.2±12.3g and a feed-egg ratio of 2.85±0.41 at 26-30 weeks of age. Its egg-laying performance is much lower than that of current commercial egg-laying chicken breeds, and there is a large population variation in egg-laying performance and egg quality indicators. Taking eggshell color as an example, Lueyang black-bone chickens mainly lay brown-shell eggs, but a small number of individuals in the group also lay green-shell eggs. In terms of brown tones, there are multiple color variations such as brown, light brown, brown-brown, brown-green, and gray-brown. If sold as ordinary black-bone chicken eggs with mixed egg colors, the price is about 6 yuan / jin, the cost is 4.8 yuan / jin, and the net profit is 1.2 yuan / jin. Therefore, the brown shell color variation of Lueyang black chicken has an extremely adverse impact on the sales of black chicken eggs and the creation of egg brands, and greatly reduces the net profit from the sales of black chicken eggs.

[0030] Traditionally, black-bone chicken eggs with uniform egg color, egg weight and egg shape are manually selected. If black-bone chicken eggs with uniform egg color, egg weight and egg shape are manually selected and sold as branded eggs, the price is about 10 yuan per catty, and the net profit increases by more than 4 times. However, this sales model increases labor costs, and the remaining eggs are still sold as ordinary eggs. On the basis of identifying molecular markers significantly associated with brown shell color variation, establishing a molecular-assisted breeding program and cultivating a new Lueyang black-bone chicken strain with uniform egg color is an effective way to solve the above-mentioned egg production problems.

[0031] In summary, how to cultivate a new strain of Lueyang black-bone chicken with uniform egg color through molecular breeding is a difficult problem that needs to be overcome in this application.

[0032] The present application provides a molecular marker, a primer pair, a detection method and a breeding method for the selection of brown-shell egg shell color. The breeding method detects the genotype of C21R in the ABCG2 gene of a black-bone chicken individual by PCR amplification and Sanger sequencing detection means according to the primer pair and the molecular marker C21R; according to the detection result, CC-type individuals are selected for breeding to assist in obtaining a new strain of black-bone chickens that produce dark brown-shell eggs; or TT-type individuals are selected for breeding to assist in obtaining a new strain of black-bone chickens that produce light brown-shell eggs, wherein the molecular marker C21R is a missense mutation on the 21st cysteine ​​in the ABCG2 gene, and the primer pair includes a forward primer sequence 5'-GTCACCTCAGAAACCCTCAT-3' and a reverse primer sequence 5'-CCACAGTCTTCCGTCTACAT-3'. The method solves the problem that the existing black-bone chickens have different egg colors due to gene mutations, thereby obtaining a new strain of black-bone chickens with uniform egg color through molecular breeding.

[0033] The technical solution of the present application and how the technical solution of the present application solves the above-mentioned technical problems are described in detail below with specific embodiments. The following specific embodiments can be combined with each other, and the same or similar concepts or processes may not be repeated in some embodiments. The embodiments of the present application will be described below in conjunction with the accompanying drawings.

[0034] Figure 1The present application provides a schematic diagram of the genotype results of the C21R site of the molecular marker detected by Sanger sequencing, which describes in detail the molecular marker C21R used for the eggshell color selection of Lueyang black-bone chicken brown shell eggs. The molecular marker C21R is a missense mutation on the 21st cysteine ​​in the ABCG2 gene, wherein the missense mutation is caused by SNP g.17548092T>C, the ABCG2 protein is encoded by the ABCG2 gene, and the position of the SNP in the chicken galGal5.0 reference genome is Chr6:17548092, and the T of the SNP g.17548092T>C is the wild-type allele, and the T is used to encode the 21st cysteine ​​(C), and C is a mutant allele, and the C is used to encode the 21st arginine (R). The C21R genotype is detected by Sanger sequencing, and the representative results are shown in FIG. Figure 1 As shown. Sanger sequencing can be commissioned to any sequencing company. The red box marks the position of g.17548092T>C, where g.17548092T>C refers to a single nucleotide mutation from T to C at position 17548092 of the genome sequence.

[0035] Further, the present embodiment provides a primer pair for detecting the above molecular marker C21R, the primer pair comprising a forward strand primer sequence 5'-GTCACCTCAGAAACCCTCAT-3' and a reverse strand primer sequence 5'-CCACAGTCTTCCGTCTACAT-3', the primer pair being used to specifically amplify a DNA fragment comprising a C21R mutation site. Before detecting the C21R genotype, the DNA fragment comprising the marker site needs to be amplified by PCR, and the primer pair can be synthesized by commercial pathway chemistry.

[0036] Furthermore, C forms a CC genotype, and T forms a TT genotype, wherein the CC genotype is associated with dark brown shells, and is used for the molecular assisted breeding of a new strain of Lueyang black-bone chicken that produces dark brown shell eggs; the TT genotype is associated with light brown shells, and is used for the molecular assisted breeding of a new strain of Lueyang black-bone chicken that produces light brown shell eggs.

[0037] As can be understood, sequence 1 contains the PCR amplified fragment sequence of the C21R site, the underlined parts are the forward and reverse strand primer binding parts, and the red font marks the SNP (i.e. single nucleotide polymorphism) g.17548092T>C, which causes the cysteine ​​at position 21 of the ABCG2 gene to arginine (missense mutation is recorded as C21R). SNP g.17548092T>C (C21R) is related to the brown shell color variation of black chickens, the CC genotype is associated with dark brown shells, and the TT genotype is associated with light brown shells, which can be used for molecular marker-assisted selection of different brown shell varieties.

[0038] Sequence 1: PCR amplified fragment sequence containing the C21R site.

[0039] GTCACCTCAGAAACCCTCAT GCGGTTGAGTTTGACCTGTGTAACAAGGATGTGATGGCGGACACATTTGATCACAGTGTCATTTCTGTTGGAGAAGAGGAAGGAGCAGACAGTTTCCAACGATCTCTTCCAACACGAGATTCTCTCCGATCCCCTCGAGGCTCCATTGTGAGTTTCCATAACATCCAGTACTCCGTTAAGCAGTCCAGTGGATTCCT ATGTAG ACGGAAGACTGTGG

[0040] Sequence 2: Primer pair used for labeling C21R genotype detection.

[0041] Positive strand: 5′-GTCACCTCAGAAACCCTCAT-3′;

[0042] Reverse strand: 5'-CCACAGTCTTCCGTCTACAT-3'.

[0043] It can be understood that the primer pairs in this embodiment, and other primer pairs involved in amplifying the C21R site, used for detecting the C21R genotype and molecular-assisted breeding of Lueyang black-bone chicken brown-shelled eggs, are all within the scope of protection of this patent.

[0044] The present embodiment proposes a molecular marker C21R for the eggshell color selection of Lueyang black-bone chicken brown-shell eggs. The molecular marker C21R is a missense mutation on the 21st cysteine ​​in the ABCG2 gene, and the missense mutation is caused by SNP g.17548092T>C. The ABCG2 protein is encoded by the ABCG2 gene. The position of the SNP in the chicken galGal5.0 reference genome is Chr6:17548092. The T of the SNP g.17548092T>C is a wild-type allele, and the T is used to encode the 21st cysteine ​​(C). C is a mutant allele, and the C is used to encode the 21st arginine (R). The discovery of molecular marker C21R revealed that SNP g.17548092T>C (C21R) is related to the brown shell color variation of black-bred chickens. The CC genotype is associated with dark brown shells, and the TT genotype is associated with light brown shells. It can be used for molecular marker-assisted selection of different brown shell varieties, thus providing a new and feasible idea for breeding new black-bred chicken strains with uniform egg color.

[0045] Figure 2A schematic flow chart of a detection method for detecting the C21R genotype in the ABCG2 gene of Lueyang black-bone chicken using primer pairs provided in this application; Figure 2 As shown, the use provided by this embodiment Figure 1 The primer pair in the embodiment detects the detection method of the C21R genotype in the ABCG2 gene of Lueyang black-bone chicken, and the detection method comprises the following steps:

[0046] S201: Using the DNA of Lueyang black-bone chicken as a template, using a primer pair to perform PCR amplification, and using the DNA fragment containing the C21R mutation site obtained by PCR amplification as a PCR amplification product.

[0047] PCR amplification refers to polymerase chain reaction (PCR), which is a molecular biology technique for rapidly amplifying specific genes or DNA sequences in vitro. Its basic principle is to simulate the natural replication process of DNA in organisms, and to achieve exponential amplification of DNA fragments in vitro through steps such as denaturation, annealing, and extension.

[0048] The specific implementation process of using primer pairs for PCR amplification can be achieved through the following steps:

[0049] Collect samples: Collect samples such as cells, tissues or blood from the desired black chickens, ensuring that the samples are of good quality and free from contamination.

[0050] DNA extraction: Use appropriate DNA extraction methods to extract DNA from samples. Common extraction methods include phenol-chloroform extraction, high salt method, etc.

[0051] DNA quantification: Measure the concentration of the extracted DNA using a spectrophotometer or fluorometer to ensure that the DNA concentration is appropriate.

[0052] Prepare the PCR reaction system: You can mix the various reagents in the reaction system (including DNA template, primers, dNTPs, polymerase, buffer and water) in appropriate proportions according to the concentration of the components required for the reaction, or you can use Figure 1 The primer pairs in the embodiment were used to perform PCR to amplify a DNA fragment containing C21R. The PCR system was 20 μL, consisting of 10 μL 2×Taq PCRStarMix (Dye) (purchased from GenStar, item number: A012), 0.5 μL 10 μM forward primer, 0.5 μL 10 μM reverse primer, 1 μL template DNA (50 ng) and 8 μL ddH2O. The PCR amplification conditions were 95°C denaturation for 3 min, (95°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 20 sec) × 33 cycles, and 72°C extension for 5 min. The length of the target fragment was 237 bp (see Figure 1 Example sequence 1). The specificity and concentration of the PCR amplification product were detected by 2% agarose gel electrophoresis.

[0053] Optimization of PCR amplification conditions: Adjust the PCR reaction conditions, such as denaturation temperature, annealing temperature, and extension time, according to the length of the DNA fragment and primers used.

[0054] PCR cycles: Set the cycle program of the PCR instrument, including cycles of denaturation, annealing and extension, usually for 25-35 cycles.

[0055] PCR product analysis: Use agarose gel electrophoresis or other appropriate methods to detect PCR amplification products and observe DNA bands to determine whether amplification is successful.

[0056] PCR product purification and sequencing: The PCR product is purified and sequenced to verify the consistency of the amplified DNA sequence with the target sequence.

[0057] S202: The PCR amplification product obtained in step S201 is subjected to agarose gel electrophoresis to confirm the specificity and concentration of the PCR amplification product.

[0058] Among them, the agarose gel electrophoresis detection refers to a commonly used molecular biology technique, which is mainly used for the separation, purification and analysis of nucleic acids (DNA and RNA). Agarose gel electrophoresis is a technology that uses agarose gel as a supporting medium to enable charged particles (such as nucleic acid molecules) to migrate in the gel through the action of an electric field, thereby achieving separation. Agarose gel has a network structure that can produce a molecular sieve effect, so that nucleic acid molecules of different sizes and charges have different migration speeds in the electric field, thereby achieving the purpose of separation.

[0059] The specific implementation process of performing agarose gel electrophoresis detection on the PCR amplification product obtained in step S201 can be achieved by the following steps:

[0060] Reagent configuration: Common electrophoresis buffers include TAE and TBE. Choose the appropriate buffer according to your needs and dilute to the appropriate concentration. To prepare agarose gel, generally use 1% agarose solution, heat to dissolve, cool to an appropriate temperature, add nucleic acid dye (such as ethidium bromide EB or GoldView) and mix well.

[0061] Gel making: Pour the agarose solution into the gel making mold, insert the comb, and pull out the comb after the gel cools and solidifies.

[0062] Loading: Mix the nucleic acid sample to be tested with the loading buffer and carefully add it to the loading well of the gel. At the same time, add a DNA marker or a control DNA of known size to estimate the size of the nucleic acid fragments in the sample.

[0063] Electrophoresis: Place the gel in the electrophoresis tank and add electrophoresis buffer, making sure the buffer covers the surface of the gel. Turn on the power, set the appropriate voltage and current, and start electrophoresis. Adjust the electrophoresis time according to the size of the nucleic acid fragment and the electrophoresis conditions until the band moves to the appropriate position of the gel.

[0064] Observation results: Figure 5 As shown, Figure 5 The present application provides a schematic diagram of the agarose gel electrophoresis detection results of the C21R site PCR amplification product, which is used to observe the electrophoresis results in a gel imaging system in this embodiment, confirm the specificity and concentration of the PCR amplification product based on the electrophoresis detection results, and record and analyze the size and integrity of the nucleic acid fragments.

[0065] S203: Determine whether the specificity and concentration of the PCR amplification product meet the Sanger sequencing requirements. If so, execute step S204; if not, return to execute step S201.

[0066] Wherein, genotype analysis technology is used to detect the genotype of the individual to be tested at the C21R site, and the genotype analysis technology includes but is not limited to the following methods: PCR-RFLP, PCR-SSCP, Sanger sequencing, MassARRAY mass spectrometry and genome sequencing. The specific implementation process of judging whether the specificity and concentration meet the requirements is: according to the specificity and concentration of the PCR amplification product confirmed in step S202, compared with the specificity and concentration set according to actual needs, if the specificity and concentration of the PCR amplification product confirmed in step S202 meet the specificity and concentration set according to actual needs, then the PCR amplification product obtained in step S201 is subjected to Sanger sequencing, and the genotype of the C21R site is determined by the sequencing result, thereby distinguishing CC type, CT type and TT type individuals, if the specificity and concentration of the PCR amplification product confirmed in step S202 do not meet the specificity and concentration set according to actual needs, then return to execute step S201, use the DNA of black chicken as a template, and use primer pairs to re-perform PCR amplification.

[0067] S204: The PCR amplification product obtained in step S201 is sequenced by Sanger sequencing, and the genotype of the individual to be tested at the C21R site is detected according to the sequencing result, so as to distinguish CC type, CT type and TT type individuals.

[0068] Among them, the gene analysis technology is used to detect the genotype of the individual to be tested at the C21R site, and the gene analysis technology includes: PCR-RFLP, PCR-SSCP, Sanger sequencing, MassARRAY mass spectrometry, second-generation genome sequencing technology, etc. In this embodiment, Sanger sequencing can be used to detect the genotype of the individual to be tested at the C21R site, and the above-mentioned other genotype detection technologies can also be used to detect the genotype of the individual to be tested at the C21R site. The specific method to be adopted is determined according to actual needs and is not limited here. It is worth mentioning that other DNA fragments containing the C21R site obtained by using the above-mentioned other genotype detection technologies are used for the breeding of eggshell color of Lueyang black-bone chicken brown shell eggs, which are all within the protection scope of the present invention.

[0069] In this step, the Sanger sequencing method used in the present embodiment utilizes DNA polymerase to extend the primer pair until a chain termination nucleotide is mixed. This process is realized by adding four kinds of deoxynucleotide triphosphates (dNTP) and a limited dideoxynucleoside triphosphate (ddNTP) in the reaction system. Because ddNTP lacks the required 3'-OH group for extension, the oligonucleotide of extension is selectively terminated at G, A, T or C. Like this, each sequence determination is made up of a set of four independent reactions, and each reaction can produce a group of chain termination products ending with different bases (A, T, C, G), each of which differs by one base in length. These products are separated by high-resolution denaturing gel electrophoresis subsequently, and are sorted according to their length, and finally detected by X-ray film radioautography or non-isotope labeling after the gel treatment, thereby determining the genotype of the C21R site by sequencing result, thereby distinguishing CC type, CT type and TT type individuality.

[0070] Furthermore, the conditions for PCR amplification include: denaturation at 95°C for 3 minutes; 33 cycles, each cycle including denaturing the DNA at 95°C for 30 seconds, followed by annealing the primers to the DNA template at 60°C for 30 seconds, and finally extending the DNA chain at 72°C for 20 seconds; and extending at 72°C for 5 minutes.

[0071] Furthermore, the electrophoresis detection conditions include: 100V electrophoresis for 40 minutes, and EB staining.

[0072] Among them, EB staining, namely Ethidium Bromide (EB) staining, is a commonly used biological experimental technique, mainly used for the detection and observation of DNA and RNA.

[0073] It is understandable that any other methods involving C21R locus genotype detection, methods for breeding brown-shell eggs of Lueyang black-bone chickens, and kits developed around these methods are within the scope of protection of this patent. Figure 1 The primer pairs and Figure 2 Other DNA fragments containing the C21R site obtained by the detection method in the embodiment or other methods, such as those used for eggshell color selection of Lueyang black-bone chicken brown-shell eggs, are within the protection scope of the present invention.

[0074] This embodiment proposes a method of using Figure 1 The primer pair in the embodiment detects the detection method of the C21R genotype in the ABCG2 gene of Lueyang black-bone chicken. The method uses the DNA of Lueyang black-bone chicken as a template, uses the primer pair to perform PCR amplification, and uses the DNA fragment containing the C21R mutation site obtained by PCR amplification as a PCR amplification product; the PCR amplification product is subjected to agarose gel electrophoresis detection to confirm the specificity and concentration of the PCR amplification product; it is judged whether the specificity and concentration meet the requirements of Sanger sequencing, if so, the PCR amplification product is subjected to Sanger sequencing, and the genotype of the individual to be tested at the C21R site is detected according to the sequencing result, so as to distinguish CC type, CT type and TT type individuals, if not, the DNA of black-bone chicken is used as a template again, and the primer pair is used to perform PCR amplification to obtain a PCR amplification product that meets the requirements. CC type, CT type and TT type individuals are distinguished by this method, thereby providing a basis for subsequent breeding.

[0075] Figure 3 The schematic diagram of the process of breeding brown-shell eggshell color based on the molecular marker C21R provided in this application is as follows: Figure 3 As shown, the present embodiment provides Figure 1 The method for breeding brown-shell eggshell color with the molecular marker C21R described in the embodiment comprises:

[0076] S301:Use Figure 1 The primer pairs described in the examples and Figure 2 The detection method described in the embodiment detects the genotype of C21R in the ABCG2 gene of black-bone chicken individuals.

[0077] Among them, the specific implementation method of the detection method for measuring the genotype of C21R in the ABCG2 gene of black-bone chicken individuals is: using the DNA of the black-bone chicken as a template, using the primer pair to perform PCR amplification, using the DNA fragment containing the C21R mutation site obtained by PCR amplification as the PCR amplification product, and performing agarose gel electrophoresis detection on the PCR amplification product to confirm the specificity and concentration of the PCR amplification product, and judging whether the specificity and concentration meet the requirements; if so, performing Sanger sequencing on the PCR amplification product, and determining the genotype of the C21R site through the sequencing results, thereby distinguishing CC type, CT type and TT type individuals; if not, using the DNA of the black-bone chicken as a template, using the primer pair to re-perform PCR amplification.

[0078] S302: According to the test results, CC type individuals are selected for breeding to obtain a new strain of black-bone chickens that lay dark brown shell eggs; or TT type individuals are selected for breeding to obtain a new strain of black-bone chickens that lay light brown shell eggs.

[0079] The detection result can be that the genotype of the C21R locus is determined by step S301, thereby distinguishing CC type, CT type and TT type individuals. By selecting CC type, CT type and TT type individuals and breeding and cultivating the selected individuals, a new strain of black-bone chickens that lay dark brown shell eggs or a new strain of black-bone chickens that lay light brown shell eggs is obtained.

[0080] Optionally, the above breeding method is implemented in the chick stage, and the specific implementation process can refer to the following Examples 1 and 2.

[0081] The present invention is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, but not for limiting the scope of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0082] Example 1: Correlation between C21R and the L value of black chicken egg shell color

[0083] Dark brown, light brown, brownish brown, brownish green, etc. are all qualitative and descriptive records of eggshell color variation. This trait recording method is very subjective and is not conducive to inter-group comparison and genetic basis research. The present invention uses the L value (brightness) value in the L*a*b color space to quantify the brown shell variation, which can objectively and quantitatively record the variation of the light and dark brown shell of black-bone chicken, laying a foundation for marker screening and breeding.

[0084] 1. Experimental samples and culture conditions

[0085] The samples used in this study (n = 381) were randomly selected from 61 half-sib families of four generations of the core breeding group of black-bred chicken egg breeding in Longhao Black-bred Chicken Seed Provenance and Breeding Center in Lueyang County. All individuals were hatched in the same batch and raised in the same chicken house. The brooding temperature was 33-35℃ in the first week, and then decreased by 2-3℃ every week, and weaned in the fourth week; the light duration was 22h in the first week, and then decreased by 1-1.5h every week. They were transferred to the laying hen house at 60 days old and raised in individual cages. Commercial complete feed (Haida) was used for feeding at all stages, and food and water were available freely.

[0086] 2. Eggshell color determination

[0087] Brown shell color variation was quantified using the L*a*b color space. The L value ranges from 0 to 100. The darker the object, the smaller the value, and the whiter the object, the larger the value. The a value is the red-green degree, with no value range restriction. The smaller the negative value, the greener the object, and the larger the positive value, the redder the object. The b value is the blue-yellow degree, with no value range restriction. The smaller the negative value, the bluer the object, and the larger the positive value, the yellower the object. The L*a*b value was measured using a MiniScan EZ 4000 portable colorimeter (Hunter Associates Laboratory, Inc.) under D65 standard light source and 10° incident angle. At 31 weeks of age, three consecutive eggs were collected from each hen, and the color value of the blunt end was measured. The mean of the three eggs was used as the representative value of the eggshell color of the sample for subsequent correlation analysis.

[0088] 3. DNA Extraction

[0089] Blood was collected from the subwing vein, anticoagulated with ACD (1:4), and genomic DNA was extracted using a blood genomic non-column extraction kit (Kangwei Century, catalog number: CW0544M) according to the kit instructions. The integrity of the obtained DNA was tested by 1% agarose gel electrophoresis, and the concentration of DNA was determined by NanoDrop 2000 (Thermo) spectrophotometer, and the concentration of DNA was adjusted to 50 ng / μL for use.

[0090] 4. Genotype detection method

[0091] The above primers were used to amplify the DNA fragment containing the C21R site according to the above PCR amplification system and conditions. After the specificity and concentration of the PCR amplification product were detected by agarose gel electrophoresis, Sanger unidirectional sequencing was performed with the reverse strand primer. The sequencing result file was viewed with ChromasPro software to record the genotype of C21R in each sample.

[0092] 5. Data Statistical Analysis

[0093] One-way ANOVA was used to test the association between the C21R genotype effect and each color index, and the Duncan multiple comparison method was used to test the significance of the difference between genotypes. The significance level was 0.05. One-way ANOVA and multiple comparisons were performed using the ANOVA program in SASUniversity Edition software.

[0094] 6. Results

[0095] like Figure 4 As shown, Figure 4The schematic diagram of the comparison of the three chromaticity indices provided in this application between C21R genotypes, the three chromaticity indices are compared between C21R genotypes, C21R (g.17548092T>C) is significantly associated with L value (F=8.89, P=0.0002) and b value (F=3.31, P=0.0377), but the association with a value is not significant. In terms of L value, TT type (78.0±4.4) is the lightest in color, TC type (76.6±4.3) is in the middle, and CC type (75.3±4.0) is the darkest in color, and there are significant differences between each genotype. In terms of b value, CC type (16.2±3.5) eggshells are biased towards yellowness, and TT type (14.7±3.2) eggshells are bluish.

[0096] Figure 4 Each scatter point in the figure represents the measured value of a sample, the black diamond square is the average value of each genotype, and the thin lines on both sides represent the standard deviation within the genotype group. The letters in the scatter plot indicate the results of multiple comparisons between genotype groups. The same letters indicate no significant difference between groups (P>0.05), and different letters indicate significant difference between groups (P<0.05).

[0097] Example 2: Comparison of the selection effects of traditional phenotypic selection and marker-assisted selection

[0098] 1. C21R molecular assisted breeding program

[0099] According to the results of genotype testing, two CC roosters and 16 CC hens were selected from the fourth generation of the egg-laying breeding core group raised by Lueyang Longjia Company to form two half-sib families with a male-to-female ratio of 1:8; two TT roosters and 16 TT hens were selected to form two half-sib families with a male-to-female ratio of 1:8.

[0100] 2. Traditional phenotypic selection scheme

[0101] From the fourth generation of the core breeding group of the egg-laying line, 16 hens with eggshell color L<75 (dark brown shell) were selected, and two roosters from the same family were selected to form two dark brown shell half-sib families with a male-to-female ratio of 1:8; 16 hens with L>78 were selected, and two roosters from the same family were selected to form two light brown shell half-sib families with a male-to-female ratio of 1:8.

[0102] 3. First-generation pedigree hatching and eggshell color determination

[0103] The families formed by the above two selection schemes were all raised in single cages, artificially inseminated, and pedigree hatched. When the first generation chicks were hatched, wing numbers were given to the chicks and pedigrees were recorded. At 30 weeks of age in the first generation, three consecutive eggs were collected from each hen, and the L*a*b values ​​of the eggs were measured using a MiniScan EZ 4000 portable colorimeter.

[0104] 4. Results of Marker-Assisted Selection (MAS)

[0105] In Example 1, the present invention found that the CC genotype of C21R is associated with dark brown shell, and TT is associated with light brown shell. In order to verify the effectiveness of molecular marker-assisted selection (MAS) for brown shell color based on C21R, we performed a comparative experiment of MAS and traditional phenotypic selection. In the MAS scheme, a total of 59 first-generation hens were obtained for the CC type, and 58 first-generation hens were obtained for the TT type. The L value of the eggshell color of the CC type is significantly lower than that of the TT type, and the b value is significantly higher than that of the TT type (Table 1). The a value of the CC type is higher than that of the TT type, and the difference tends to be significant (Table 1). These results show that the offspring bred by the hens selected by MAS, the CC type has a darker brown shell color, while the TT type has a lighter color, which provides data support for the effectiveness of MAS.

[0106] Table 1 Comparison of color index of black chicken egg shell among C21R genotypes in Lueyang

[0107]

[0108] Note: The numbers in brackets in Table 1 are the coefficients of variation of various chromaticity indicators.

[0109] 5. Results of phenotypic selection

[0110] In order to compare the effect difference between MAS and traditional phenotypic selection, we also performed phenotypic selection while performing MAS. By selecting dark brown (L<75) and light brown (L>78) hens, the present invention obtained 54 first-generation hens in the dark brown group and 51 first-generation hens in the light brown group. In addition to the significant difference in L value, there was no significant difference in a value and b value between the dark brown group and the light brown group (Table 2).

[0111] Table 2 Comparison of color chromaticity index groups of Lueyang black chicken egg shell

[0112]

[0113] Note: The numbers in brackets in Table 2 are the coefficients of variation of various chromaticity indicators.

[0114] 6. Comparison of the effects of MAS and phenotypic selection

[0115] As shown in Tables 1 and 2, MAS had significant differences in the three chromaticity indices, while phenotypic selection had significant differences only in L value, and the magnitude of the difference (ΔL 表型 =2) is less than the MAS solution (ΔL MAS=5.5). In addition to the difference in the quantity of the indicators, the two breeding schemes also have obvious differences in the variation range of the indicators. The present invention found that in the MAS scheme, the coefficient of variation of the three chromaticity indicators is smaller than that of the phenotypic selection scheme. Compared with the phenotypic selection scheme, ① the dark brown and light brown groups obtained by the MAS scheme have a greater degree of distinction in eggshell color; ② the dark brown and light brown groups obtained by the MAS scheme have better uniformity of eggshell color within the group. ③ The MAS scheme is not limited by individual age, and selection can be made according to purpose based on the genotype discrimination results at the chick stage, which can significantly shorten the breeding process and save breeding costs.

Claims

1. A molecular marker C21R for the breeding of brown-shell eggs of Lueyang black-bone chicken, characterized in that: The molecular marker C21R is a missense mutation on the 21st cysteine ​​of the ABCG2 protein, wherein the missense mutation is caused by SNPg.17548092T>C, the ABCG2 protein is encoded by the ABCG2 gene, the position of the SNP in the chicken galGal5.0 reference genome is Chr6:17548092, the T of the SNP g.17548092T>C is the wild-type allele, the T is used to encode the 21st cysteine ​​(C), C is a mutant allele, and the C is used to encode the 21st arginine (R).

2. The molecular marker C21R according to claim 1, characterized in that: The C forms a CC genotype, and the T forms a TT genotype, wherein the CC genotype is associated with dark brown shells, and is used for the molecular assisted breeding of a new Lueyang black-bone chicken strain that produces dark brown shell eggs; the TT genotype is associated with light brown shells, and is used for the molecular assisted breeding of a new Lueyang black-bone chicken strain that produces light brown shell eggs.

3. A primer pair for detecting the molecular marker C21R according to claim 1, characterized in that: The primer pair includes a forward strand primer sequence 5'-GTCACCTCAGAAACCCTCAT-3' and a reverse strand primer sequence 5'-CCACAGTCTTCCGTCTACAT-3', and the primer pair is used to specifically amplify a DNA fragment containing a C21R mutation site.

4. A method for detecting the C21R genotype in the ABCG2 gene of Lueyang black-bone chicken using the primer pair described in claim 3, characterized in that: The following steps are involved: Step S1: using the genomic DNA of Lueyang black-bone chicken as a template, using the primer pair to perform PCR amplification, and using the obtained DNA fragment containing the C21R mutation site as a PCR amplification product; Step S2: performing agarose gel electrophoresis on the PCR amplification product obtained in step S1 to confirm the specificity and concentration of the PCR amplification product; Step S3: Determine whether the specificity and concentration of the PCR amplification product meet the Sanger sequencing requirements. If yes, execute step S4; if not, return to execute step S1; Step S4: The PCR amplification product obtained in step S1 is sequenced by the Sanger sequencing, and the genotype of the individual to be tested at the C21R site is detected according to the sequencing result, so as to distinguish CC type, CT type and TT type individuals.

5. A method for breeding brown-shell eggshell color based on the molecular marker C21R according to claim 1, characterized in that: The following steps are involved: Step T1: using the primer pair described in claim 3 and the detection method described in claim 4 to detect the genotype of C21R in the ABCG2 gene of the black-bone chicken individual; Step T2: According to the test results, CC-type individuals are selected for breeding to assist in obtaining a new strain of black-bone chickens that lay dark brown-shelled eggs; or TT-type individuals are selected for breeding to assist in obtaining a new strain of black-bone chickens that lay light brown-shelled eggs.

6. The breeding method according to claim 5, characterized in that: The breeding method is intended to be implemented at the chick stage.

Images