Molecular marker linked with browning resistance of towel gourd fruits and application of molecular marker

Abstract

The invention provides a molecular marker linked with browning resistance of loofah fruits and application. The application comprises the following steps: (I) predicting, screening and / or identifying browning of the loofah fruits; and / or (II) improvement of the towel gourds; the molecular marker is located at the 43044275th basic group of the No.3 chromosome of a loofah genome; the improvement comprises the step of accelerating selection of fruit browning-resistant plants in offspring towel gourds through molecular marker-assisted selective breeding. According to the application, molecular marker-assisted selection of browning-resistant breeding is realized through positioning and marker development of browning-resistant major genes of common towel gourds, and the selection efficiency of browning-resistant characters is effectively improved; the method is of great significance to establishment of an efficient loofah quality breeding molecular system and improvement of the loofah quality breeding level.

Description

Technical Field

[0001] The present application relates to the technical field of plant breeding, and in particular to a molecular marker linked to browning resistance of loofah fruit and its application. Background Art

[0002] Most common loofahs are prone to browning during transportation, processing, steaming and frying, which not only affects the nutritional value and edible value, but also seriously affects its commercial value. Since the browning of loofah needs to be measured by steaming and other methods, it is time-consuming and labor-intensive, which is not conducive to the field selection of traits. The use of molecular markers can effectively improve the selection efficiency of browning resistance traits.

[0003] Luffa (2n=2x=26) is an annual climbing herb of the Cucurbitaceae family. It is widely cultivated in my country. There are two main cultivated species: common luffa [Luffa cylindrica (L.) Roem.] and ribbed luffa [Luffaacutangula (L.) Roxb.]. Among them, the browning phenomenon of the fleshy luffa in the common luffa is relatively common.

[0004] Application Contents

[0005] The present application is made in view of the above-mentioned problems, and its purpose is to provide a molecular marker; the molecular marker is used to screen the browning trait of sponge gourd fruit.

[0006] Specifically, the first aspect of the present application provides the application of molecular markers in the following aspects:

[0007] (I), predicting, screening and / or identifying browning of loofah fruit;

[0008] and / or, (II), improvement of loofah;

[0009] The molecular marker is located at base 43044275 of chromosome 3 of the loofah genome;

[0010] The improvement includes accelerating the selection of fruit browning resistant plants in offspring loofahs through molecular marker-assisted selection breeding.

[0011] The second aspect of the present application provides a primer set, the primer set comprising:

[0012] (I) First forward primer set:

[0013] The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.1 and a linker sequence;

[0014] SEQ ID NO. 1: TTTTTGGCAAATAAAAATTTTCTCAGAAC.

[0015] and / or, (II) a second forward primer set:

[0016] The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.2 and a linker sequence;

[0017] SEQ ID NO.2:

[0018] TTTTTGGCAAATAAAAATTTTCTCAGAAT.

[0019] and / or, (III) a reverse primer set,

[0020] The reverse primer set has a nucleotide sequence as shown in SEQ ID NO.3;

[0021] SEQ ID NO.3:

[0022] TGTGGTACTGCTGAAAATCAGGTA.

[0023] and / or, (IV) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (III), but different from the nucleotide sequence shown in any one of (I) to (III) due to the degeneracy of the genetic code;

[0024] and / or, (V) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (IV), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in any one of (I) to (IV);

[0025] and / or, (VI) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in any one of (I) to (V),

[0026] And / or, the linker sequence includes the nucleotide sequence shown in SEQ ID NO.4 or SEQ ID NO.5.

[0027] SEQ ID NO.4:

[0028] GAAGGTGACCAAGTTCATGC.

[0029] SEQ ID NO.5:

[0030] GAAGGTCGGAGTCAACGGAT.

[0031] The third aspect of the present application provides the use of the primer set as described in the second aspect in the following aspects:

[0032] (I), predicting, screening and / or identifying browning of loofah fruit;

[0033] and / or, (II), improvement of loofah;

[0034] and / or, (III), a kit for predicting, screening and / or identifying browning of sponge gourd fruit;

[0035] The improvement includes accelerating the selection of fruit browning resistant plants in offspring loofahs through molecular marker-assisted selection breeding.

[0036] The fourth aspect of the present application provides a kit, comprising the primer set as described in the second aspect.

[0037] The fifth aspect of the present application provides the use of the kit as described in the fourth aspect in the following aspects:

[0038] (I), predicting, screening and / or identifying browning of loofah fruit;

[0039] and / or, (II), improvement of loofah;

[0040] The improvement includes accelerating the selection of fruit browning resistant plants in offspring loofahs through molecular marker-assisted selection breeding.

[0041] The sixth aspect of the present application provides a method for screening browning of sponge gourd fruit, comprising the following steps: extracting sponge gourd genomic DNA, identifying the genotype of the sponge gourd using the primer set described in the second aspect and / or the kit described in the fourth aspect, and screening for browning-resistant sponge gourd.

[0042] Optionally, the criteria for screening browning-resistant sponge gourds according to the genotype are as follows:

[0043] (I) When the base 43044275 of chromosome 3 of the sponge gourd genome is CC, compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CC-type plants is significantly higher than that of TT-type plants;

[0044] (II) When the base 43044275 of chromosome 3 of the sponge gourd genome is CT, compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits in CT-type plants is significantly higher than that in TT-type plants.

[0045] The seventh aspect of the present application provides a method for breeding loofah fruit, comprising the following steps: extracting loofah genomic DNA, using the primer set described in the second aspect and / or the kit described in the fourth aspect for PCR amplification, and obtaining the corresponding variety based on the fluorescent signal of the PCR product.

[0046] Optionally, the criteria for judging the genotype and evaluating the browning resistance of sponge gourd according to the fluorescent signal are as follows:

[0047] (I) If only the fluorescent signal corresponding to the first primer group is detected, when the base 43044275 of chromosome 3 of the sponge gourd genome is CC, compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CC-type plants is significantly higher than that of TT-type plants;

[0048] (II) If the fluorescence signals corresponding to the first primer set and the second primer set are detected simultaneously, the base 43044275 of chromosome 3 of the sponge gourd genome is CT. Compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CT-type plants is significantly higher than that of TT-type plants.

[0049] Optionally, the reaction procedure of the PCR amplification includes:

[0050] (I), pre-denaturation at 94°C-95°C for 14-15 min, denaturation at 94°C-95°C for 20-30 s, annealing and extension at 65°C-56°C for 60-70 s, 10-15 cycles, reducing the temperature by 0.6°C-0.8°C in each cycle;

[0051] And / or, (II), denaturation at 94°C-95°C for 20s-30s, annealing and extension at 55°C-57°C for 60s-70s, for 26-30 cycles.

[0052] This application has at least the following beneficial effects:

[0053] The molecular marker of the present application is directly used for the identification of browning of sponge gourd and corresponding genotype, and then relies on the molecular marker to carry out auxiliary breeding, which can effectively solve the problem that the conventional breeding cycle is long and susceptible to environmental influences. By utilizing the molecular marker in the early stage, a satisfactory plant can be quickly screened, which effectively reduces the planting scale and reduces the workload of later identification. Improve the efficiency and accuracy of selection. It can be used for the identification of the sponge gourd of various varieties, which is of great significance to the molecular mechanism of studying sponge gourd fruit. Therefore, the present application is of great significance in the practice and research of browning breeding of sponge gourd fruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] In order to more clearly illustrate the embodiments of the present drawings or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present drawings. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying any creative work.

[0055] Figure 1 Phenotype diagrams of the two parents mapped by the BSA-seq population: S273 (A, B) and S370 (C, D).

[0056] Figure 2 BSA mapping results for the S273 and S370 construction groups.

[0057] Figure 3 This is the genetic map of browning gene mutation for this application.

[0058] Figure 4 This is the LOD diagram of the gene in this application.

[0059] Figure 5 Partial results of genotyping of the Brow275 molecular marker in the present application in the backbone browning parent 'S273' and the browning resistant parent 'S370' of the sponge gourd and the constructed F2 population;

[0060] A indicates that the PCR product is the fluorescence signal corresponding to the forward primer Brow275-F, which is a homozygous plant without browning;

[0061] B indicates that the PCR product has two fluorescent signals of primers Brow275-F / R, which is a heterozygous plant without browning;

[0062] C indicates that the PCR product is the fluorescence signal corresponding to the forward primer Brow275-R, which is a homozygous individual plant with browning.

[0063] The purpose, features and advantages of this figure will be further described in conjunction with the embodiments with reference to the accompanying drawings. DETAILED DESCRIPTION

[0064] Hereinafter, the reference electrode, lithium-ion battery, and the preparation method and application embodiments of the present application are specifically disclosed in detail with appropriate reference to the accompanying drawings. However, there may be cases where unnecessary detailed descriptions are omitted. For example, there are cases where detailed descriptions of well-known matters and repeated descriptions of actually the same structures are omitted. This is to avoid the following description from becoming unnecessarily lengthy and to facilitate the understanding of those skilled in the art. In addition, the drawings and the following descriptions are provided for those skilled in the art to fully understand the present application and are not intended to limit the subject matter described in the claims.

[0065] "Scope" disclosed in the present application is limited in the form of lower limit and upper limit, and a given range is limited by selecting a lower limit and an upper limit, and the selected lower limit and upper limit define the boundary of a special range. The scope limited in this way can be including end values ​​or not including end values, and can be arbitrarily combined, that is, any lower limit can be combined with any upper limit to form a scope. For example, if the scope of 60-120 and 80-110 is listed for a specific parameter, it is understood that the scope of 60-110 and 80-120 is also expected. In addition, if the minimum range values ​​1 and 2 are listed, and if the maximum range values ​​3, 4 and 5 are listed, the following scope can be all expected: 1-3, 1-4, 1-5, 2-3, 2-4 and 2-5. In the present application, unless otherwise specified, the numerical range "ab" represents the abbreviation of any real number combination between a and b, wherein a and b are real numbers. For example, the numerical range "0-5" means that all real numbers between "0-5" are listed in this document, and "0-5" is just an abbreviation of these numerical combinations. In addition, when a parameter is expressed as an integer ≥ 2, it is equivalent to disclosing that the parameter is, for example, an integer of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0066] Unless otherwise specified, all embodiments and optional embodiments of the present application can be combined with each other to form a new technical solution.

[0067] Unless otherwise specified, all technical features and optional technical features of this application can be combined with each other to form a new technical solution.

[0068] If there is no special explanation, all steps of the present application can be performed sequentially or randomly, preferably sequentially. For example, the method includes steps (a) and (b), which means that the method may include steps (a) and (b) performed sequentially, or may include steps (b) and (a) performed sequentially. For example, the method may further include step (c), which means that step (c) may be added to the method in any order. For example, the method may include steps (a), (b) and (c), or may include steps (a), (c) and (b), or may include steps (c), (a) and (b), etc.

[0069] If there is no special explanation, the "include" and "comprising" mentioned in this application are open-ended or closed-ended. For example, the "include" and "comprising" may mean that other components not listed may also be included or only the listed components may be included or only the listed components may be included.

[0070] If not specifically stated, in this application, the term "or" is inclusive. For example, the phrase "A or B" means "A, B, or both A and B". More specifically, any of the following conditions satisfies the condition "A or B": A is true (or exists) and B is false (or does not exist); A is false (or does not exist) and B is true (or exists); or both A and B are true (or exist).

[0071] Before describing the present application in detail, it should be understood that the present application is not limited to specific embodiments, which can of course be varied. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be limiting. As used in this specification and the appended claims, singular and singular forms of terms, such as "a", "a", and "the", include plural referents unless otherwise expressly stated in the text. Thus, for example, reference to "a plant", "the plant", or "a plant" also includes multiple plants; and, depending on the context, the use of the term "plant" can also include genetically similar or identical progeny of the plant; the use of the term "nucleic acid" actually optionally includes multiple copies of the nucleic acid molecule; similarly, the term "probe" optionally (and typically) covers many similar or identical probe molecules.

[0072] Unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' direction. The numerical ranges mentioned in this specification include the numerical values ​​that limit the range, and include each integer or any non-integer part in the limited range. Unless otherwise defined, the meaning of all scientific and technological terms used herein is the same as that of ordinary technicians in the field to which the application belongs. Although any methods and materials similar or equivalent to those described herein can be used to test the practice of the application, preferred methods and materials are those described herein. In the description and claims of the application, the following terms will be used according to the definitions listed below.

[0073] Certain definitions used in the specification and claims are provided below. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given to such terms, the following definitions are provided:

[0074] "Agronomics", "agronomic traits", and "agronomic performance" refer to the traits (and underlying genetic factors) of a given plant variety that contribute to yield over the course of the growing season. Individual agronomic traits include emergence vigor, vegetative potential, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, lodging resistance, threshing rate, fruit browning, etc.

[0075] The term "allele" refers to any of one or more alternative forms of a gene sequence. For example, in a diploid cell or organism, two alleles of a given sequence typically occupy corresponding loci on a pair of homologous chromosomes. With respect to SNP markers, alleles refer to the specific nucleotide bases of the SNP locus present in the individual plant.

[0076] An allele is "associated with" a trait when the allele is part of or linked to a DNA sequence or allele that affects the expression of the trait. The presence of the allele is an indication of how the trait will be expressed.

[0077] The term "amplification" in the context of nucleic acid amplification is any process by which additional copies of (or transcribed from) a selected nucleic acid are produced. Typical amplification methods include a variety of polymerase-based replication methods, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and RNA polymerase-based amplification (e.g., transcription) methods. An "amplicon" is an amplified nucleic acid, e.g., a nucleic acid produced by amplifying a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, etc.).

[0078] The term "chromosome segment" refers to a continuous linear segment of genomic DNA present on a single chromosome in plants.

[0079] The term "complementary sequence" refers to a nucleotide sequence that is complementary to a given nucleotide sequence, ie, the sequences are related by the Watson-Crick base pairing rules.

[0080] "Cultivar" and "variety" are used synonymously to refer to a group of plants within the same species (eg, luffa) that share certain genetic traits that distinguish them from other possible varieties within that species.

[0081] "Elite lines" are agronomically superior lines resulting from many rounds of breeding and selection for superior agronomic performance. Many elite lines are available and are known to those skilled in the art of loofah breeding.

[0082] "Elite population" refers to a mixed group of superior individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as loofah.

[0083] "Favorable alleles" are alleles at specific loci that confer or contribute to an agronomically desirable phenotype (e.g., browning resistance trait) and allow identification of plants with the agronomically desirable phenotype. A marker's favorable allele is a marker allele that segregates with a favorable phenotype.

[0084] "Gene map" is a description of the gene linkage relationship between the loci on one or more chromosomes (or linkage groups) in a given species, usually expressed as a figure or table form. For each gene map, the distance between the loci is measured by how frequently their alleles appear together in the population (their recombination frequency). Using DNA or protein markers or observable phenotypes, alleles can be detected. Gene map is the product of the polymorphism possibility of each mark between the mapping population, the marker type used and different populations. Between a gene map and another, the genetic distance between the loci can be different. However, using a shared marker, information can be associated between a map and another. Those of ordinary skill in the art can use a shared marker position to identify the position of the marker and other loci of concern on each gene map. The order of the loci should be constant between the maps, but due to, for example, the marker detects alternative repeated loci in different populations, the difference, new mutation or experimental error of the statistical method for marking sorting, there is often a small change in the order of markers.

[0085] "Genetic recombination frequency" is the frequency of crossing over events (recombinations) between two loci. Recombination frequency can be observed by tracking the segregation of markers and / or traits after meiosis.

[0086] "Genome" refers to the total DNA or complete set of genes carried by a chromosome or group of chromosomes.

[0087] "Genotype" refers to the genetic makeup of a cell or organism.

[0088] "Geroplasm" refers to the genetic material that forms the physical basis of the genetic qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants can grow; or other plant parts that can be cultured into whole plants, such as leaves, stems, pollen, or cells. Germplasm resources provide a source of genetic traits that plant breeders use to improve commercial cultivars.

[0089] A "haplotype" is the genotype of an individual at multiple loci, i.e., a combination of alleles. Typically, the loci described by a haplotype are physically and genetically linked, i.e., located on the same chromosome segment. The term "haplotype" can refer to an allele at a specific locus, or to an allele at multiple loci along a chromosome segment.

[0090] If an individual has only one type of allele at a given locus, the individual is "homozygous" (e.g., a diploid individual has one copy of the same allele at a locus on each of two homologous chromosomes). If there is more than one type of allele at a given locus, the individual is "heterozygous" (e.g., a diploid individual has one copy of each of two different alleles). The term "homogeneity" means that the members of a population have the same genotype at one or more specific loci. In contrast, the term "heterogeneity" is used to indicate that the genotypes of individuals within a population at one or more specific loci are different.

[0091] The term "indel" refers to an insertion or deletion, wherein one strain may be referred to as having an inserted nucleotide or DNA segment relative to a second strain, or the second strain may be referred to as having a deleted nucleotide or DNA segment relative to a first strain.

[0092] "Introgression" refers to the infiltration or introduction of a gene, quantitative trait locus (QTL), marker locus, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.

[0093] "Strain" or "strain" is a group of individuals of the same kinship, which are usually inbred to a certain degree and are usually homozygous and homogeneous (isogenic or near-isogenic) at most loci. "Subline" refers to an inbred subgroup of offspring that is genetically different from other similar inbred subgroups originating from the same ancestor. Conventionally, sublines are obtained by inbreeding seeds from a single sponge gourd plant selected in the F3 to F5 generation until the remaining isolated loci are "fixed" or are homozygous at most or all of the loci. Commercial sponge gourd varieties (or strains) are usually produced by aggregating ("converging") the self-pollination progeny of a single F3 to F5 plant from a controlled hybridization between two genetically different parents. Although the above varieties usually appear to be uniform, the varieties derived from the self-pollination of the selected plants will eventually (e.g., F8) become a mixture of homozygous plants that can be genotyped differently at any locus in the initially selected F3 to F5 plants. Sublines based on markers that differ from each other based on qualitative polymorphisms at the DNA level at one or more specific marker loci are obtained by genotyping a seed sample derived from a single self-pollination progeny of a selected F3-F5 plant. The seed sample can be directly genotyped as a seed or as a plant tissue grown from such a seed sample. Optionally, seeds that share a common genotype at a specific locus (or loci) are combined, providing sublines that are genetically homologous on the identified loci that are important for the trait being paid attention to (e.g., anther extrusion, flowering stage, heading stage and / or head blight resistance, etc.).

[0094] "Linkage" refers to the phenomenon that alleles on the same chromosome tend to co-segregate more often than expected by chance when their transmission is independent. Genetic recombination occurs at an assumed random frequency over the entire genome. The gene map is constructed by measuring the frequency of recombination between pairs of traits or markers. The closer traits or markers are to each other on the chromosome, the lower the frequency of recombination, and the higher the degree of linkage. If traits or markers are generally co-segregated, they are considered to be linked in this article. The recombination probability of 1 / 100 per generation is defined as a map distance of 1.0 centimorgan (1.0 cM).

[0095] The hereditary element or gene that are positioned at a single chromosome segment are physically linked. Advantageously, two locus positions are in close proximity so that the reorganization between the homologous chromosome pair in the meiotic process does not occur with high frequency between the two loci, for example, so that the linked loci are co-segregated at least about 90% of the time, for example 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75% or more time. The hereditary element that is positioned at the chromosome segment is also hereditarily linked, usually in the genetic recombination distance that is less than or equal to 50 centimorgans (cM), for example about 49,40,30,20,10,5,4,3,2,1,0.75,0.5 or 0.25cM or less. That is, two genetic elements within a single chromosome segment recombine with each other during meiosis at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or 0.25% or less.

[0096] In the present application, the phrase "tightly linked" about loci refers to the recombination between two linked loci occurring at a frequency equal to or less than 10% (i.e., separated by no more than 10 cM on the genetic map). In other words, tightly linked loci co-segregate at least 90% of the time. When marker loci show a significant possibility (linkage) of co-segregation with a desired trait (e.g., browning resistance), they are particularly useful in the present application. Tightly linked loci, such as marker loci and second loci, can show 10% or less, preferably about 9% or less, more preferably about 8% or less, more preferably about 7% or less, still more preferably about 6% or less, more preferably about 5% or less, still more preferably about 4% or less, more preferably about 3% or less, and still more preferably about 2% or less of inter-loci recombination frequency. In a highly preferred embodiment, the associated loci show a recombination frequency of about 1% or less, for example, about 0.75% or less, more preferably about 0.5% or less, or more preferably about 0.25% or less. Such two loci on the same chromosome that are located at a distance such that the recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or lower) are also referred to as being "adjacent" to each other. In some cases, two different markers can have the same genetic map coordinates. In such cases, the two markers are so close to each other that the recombination between them occurs at a frequency so low that it is not detectable.

[0097] When it comes to the relationship between two genetic elements (such as a genetic element that contributes to antagonism and a neighboring marker), "coupling" state linkage refers to a state in which the "favorable" allele at the locus is physically associated with the "favorable" allele of the corresponding linked marker locus on the same chromosome chain. In the coupling state, the offspring to which the two favorable alleles are inherited together inherits the chromosome chain. In the "repulsive" state linkage, the "favorable" allele at the locus of interest is physically linked to the "unfavorable" allele at the neighboring marker locus, and the two "favorable" alleles are not inherited together (that is, the two loci are "anti-phase" to each other).

[0098] "Linkage disequilibrium" refers to when separating from parents to offspring, alleles tend to keep together in linkage groups with a higher frequency than expected from their respective frequencies. The state of being in linkage disequilibrium implies that the relevant loci are physically in sufficient proximity along the length of chromosome, so that they are separated together with a higher frequency than random (that is, non-random). The markers showing linkage disequilibrium are considered to be linked. The linked loci are more than 50% of the time co-segregated, for example, about 51% to about 100% of the time. In other words, two markers of co-segregation have a recombination frequency less than 50% (and by definition, less than 50cM apart on the same linkage group). As used herein, linkage can be between two markers, or between a marker and a locus that affects a phenotype. The marker locus can be "associated" (associated) with a trait. The linkage degree of the marker locus and the locus that affects a phenotypic trait is as, for example, the statistical probability (for example, F statistic or LOD score) of the co-segregation of the molecular marker and the phenotype is measured.

[0099] "Linkage group" (LG) refers to a trait or marker that is generally co-segregated. A linkage group generally corresponds to a chromosomal region containing genetic material encoding the trait or marker. Thus, a linkage group can generally be attributed to a specific chromosome.

[0100] A "locus" is a defined segment of DNA. For example, it can refer to the position on a chromosome where a nucleotide, gene, sequence, or marker is located.

[0101] A "map position" is a designated location on a genetic map relative to linked genetic markers within a given species where a particular marker can be found.

[0102] "Mapping" is the process of defining the linkage relationships of genetic loci through the use of genetic markers, population segregation of markers, and standard genetic principles of recombination frequency.

[0103] "Marker" or "molecular marker" or "marker locus" is a term used to represent a nucleic acid or amino acid sequence that is unique enough to characterize a specific locus on a genome. Examples include restriction fragment length polymorphism (RFLP), simple sequence repeats (SSR), target region amplified polymorphism (TRAP), isozyme electrophoresis, random amplified polymorphic DNA (RAPD), random primer polymerase chain reaction (AP-PCR), DNA amplification fingerprint (DAF), sequence-specific amplified region (SCAR), amplified fragment length polymorphism (AFLP) and single nucleotide polymorphism (SNP). In addition, other types of molecular markers are known in the art, and phenotypic traits can also be used as markers in the method. All markers are used to define a specific locus on the sponge gourd genome. Therefore, each marker is an indication of a specific segment of DNA with a unique nucleotide sequence. The map position provides a measure of the relative position of a specific marker relative to each other. When a trait is described as being linked to a given marker, it should be understood that the actual DNA segment whose sequence affects the trait is generally co-separated with the marker. If markers are identified on both sides of a trait, a more precise and definitive localization of the trait can be obtained. By measuring the presence of the marker in the progeny of a cross, the presence of the trait can be detected by a relatively simple molecular test without actually assessing the presence of the trait itself, which can be difficult and time consuming because actual assessment of the trait requires growing the plant to a stage where the trait can be expressed.

[0104] "Marker-assisted selection" refers to the process of selecting one or more desired traits in one or more plants by detecting one or more nucleic acids from the plant (wherein the nucleic acid is associated with the desired trait), and then selecting plants or germplasm having the one or more nucleic acids.

[0105] In some examples, multiple marker loci or haplotypes are used to define a "marker profile". As used herein, a "marker profile" refers to a combination of two or more marker loci or haplotypes within the genome of a particular plant. For example, in one example, a specific combination of marker loci or a specific combination of haplotypes defines a marker profile for a particular plant.

[0106] The term "phenotype", "phenotypic traits" or "traits" can refer to the observable expression of a gene or series of genes. The phenotype can be observable by the naked eye or by any other evaluation method known in the art, for example, weighing, counting, measuring (length, width, angle, etc.), microscopy, biochemical analysis, or electromechanical determination. In some cases, the phenotype is directly controlled by a single gene or locus, that is, a "monogenic trait" or "simple genetic trait". In the absence of a large degree of environmental variation, monogenic traits can be separated in a population, producing a "qualitative" or "discrete" distribution, that is, the phenotype is divided into discrete categories. In other cases, the phenotype is the result of multiple genes and can be considered as a "polygenic trait" or "composite trait". Polygenic traits are separated in a population to produce a "quantitative" or "continuous" distribution, that is, the phenotype cannot be separated into discrete categories. Both monogenic and polygenic traits can be affected by the environment in which they are expressed, but polygenic traits tend to have a larger environmental composition.

[0107] A "favorable trait" or "favorable phenotype," such as, for example, resistance to fruit browning, is an agronomically desirable phenotype.

[0108] The term "plant" includes reference to the entire plant, whether immature or mature, including a plant from which seeds or grains or anthers have been removed. A seed or embryo that will produce a plant is also considered a plant.

[0109] "Plant part" refers to any part or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seeds, grains, embryos, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, branches, stems, tissues, tissue cultures, cells, etc.

[0110] "Polymorphism" refers to a variation or difference between two related nucleic acids. "Nucleotide polymorphism" refers to a nucleotide that is different in one sequence compared to related sequences when two nucleic acids are aligned for maximum correspondence.

[0111] "Polynucleotide", "polynucleotide sequence", "nucleic acid sequence", "nucleic acid fragment" and "oligonucleotide" are used interchangeably herein. These terms encompass nucleotide sequences, among others. Polynucleotides can be polymers of RNA or DNA, which can be single-stranded or double-stranded, optionally containing synthetic, non-natural or modified nucleotide bases. A polynucleotide in the form of a DNA polymer can be composed of one or more chains of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.

[0112] "Primer" refers to an oligonucleotide (synthetic or naturally occurring) that can serve as a starting point for nucleic acid synthesis or replication along a complementary strand when placed under conditions where the complementary strand is synthesized by a polymerase. Typically, a primer is an oligonucleotide of 10 to 30 nucleic acids in length, but longer or shorter sequences can be used. Primers can be provided in double-stranded form, although single-stranded form is preferred. Primers can also contain a detectable label, such as a 5' end label.

[0113] "Probe" refers to an oligonucleotide (synthetic or naturally occurring) that is complementary to the polynucleotide of interest (but not necessarily completely complementary) and forms a double-stranded structure by hybridizing with at least one chain of the polynucleotide of interest. Typically, a probe is an oligonucleotide of 10 to 50 nucleic acids in length, but longer or shorter sequences can be used. The probe can also include a detectable label. The terms "label" and "detectable label" refer to molecules that can detect, including but not limited to radioisotopes, fluorescent agents, chemiluminescent agents, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, semiconductor nanocrystals, ligands (e.g., biotin, avidin, streptavidin or haptoantigen), etc. Detectable labels can also include a combination of a reporter gene and a quencher, such as those used in FRET probes or TaqMan probes.

[0114] The term "reporter gene" refers to a substance or a portion thereof, which is capable of expressing a detectable signal, and the signal can be suppressed by a quencher. The detectable signal of the reporter gene is, for example, fluorescence within a detectable range.

[0115] The term "quencher" refers to a substance or a portion thereof that is capable of inhibiting, reducing, suppressing, etc., a detectable signal generated by the reporter gene.

[0116] As used herein, the terms "quenching" and "fluorescence energy transfer" refer to the process whereby, when a reporter gene and a quencher are in close proximity and the reporter gene is excited by an energy source, a major portion of the energy of the excited state is non-radiatively transferred to the quencher, where it is either dissipated non-radiatively or emitted at a wavelength different from the emission wavelength of the reporter gene.

[0117] The term "quantitative trait locus" or "QTL" refers to a region of DNA associated with differential expression of a quantitative phenotypic trait in at least one genetic background (e.g., in at least one breeding population). The region of a QTL encompasses or is closely associated with one or more genes that affect the trait under consideration.

[0118] A "reference sequence" or "consensus sequence" is a defined sequence used as the basis for sequence comparison. A reference sequence for a PHM marker is obtained by sequencing multiple strains at the locus, aligning the nucleotide sequences in a sequence alignment program (e.g., Sequencher), and then obtaining the most common nucleotide sequence in the alignment. Polymorphisms that exist between individual sequences are annotated in the consensus sequence. A reference sequence is usually not an exact copy of any individual DNA sequence, but rather represents a mixture of available sequences and is used to design primers and probes for polymorphisms within the sequence.

[0119] "Recombination frequency" is the frequency of crossing over events (recombinations) between two loci. Recombination frequency can be observed by tracking the segregation of markers and / or traits during meiosis.

[0120] "Self-fertilization," "self-pollination," or "selfing" is the process by which a breeder mates a plant with itself; for example, a second generation hybrid F2 with itself produces progeny designated F2:3.

[0121] "SNP" or "single nucleotide polymorphism" refers to the sequence variation that occurs when a single nucleotide (A, T, C or G) in the genomic sequence is changed or mutated. When SNP is mapped to a site on the luffa genome, there is a "SNP marker". Many techniques for detecting SNP are known in the art, including allele-specific hybridization, primer extension, direct sequencing, TM and real-time PCR such as TaqMan assay.

[0122] "Transgenic plant" refers to a plant comprising exogenous polynucleotides in its cell. Generally speaking, exogenous polynucleotides are stably integrated into the genome so that the polynucleotides are passed to continuous generations. Exogenous polynucleotides can be integrated into the genome individually or as part of a recombinant expression cassette. "Transgenic" as used herein refers to any cell, cell line, callus, tissue, plant part or plant that has changed genotype due to the presence of exogenous nucleic acids, including transgenic organisms or cells that initially carry out such changes, and those transgenic organisms or cells produced by hybridization or asexual reproduction from initial transgenic organisms or cells. As used herein, the term "transgenic" does not encompass genomes (chromosomal genomes or extrachromosomal genomes) changes caused by conventional plant breeding methods (e.g., hybridization) or by naturally occurring events such as random cross-fertilization, non-recombinant virus infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutations.

[0123] An "unfavorable allele" of a marker is a marker allele that segregates with an unfavorable plant phenotype, thereby providing a beneficial effect in identifying plants that can be eliminated from a breeding program or germplasm.

[0124] The term "vector" is used to refer to a polynucleotide or other molecule that transfers a nucleic acid fragment into a cell. The vector optionally includes portions that mediate the maintenance of the vector and allow its intended use (e.g., sequences necessary for replication, genes that confer drug or antibiotic resistance, multiple cloning sites, operably linked promoter / enhancer elements that enable expression of cloned genes, etc.). Vectors are often derived from plasmids, bacteriophages, or plant or animal viruses.

[0125] Turning to the example here:

[0126] Identification of markers. Haplotypes and / or marker profiles associated with traits of interest.

[0127] A variety of methods well known in the art are available for detecting molecular markers or sets of molecular markers that are co-separated with the proterties (such as browning resistance) of interest. The basic idea behind these methods is the selection of markers, and for these markers, the available genotypes (or alleles) have significantly different average phenotypes. Therefore, people compare the magnitude of the difference between the available genotypes (or alleles) or the significance level of this difference between the marker loci. The trait gene is presumed to be located at the nearest place of the marker with the maximum associated genotype difference.

[0128] Two such methods for detecting the trait loci of interest are: 1) population-based association analysis and 2) conventional linkage analysis. In population-based association analysis, strains are obtained from existing populations with multiple founders, such as elite breeding strains. Population-based association analysis relies on the decline of linkage disequilibrium (LD) and the following concept: in an unstructured population, after so many generations of random mating, only the genes controlling the trait of interest and the correlation between the markers closely linked to these genes will be retained. In fact, most existing populations have population substructures.

[0129] Therefore, by using the data obtained from the randomly distributed marks in the genome, individuals are assigned to the population, thereby minimizing the imbalance caused by the population structure in each population (also referred to as subpopulation), and the use of structured association methods helps to control the population structure. For each strain in the subpopulation, the phenotypic value is compared with the genotype (allele) at each marker locus. Significant marker-trait correlations indicate close proximity between the marker locus and one or more loci participating in the expression of this trait.

[0130] The same principle exists behind conventional linkage analysis; However, LD is produced by constructing a population from a small amount of founders. Founders are selected to maximize the level of polymorphism in the constructed population, and assess the level of co-separation of polymorphic sites with a given phenotype. A variety of statistical methods have been used to identify significant marker-trait correlations. A type of such method is an interval mapping method, in which, for each of many positions (e.g., at 1 cM intervals) along the gene map, the possibility of controlling the proterties gene being paid attention to being located at the position is tested. Genotype / phenotype data are used to calculate LOD scores (logarithm of probability ratio) for each test position. When the LOD score exceeds a threshold value, there is significant evidence that the gene controlling the proterties being paid attention to is located at the position on the gene map (it will fall between two specific marker loci).

[0131] The present disclosure provides marker loci that exhibit statistically significant co-segregation with at least one of the following traits: fruit browning resistance, as determined by population-based association analysis.

[0132] Detection of these loci or additional linked loci can be used in marker-assisted breeding programs of Luffa to produce plants with favorable traits.

[0133] The present application is made in view of the above-mentioned problems, and its purpose is to provide a molecular marker; the molecular marker is used to screen the browning trait of sponge gourd fruit.

[0134] Specifically, the first aspect of the present application provides the application of molecular markers in the following aspects:

[0135] (I), predicting, screening and / or identifying browning of loofah fruit;

[0136] and / or, (II), improvement of loofah;

[0137] The molecular marker is located at base 43044275 of chromosome 3 of the loofah genome;

[0138] The improvement includes accelerating the selection of fruit browning resistant plants in offspring loofahs through molecular marker-assisted selection breeding.

[0139] The reference versions of the sequences in this application are as follows:

[0140] https: / / ftp.cngb.org / pub / CNSA / data2 / CNP0000780 / CNS0139036 / CNA0007250 / .

[0141] This genome is the third-generation assembled high-quality genome version, which contains 74Gb of high-quality sequences, 99.5% of the sequences are anchored to 13 chromosomes, the lengths of Contig N50 and Scaffold N50 are 5Mb and 53Mb respectively, the GC content is about 35.9%, and the final assembled loofah genome size is 669Mb, with a repetitive sequence content of 62.18%.

[0142] The genome was used for BLAST analysis and the sequence was located on chromosome 3.

[0143] The second aspect of the present application provides a kit, wherein the primer set comprises:

[0144] (I) First forward primer set:

[0145] The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.1 and a linker sequence;

[0146] SEQ ID NO. 1: TTTTTGGCAAATAAAAATTTTCTCAGAAC.

[0147] and / or, (II) a second forward primer set:

[0148] The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.2 and a linker sequence;

[0149] SEQ ID NO.2:

[0150] TTTTTGGCAAATAAAAATTTTCTCAGAAT.

[0151] and / or, (III) a reverse primer set,

[0152] The reverse primer set has a nucleotide sequence as shown in SEQ ID NO.3;

[0153] SEQ ID NO.3:

[0154] TGTGGTACTGCTGAAAATCAGGTA.

[0155] and / or, (IV) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (III), but different from the nucleotide sequence shown in any one of (I) to (III) due to the degeneracy of the genetic code;

[0156] and / or, (V) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (IV), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in any one of (I) to (IV);

[0157] and / or, (VI) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in any one of (I) to (V),

[0158] And / or, the linker sequence includes the nucleotide sequence shown in SEQ ID NO.4 or SEQ ID NO.5.

[0159] SEQ ID NO.4:

[0160] GAAGGTGACCAAGTTCATGC.

[0161] SEQ ID NO.5:

[0162] GAAGGTCGGAGTCAACGGAT.

[0163] Optionally, the primer set includes:

[0164] Brow275-F:

[0165] GAAGGTGACCAAGTTCATGCTTTTGGCAAATAAAAATTTTCTCAG AAC.

[0166] Brow275-R:

[0167] GAAGGTCGGAGTCAACGGATTTTTTGGCAAATAAAAATTTTCTCAG AAT.

[0168] Brow275-C:

[0169] TGTGGTACTGCTGAAAATCAGGTA.

[0170] Optionally, the 5' ends of the two forward primers Brow275-F and Brow275-R are respectively connected to different fluorescent linker sequences.

[0171] Optionally, the fluorescent linker sequence is a FAM linker sequence or a HEX linker sequence of LGC Company.

[0172] Optionally, the FAM linker sequence is GAAGGTGACCAAGTTCATGC (SEQ ID NO. 4).

[0173] Optionally, the HEX linker sequence is GAAGGTCGGAGTCAACGGAT (SEQ ID NO. 5).

[0174] The third aspect of the present application provides the use of the primer set as described in the second aspect in the following aspects:

[0175] (I), predicting, screening and / or identifying browning of loofah fruit;

[0176] and / or, (II), improvement of loofah;

[0177] and / or, (III), a kit for predicting, screening and / or identifying browning of sponge gourd fruit;

[0178] The improvement includes reducing the fruit browning ratio in offspring loofahs through molecular marker-assisted selection breeding.

[0179] The fourth aspect of the present application provides a kit, comprising the primer set as described in the second aspect.

[0180] The fifth aspect of the present application provides the use of the kit as described in the fourth aspect in the following aspects:

[0181] (I), predicting, screening and / or identifying browning of loofah fruit;

[0182] and / or, (II), improvement of loofah;

[0183] The improvement includes accelerating the selection of fruit browning resistant plants in offspring loofahs through molecular marker-assisted selection breeding.

[0184] The sixth aspect of the present application provides a method for screening browning of sponge gourd fruit, comprising the following steps: extracting sponge gourd genomic DNA, identifying the genotype of the sponge gourd using the primer set described in the second aspect and / or the kit described in the fourth aspect, and screening for browning-resistant sponge gourd.

[0185] Optionally, the criteria for screening browning-resistant sponge gourds according to the genotype are as follows:

[0186] (I) When the base 43044275 of chromosome 3 of the sponge gourd genome is CC, compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CC-type plants is significantly higher than that of TT-type plants;

[0187] (II) When the base 43044275 of chromosome 3 of the sponge gourd genome is CT, compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits in CT-type plants is significantly higher than that in TT-type plants.

[0188] The seventh aspect of the present application provides a method for breeding loofah fruit, comprising the following steps: extracting loofah genomic DNA, using the primer set described in the second aspect and / or the kit described in the fourth aspect for PCR amplification, and obtaining the corresponding variety based on the fluorescent signal of the PCR product.

[0189] Optionally, the criteria for judging the genotype and evaluating the browning resistance of sponge gourd according to the fluorescent signal are as follows:

[0190] (I) If only the fluorescent signal corresponding to the first primer group is detected, the base 43044275 of chromosome 3 of the sponge gourd genome is CC, and compared with the case where the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CC-type plants is significantly higher than that of TT-type plants;

[0191] (II) If the fluorescence signals corresponding to the first primer set and the second primer set are detected simultaneously, the base 43044275 of chromosome 3 of the sponge gourd genome is CT. Compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CT-type plants is significantly higher than that of TT-type plants.

[0192] Optionally, the reaction procedure of the PCR amplification includes:

[0193] (I), pre-denaturation at 94°C-95°C for 14-15 min, denaturation at 94°C-95°C for 20-30 s, annealing and extension at 65°C-56°C for 60-70 s, 10-15 cycles, reducing the temperature by 0.6°C-0.8°C in each cycle;

[0194] And / or, (II), denaturation at 94°C-95°C for 20s-30s, annealing and extension at 55°C-57°C for 60s-70s, for 26-30 cycles.

[0195] This application has at least the following beneficial effects:

[0196] The present application utilizes the method of BSA positioning to locate a gene that controls the browning of sponge gourd fruit, and according to the mutation site of the gene, develops the KASP molecular marker associated with the browning gene of the sponge gourd. It can be directly used for the identification of browning of sponge gourd and the corresponding genotype, and then relies on the molecular marker to carry out auxiliary breeding, which can effectively solve the problem that the conventional breeding cycle is long and susceptible to environmental influences. By using the molecular marker in the early stage, a satisfactory plant can be quickly screened, which effectively reduces the planting scale and reduces the workload of later identification. Improve the efficiency and accuracy of selection. It can be used for the identification of the sponge gourd of various varieties, which is of great significance to the molecular mechanism of studying the sponge gourd fruit. Therefore, the present application is of great significance in the practice and research of browning breeding of sponge gourd fruit.

[0197] Example 1 Obtaining the Molecular Marker BSA Linked to the Browning Gene of Luffa

[0198] This embodiment adopts the BSA positioning method, including the following steps:

[0199] Step 1. Construction of the group

[0200] The main stem browning parent of sponge gourd 'S273' ( Figure 1 A), and the browning resistant material 'S370' parent ( Figure 1 C), the browning 'S273' parent and the browning resistant 'S370' parent were hybridized to obtain the F1 generation, and the F1 generation was self-pollinated to obtain the F2 population.

[0201] Step 2. Fruit browning identification

[0202] When the F2 generation group reaches the commercial fruit stage, the fruit browning is observed and identified, and the levels are divided into 0, 1, 3, 5, and 7 according to the degree of fruit browning.

[0203] The specific level judgment criteria are as follows:

[0204] Level 0: no obvious browning (white or green);

[0205] Level 1: The core and middle flesh are slightly browned, with the browning area ratio below 30%;

[0206] Grade 3: The core of the fruit is brown, the flesh is slightly browned, and the browning area ratio is 30% to 50%;

[0207] Level 5: The core and middle flesh are brown, and the browning area is more than 50%;

[0208] Level 7: The flesh is dark brown, and the browning area is more than 50%.

[0209] Step 3. Preliminary location of browning genes

[0210] In order to locate the genes that control fruit browning, the QTL-SEQ method was used to select 14 individuals with extreme fruit browning and 14 individuals without browning from the F2 segregating population. Two DNA pools (Browning and Nobrown pools) were constructed respectively. The two parents (S273 and S370) and the two DNA pools were whole-genome resequencing, generating a total of 62.9Gb of sequence data.

[0211] The reads were aligned to the reference genome of Luffa using BWA software, and the SAM tools software was used to find the SNP sites of the whole genome. The analysis found that the sequencing depths of S273, S370, Browning pool, and Nobrown pool were 9.6×, 10.8×, 19.8.×, and 20.3×, respectively, all covering more than 96% of the whole genome.

[0212] The base quality value was greater than or equal to 30, the mapping quality value was greater than or equal to 30, the base depth in the parent was greater than or equal to 2 and less than or equal to 60, and the base depth in the two F2 pools was greater than or equal to 2 and less than or equal to 100. A total of 448,493 differential SNPs were obtained. The following is a plot with a 1Mb window and a step size of 100kb (see Figure 2 ).

[0213] Since the SNP associated with the target trait is linked to the SNPs around it on the chromosome, the deltaSNP index should be above 0.5, or close to 1, while the deltaSNP index in the genomic region without trait association is randomly distributed around 0.0. Observing the distribution of deltaSNP index values, based on the distribution of SNP-Index of the two offspring pools on the genome, we selected the region where the SNP-index in one offspring pool is close to 1 and the SNP-index in the other offspring pool is close to 0, and the difference between the two is above the 99% confidence line. We found that there is an interval (35.3M-45.7M) on chromosome 3 as a candidate region.

[0214] Step 4. Fine positioning of browning genes

[0215] The chromosome region controlling browning of loofah was obtained through step 3. In order to further narrow down the candidate region of the gene controlling browning, the DNA sequence variation in the segment was analyzed and the KASP marker was developed. The developed KSAP molecular marker was used to perform genotyping on the individual plants of the F2 population, and the JoinMap4.0 software was used to perform linkage analysis on the typing results to obtain a genetic linkage map; MapQTL6.0 software was used to perform QTL linkage analysis on the browning phenotype in combination with the browning phenotype data of F2, and the maximum LOD was found among the developed markers, with an LOD of 18.24 ( Figure 4 ), which explains 32% of the variation (see Figures 3-4 ). The marker is Chr03-43044275, named Brow275.

[0216] The sequence of Chr03-43044275 and its related regions are as follows:

[0217] ATGCATCTCATCGAGAAGGTCATGTGCTTGATCTAACCACCCCAAGT

[0218] GAATGCATGCATTTATGACATGAACTAACAAAGAATCGTCATTAGAT

[0219] ACAGGTGACTCTTCCCTCTCTGCCTTGATAAGAAACTGAGCTAAATCCT

[0220] TGGTCTTACCAGCTTCCAGAAAAGCCCTAACTAATTTCACAAGAATAGC

[0221] TTCAGTTGGCTGGAGAACACCACGTTCAGTTGTAACTAATTCAACTTGC

[0222] AATTGCAGCTTCATAAGCAAGGTGCGAAGAATTTCCTTGGCTTCAATAT

[0223] CAAGGTTCGGAAAATTTCGATCCATAACAAAATCTTCATAAGAAATGG

[0224] ACTTCCCATTTAATATCTTATCTTTTAATCCATCATTTTGGCAAATAAAA

[0225] ATTTTCTCAGAA[C / T]CTAGTCCAGATGATGGTCTTACCTGATTTTCAGC AGTACCACATACTAAGGTAGTTGTAGCGATTGCATTTTTAGCTATCTTTGCTTTCCTCAGCATGTCCAAAACCATGTTAGATGCAGATTCTAGATCTCCAAATTTCAGGTGACATGTGAGTAAACAACTATAAAACTGCCGATACTGAACATCACTTAGATTATAGGCTTCATCTATGTGTCT CTGTAATTTCTTCAATTCTTCTCTCCGCCCGTTTCTTTCATGTATATGAACCATTACCATCAATAAGTTGGCATCTACTTTGACACCAATTCTGGGCATCATATCAAGGAGTTCTTCTGCCTTTCTAGTTGTCCCAAACAAGACACATCCCGCCAGAGCAATGTTAAAAGCTGTAGAATTAGG.

[0226] Example 2

[0227] When molecular markers are used, the following steps are specifically included:

[0228] (1) Using the genomic DNA of the sample to be tested as a template, amplification is performed using molecularly labeled amplification primers to obtain an amplification product;

[0229] The primers designed for this mutation site are as follows:

[0230] Normal primer Brow275-F:

[0231] GAAGGTGACCAAGTTCATGCTTTTGGCAAATAAAAATTTTCTCAG AAC.

[0232] Forward primer Brow275-R:

[0233] GAAGGTCGGAGTCAACGGATTTTTTGGCAAATAAAAATTTTCTCAG AAT.

[0234] Reverse primer Brow275-C:

[0235] TGTGGTACTGCTGAAAATCAGGTA.

[0236] The two forward primers are connected to different fluorescent linker sequences respectively; the fluorescent linker sequence is FAM or HEX.

[0237] Touchdown PCR was used for amplification, and the amplification program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 95°C for 20 s; annealing and extension at 65°C-56°C for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle;

[0238] Denaturation at 94°C for 20 s; annealing and extension at 57°C for 60 s, for 26 cycles.

[0239] (2) Detect and analyze the amplified products.

[0240] When the amplified product is subjected to fluorescence detection, if only the fluorescence signal corresponding to the primer Brow275-F is detected in the sample PCR product, the detection site is a C:C genotype, and it is determined to be a single plant of the luffa phenotype of browning resistance;

[0241] If the sample PCR product only detects the fluorescence signal corresponding to the primer Brow275-R, the detection site is T:T genotype, and it is determined to be a single plant with browning phenotype of luffa;

[0242] If two fluorescent signals (the fluorescent signals corresponding to Brow275–F and Brow275–R) are detected at the same time, the detection site is a C:T genotype, and the loofah is determined to be a single plant with a browning resistance phenotype.

[0243] In this embodiment, the test sample is a leaf.

[0244] The leaves of 96 plants selected from the F2 population constructed by S273 and S370 were genotyped using the Brow275 marker, and three fluorescent signals appeared, including 44 plants with C:C fluorescent signals, 16 plants with C:T fluorescent signals, and 36 plants with G:G fluorescent signals. Combined with the phenotypic survey data, it was found that the genotype was highly consistent with the pollen fertility phenotype (see Table 1). The above results fully demonstrate that the Brow275 marker is versatile and accurate, and can be used for the prediction, identification and screening of fruit browning in loofah plants.

[0245] Table 1 shows the fruit browning types and genotypes of some individual plants in the F2 population constructed with marker Brow275 in S273 and S370

[0246]

[0247]

[0248]

[0249]

[0250] The above identification results show that by using molecular marker identification and screening in breeding, retaining the material with the HEX fluorescence signal corresponding to the primer Brow275, it is possible to select the material of loofah resistant to browning. Retaining the material with the FAM fluorescence signal corresponding to the primer Brow275, it is possible to select the homozygous material of browning. Retaining the material with the FAMHEX fluorescence signal (including the fluorescence signals corresponding to the above two primers), it is possible to select the heterozygous material resistant to browning. The results are shown in Figure 5 The screening of molecular markers in the early stage can reduce the workload of later screening and identification and accelerate the breeding process.

[0251] In summary, this application realizes molecular marker-assisted selection for browning resistance breeding by locating and marking the main effect gene of browning resistance in common loofah, and effectively improves the selection efficiency of browning resistance trait; this application is of great significance to the establishment of an efficient molecular system for loofah quality breeding and to the improvement of the level of loofah quality breeding.

[0252] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and the embodiments having the same structure as the technical idea and exerting the same effect within the scope of the technical solution of the present application are all included in the technical scope of the present application. In addition, without departing from the scope of the main purpose of the present application, various modifications that can be thought of by those skilled in the art to the embodiments and other methods of combining some of the constituent elements in the embodiments are also included in the scope of the present application.

Claims

1. The application of molecular markers in the following aspects is characterized in that: (I), predicting, screening and / or identifying browning of loofah fruit; and / or, (II), improvement of loofah; The molecular marker is located at base 43044275 of chromosome 3 of the loofah genome; The improvement includes accelerating the selection of fruit browning resistant plants in offspring loofahs through molecular marker-assisted selection breeding.

2. A primer set, characterized in that: The primer set comprises: (I) a first forward primer set: The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.1 and a linker sequence; and / or, (II) a second forward primer set: The first forward primer set includes a nucleotide sequence as shown in SEQ ID NO.2 and a linker sequence; and / or, (III) a reverse primer set, The reverse primer set has a nucleotide sequence as shown in SEQ ID NO.3; and / or, (IV) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (III), but different from the nucleotide sequence shown in any one of (I) to (III) due to the degeneracy of the genetic code; and / or, (V) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in any one of (I) to (IV), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in any one of (I) to (IV); and / or, (VI) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in any one of (I) to (V), And / or, the linker sequence includes the nucleotide sequence shown in SEQ ID NO.4 or SEQ ID NO.

5.

3. Use of the primer set as claimed in claim 2 in the following aspects: (I), predicting, screening and / or identifying browning of loofah fruit; and / or, (II), improvement of loofah; and / or, (III), a kit for predicting, screening and / or identifying browning of sponge gourd fruit; The improvement includes accelerating the selection of fruit browning resistant plants in offspring loofahs through molecular marker-assisted selection breeding.

4. A kit, characterized in that Comprising the primer set as claimed in claim 2.

5. Use of the kit as claimed in claim 4 in the following aspects: (I), predicting, screening and / or identifying browning of loofah fruit; and / or, (II), improvement of loofah; The improvement includes accelerating the selection of fruit browning resistant plants in offspring loofahs through molecular marker-assisted selection breeding.

6. A method for screening browning of sponge gourd fruit, characterized in that: The method comprises the following steps: extracting genomic DNA of the sponge gourd, identifying the genotype of the sponge gourd using the primer set as claimed in claim 2 and / or the kit as claimed in claim 4, and screening to obtain the browning-resistant sponge gourd.

7. The method according to claim 6, characterized in that The criteria for screening browning-resistant loofah according to the genotype are as follows: (I) When the base 43044275 of chromosome 3 of the sponge gourd genome is CC, compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CC-type plants is significantly higher than that of TT-type plants; (II) When the base 43044275 of chromosome 3 of the sponge gourd genome is CT, compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits in CT-type plants is significantly higher than that in TT-type plants.

8. The method for breeding of loofah fruits is characterized in that, The method comprises the following steps: extracting loofah genomic DNA, performing PCR amplification using the primer set as claimed in claim 2 and / or the reagent kit as claimed in claim 4, and obtaining corresponding varieties according to the fluorescent signal of the PCR product.

9. The method according to claim 8, characterized in that The criteria for judging the genotype and evaluating the browning resistance of sponge gourd according to the fluorescent signal are as follows: (I) If only the fluorescent signal corresponding to the first primer group is detected, the base 43044275 of chromosome 3 of the sponge gourd genome is CC, and compared with the case where the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CC-type plants is significantly higher than that of TT-type plants; (II) If the fluorescence signals corresponding to the first primer set and the second primer set are detected simultaneously, the base 43044275 of chromosome 3 of the sponge gourd genome is CT. Compared with when the base is TT, the sponge gourd has a higher browning resistance, that is, the proportion of browning-resistant fruits of CT-type plants is significantly higher than that of TT-type plants.

10. The method according to claim 8 or 9, characterized in that The reaction procedure of the PCR amplification includes: (I), pre-denaturation at 94°C-95°C for 14-15 min, denaturation at 94°C-95°C for 20-30 s, annealing and extension at 65°C-56°C for 60-70 s, 10-15 cycles, reducing the temperature by 0.6°C-0.8°C in each cycle; And / or, (II), denaturation at 94°C-95°C for 20s-30s, annealing and extension at 55°C-57°C for 60s-70s, for 26-30 cycles.

Images