Application of OsLOX1 gene in regulation and control of drought resistance and seed vigor of rice

Abstract

The invention discloses application of an OsLOX1 gene in regulation and control of drought resistance and seed vigor of rice, and relates to the technical field of plant genetic engineering. According to the invention, the drought stress tolerance of the mutation line with the OsLOX1 knocked out through CRISPR / Cas9 is lower than that of a wild type line, and along with the increase of the content of hydrogen peroxide (H2O2) and malondialdehyde (MDA) and the reduction of the expression quantity of antioxidant enzyme related genes. In addition, it is found that compared with a wild type, the service life of rice seeds is shortened by knocking out OsLOX1, meanwhile, the content of H2O2 and MDA is increased, and the activity of antioxidant enzyme superoxide dismutase (SOD) and catalase (CAT) is reduced; the method can be used for breeding storage-resistant and drought-resistant rice varieties; important gene resources are provided for cultivating drought-resistant rice varieties and prolonging the service life of seeds.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of OsLOX1 gene in regulating rice drought resistance and seed vitality. Background Art

[0002] Rice is an important food crop worldwide and the staple food for more than half of the world's population. As breeding technology improves, rice production is also increasing. However, global climate change has led to a gradual increase in changes in overall temperature and annual precipitation, which can lead to dry periods and eventually droughts. Drought stress is a major environmental stress that can severely impair plant growth and development and even cause severe losses in crop yields. In the absence of water, all physiological and biochemical processes such as photosynthesis, respiration, seed germination, root system and plant growth are severely affected, leading to progressive cell death. Therefore, breeders are in urgent need of producing more drought-resistant and high-yield plants.

[0003] During storage, the decline in seed vigor has an immeasurable negative impact on breeding work. Therefore, maintaining seed quality and vitality during long-term storage is a common challenge. There are many factors that affect seed vigor, such as environmental conditions, seed physiological state, and subspecies differences. In recent years, many researchers have extended seed vigor by improving storage methods and storage temperatures, but this often requires a lot of financial and material resources and cannot be widely promoted. With the rapid development of molecular biology technology, research on the genetic mechanism and physiological and biochemical mechanism of rice seed vitality has made great progress, which is of great significance to rice production.

[0004] Although several genes related to rice drought tolerance or seed vigor have been located and cloned, due to the complexity of drought tolerance mechanisms and mechanisms regulating seed vigor, the located and cloned genes are far from revealing the molecular mechanisms of rice drought and seed vigor, which limits the application of these genes in rice breeding. Therefore, it is urgent to explore more gene resources in a wide range of rice germplasm resources, identify and clone more new genes regulating rice drought tolerance and seed vigor, and lay the foundation for further exploring the molecular mechanisms of rice and cultivating rice varieties with high drought tolerance or seed vigor. Summary of the invention

[0005] In view of this, the present invention cloned the lipoxygenase OsLOX1 gene of the 13-lipoxygenase metabolic pathway from rice, and mainly studied its role in rice drought stress and seed germination. The present invention found that the OsLOX1 gene was expressed at a relatively high level in leaves and early germinating seeds. It was found that the tolerance of the mutant line of OsLOX1 knocked out by CRISPR / Cas9 to drought stress was lower than that of the wild-type line, and was accompanied by an increase in the content of hydrogen peroxide (H2O2) and malondialdehyde (MDA) and a decrease in the activity of catalase (CAT) and the expression of genes related to antioxidant enzymes. In addition, it was found that compared with the wild type, knocking out OsLOX1 reduced the lifespan of rice seeds, accompanied by an increase in the content of H2O2 and MDA and a decrease in the activity of antioxidant enzymes superoxide dismutase (SOD) and catalase (CAT). In general, knocking out LOX1 mutants reduced the tolerance of rice seedlings to drought stress and seed lifespan.

[0006] The first object of the present invention is to provide an application of an OsLOX1 gene in regulating rice drought resistance and / or regulating rice seed vigor.

[0007] It can be used for breeding storage-resistant and / or drought-resistant rice varieties.

[0008] Furthermore, knocking out or silencing the OsLOX1 gene reduces the drought resistance of rice.

[0009] Furthermore, the rice characteristics in the drought resistance include at least one of the following (1) to (6):

[0010] (1) Growth of rice plant height and rice panicle length under drought stress;

[0011] (2) Rice yield per plant under drought stress;

[0012] (3) Grain setting rate, grain thickness, and 1000-grain weight of rice under drought stress;

[0013] (4) Survival rate of rice under drought stress;

[0014] (5) Hydrogen peroxide, malondialdehyde, and CAT contents in rice under drought stress;

[0015] (6) Expression of genes related to the ROS scavenging system in rice under drought stress, wherein the genes related to the ROS scavenging system include at least one of OsCATB, OsCATC, OssodCc1, OsAPX2 and OsPOX1.

[0016] Specifically, knocking out or silencing the OsLOX1 gene will reduce the height of rice plants and the length of rice panicles, resulting in a decrease in the yield per plant and the fruit setting rate of rice, and a significant decrease in the thickness of rice grains and the thousand-grain weight. It will also lead to severe drought stress symptoms, and after watering is resumed after drought stress, the survival rate of plants will decrease.

[0017] Under drought conditions, OsLOX1 downregulated the expression of genes related to the ROS scavenging system, including OsCATB (catalase B), OsCATC (catalase C), OssodCc1 (copper / zinc superoxide dismutase 1), OsAPX2 (ascorbate peroxidase 2), and OsPOX1 (peroxidase 1).

[0018] Furthermore, knocking out or silencing the OsLOX1 gene reduces the vigor of rice seeds.

[0019] Furthermore, the characteristics of the seed vitality include seed germination potential, germination rate, germination index and anti-aging property.

[0020] Specifically, after knocking out or silencing the OsLOX1 gene, the germination potential, germination rate and germination index of the mutant were significantly lower than the corresponding values ​​of the WT plant (wild type); similarly, after 6 months of natural aging, the mutant lost seed vigor.

[0021] After six months of natural aging, the mutant plants showed increased H2O2 accumulation and a significant increase in malondialdehyde (MDA) content, and a significantly decreased superoxide dismutase (SOD) activity. Further testing of the expression of genes related to the ROS scavenging system showed that after aging, LOX1 downregulated the expression of CATA (catalase A), CATB (catalase B), and CATC (catalase C) genes.

[0022] In addition, the endosperm structure of the mutant plants showed a loose, fragile, and irregular structure, and the concentration of free fatty acids in the mutant plants was increased.

[0023] Furthermore, the nucleotide sequence of the OsLOX1 gene is as follows (a1) or (a2):

[0024] (a1) the nucleotide sequence shown in SEQ ID NO: 1;

[0025] (a2) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence expresses a protein with the same function.

[0026] A second object of the present invention is to provide a primer pair for amplifying the OsLOX1 gene, comprising a forward primer as shown in SEQ ID NO: 2 and a reverse primer as shown in SEQ ID NO: 3.

[0027] A third object of the present invention is to provide a primer pair for knocking out the OsLOX1 gene, comprising a forward primer as shown in SEQ ID NO:4 and a reverse primer as shown in SEQ ID NO:5.

[0028] The present invention also aims to provide a method for regulating agronomic traits of rice, comprising knocking out or silencing the OsLOX1 gene in rice to obtain rice with reduced tolerance to drought stress and / or rice with reduced seed vigor.

[0029] The present invention also aims to provide a method for regulating the free fatty acid content in rice seeds, comprising knocking out or silencing the OsLOX1 gene in rice to increase the free fatty acid content in rice seeds.

[0030] Furthermore, the free fatty acids include linolenic acid (LNA), linoleic acid (LA) and arachidonic acid (ARA).

[0031] Compared with the prior art, the present invention has the following advantages:

[0032] The present invention has discovered a new application of the OsLOX1 gene, and found that the mutant line with CRISPR / Cas9 knocking out OsLOX1 has lower tolerance to drought stress than the wild-type line, and is accompanied by an increase in the content of hydrogen peroxide (H2O2) and malondialdehyde (MDA) and a decrease in the activity of catalase (CAT) and the expression of genes related to antioxidant enzymes. In addition, it was found that compared with the wild type, knocking out OsLOX1 reduced the lifespan of rice seeds, accompanied by an increase in the content of H2O2 and MDA and a decrease in the activity of the antioxidant enzymes superoxide dismutase (SOD) and catalase (CAT). In general, knocking out the OsLOX1 mutant reduced the tolerance of rice seedlings to drought stress and the lifespan of seeds; it can be used for the breeding of rice storage-resistant and drought-resistant varieties; and it provides important gene resources for breeding drought-resistant rice varieties and improving seed lifespan. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is a phylogenetic classification, conserved domain and conserved motif feature diagram of rice and Arabidopsis LOX genes provided in the embodiments of the present invention.

[0034] Figure 2The present invention provides an expression pattern and subcellular localization diagram of the rice LOX1 gene. (A, B) Histochemical staining of GUS activity of the LOX1 gene in seedlings, roots, stems, leaves and early germination of seeds; (C) Real-time fluorescence quantitative PCR (qPCR) method was used to analyze the expression pattern of the LOX1 gene in different tissues and germination stages of rice; (D) In ​​rice protoplasts, the subcellular localization of the LOX1 gene in protoplasts was marked with C-terminal green fluorescent protein (GFP).

[0035] Figure 3 Schematic diagram of LOX1 mutation types and proteins provided in the embodiments of the present invention. Among them, (A) two mutation type diagrams and detection of relative expression levels; (B) two mutant protein schematic diagrams.

[0036] Figure 4 The agronomic traits of WT and lox1 mutants provided in the embodiments of the present invention are as follows: (A) phenotypes of WT and lox1 mutants in the test field; (B) comparison of mature ear traits of WT and lox1 mutants; (CH) plant height, ear length, yield per plant, seed setting rate, grain thickness, and 1000-grain weight of WT and lox1 mutants.

[0037] Figure 5 It is a drought sensitivity diagram of the lox1 gene knockout strain provided in the embodiment of the present invention. Among them, (A) phenotype of lox1 and WT seedlings; (B) survival rate of lox1 and WT plants before drought treatment; (C) survival rate of lox1 and WT plants after rehydration; (D) DAB histochemical staining shows the accumulation of H2O2 in WT and lox1; (E, F) MDA and H2O2 content of WT and lox1 before and after drought treatment; (G) CAT activity of WT and lox1 before and after drought treatment; (HL) expression level of ROS-related genes in WT and lox1 under drought stress. ** indicates that there is a significant difference between lox1 and the corresponding WT (**, P<0.01).

[0038] Figure 6It is a comparison diagram of rice seed vigor of WT and lox1 gene knockout mutant under natural aging conditions provided by the embodiment of the present invention. Among them, (A, B) WT and lox1 mutant seed germination at 3 days and 7 days after natural aging for 0 months and 6 months; (CE) germination potential, germination rate and germination index of WT and lox1 mutant under normal conditions; (FH) germination potential, germination rate and germination index of wild type and lox1 mutant after 6 months of natural aging; (IK) MDA, H2O2 and SOD content of WT and lox1 before and after aging; (LN) Expression level of ROS-related genes in WT and lox1 before and after aging. Values ​​are the mean ± standard deviation of three biological replicates; *, * According to Student's t-test, significant differences compared with WT are indicated at the 5% and 1% levels, respectively.

[0039] Figure 7 The present invention provides an example of the observation of endosperm starch granule structure and embryo free fatty acid concentration measurement diagram. Among them, (A) observation of rice endosperm starch granule structure of wild type (WT) and lox1 mutant after 6 months of natural aging; (B, C) heat map of rice embryo metabolite aggregation of WT and lox1 mutant before and after six months of artificial aging; (DF) concentrations of linoleic acid, linolenic acid and arachidonic acid in WT and lox1 mutant rice embryos before and after natural aging. DETAILED DESCRIPTION

[0040] Many specific details are set forth in the following description to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art can make similar modifications without violating the connotation of the present invention, so the present invention is not limited to the specific implementation disclosed below.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0042] Example 1 Phylogenetic analysis of rice LOXs gene family

[0043] So far, the rice lipoxygenase family reported in the literature contains 13 members. LOXs are distributed in various plants. The phylogenetic tree of the LOXs gene family was constructed with reference to the genome sequences of five species: rice, Arabidopsis, soybean, maize, and wheat. According to the evolutionary relationship of these genes, they can be divided into six subtypes (Ⅰ-Ⅵ). Subtypes Ⅰ, Ⅱ, and Ⅲ are all 9-LOX, and subtypes Ⅳ, Ⅴ, and Ⅵ are all 13-LOX. From an evolutionary perspective, the LOX1 (Os02g0194700) gene is more closely related to the maize ZmLOX10 (Zm00001d053675). The phylogenetic tree shows that OsLOX1 is more closely related in monocotyledonous plants such as rice, wheat, and maize than in dicotyledonous plants such as Arabidopsis, soybean, and tomato. From an evolutionary perspective, lipoxygenase genes may play an important role in the evolution of organisms, thereby enabling organisms to better adapt to environmental changes. In order to further understand the genetic structure of LOXs, LOX is divided into two subtypes according to the similarity of conserved motifs: 1-LOX and 2-LOX. The former is an apoplast enzyme that does not contain a transit peptide and has a high degree of sequence similarity with each other, which is the 1-LOX subtype; the latter contains a chloroplast transit peptide sequence in the structural domain, and these enzymes only show a moderate degree of overall sequence similarity with each other, which is the 2-LOX subtype. At the same time, according to the catalytic properties of plant LOXs, they are divided into 9-LOX and 13-LOX. However, so far, only 1-LOX has been found in 9-LOX, and both subtypes exist in 13-LOX. In rice and Arabidopsis, 22 genes belong to 13-LOX, and 14 genes belong to 9-LOX. LOX1 belongs to the 13-LOX metabolic pathway. In addition, based on the multiple amino acid sequence alignment, the conserved regions of these genes are divided into 10 conserved motifs. The types and numbers of conserved motifs contained in the LOX genes of different species are not consistent ( Figure 1 ), indicating that the plant LOXs gene family has been constantly evolving to adapt to environmental changes.

[0044] Example 2 Cloning of Rice LOX1 Gene

[0045] Total RNA was extracted from rice (Yunyin) seedlings, germinated seeds (after incubation for 0, 1, 3, 5 and 7 days) and various tissues (roots, stems, leaves and embryos, etc.) of transgenic plants using TRIzol reagent (TransGen Biotech, China). PCR amplification enzyme KOD FX DNA Polymerase provided by TOYOBO was used for amplification. The PCR amplification system was as follows: Primer Star 10μL, ddH2O 7μL, LOX1-CDS-F 1.5μL, LOX1-CDS-R 1.5μL, and template DNA 1μL. After adding the sample, mix and centrifuge. The PCR amplification program was as follows: 98℃ pre-denaturation for 5min; 98℃ denaturation for 10s, 65℃ annealing for 30s, 72℃ extension for 2min, a total of 35 cycles; 72℃ extension for 5min; 4℃ constant temperature. The CDS of the LOX1 gene was obtained from Yunyin. After amplification, the PCR product was detected by agarose gel electrophoresis, and the amplified product was recovered through the gel and sent to the company for sequencing, and the CDS of the LOX1 gene was obtained as shown in SEQ ID NO: 1.

[0046] Amplification primers are as follows:

[0047] LOX1-CDS-F (SEQ ID NO:2):ATGATTCACCCCAACCAGCCLOX1-CDS-R (SEQ ID NO:3):TCAGATGGAGATGCTGTTTGGG

[0048] Example 3 Expression pattern and subcellular localization of LOX1

[0049] To further understand the physiological function of LOX1 in rice, histochemical staining of GUS activity was performed on LOX1 promoter::GUS transgenic lines.

[0050] A 2-kb promoter fragment of OsLOX1 was amplified and inserted into the BamHI and NcoI sites of the pCAMBIA1305 plasmid. The recombinant vector was introduced into "Yunyin" by Agrobacterium-mediated method. GUS (β-glucuronidase) staining was performed on various tissues of transgenic plants by incubation at 37°C overnight using a GUS staining solution kit (Solarbio, Beijing, China). The tissues were decolorized with 75% ethanol to obtain photographic images of the tissues. Figure 2 As shown, GUS activity was observed to be relatively high in leaves and early stages of seed germination ( Figure 2 A, B).

[0051] Real-time fluorescence quantitative PCR (qPCR) was used to analyze the expression pattern of LOX1 during rice seed germination and seedling development. LOX1 transcripts were detected in the early stages of seed germination and leaves ( Figure 2 C). The increased expression of LOX1 in germinating seeds suggests that this gene may play an important role in regulating rice seed vigor and plant growth and development.

[0052] Subsequently, in this example, a recombinant LOX1 tagged with GFP at the C-terminus was constructed and transiently expressed in rice protoplasts to determine the subcellular localization of LOX1. The construction method is: amplify the coding sequence of OsLOX1 and ligate it to the BamHI and HindIII sites of the pRTVc-GFP plasmid to generate the recombinant plasmid LOX1::GFP.

[0053] Fluorescent proteins were scanned and observed using a TCS SP8 STED 3× laser confocal microscope (Leica, Germany). The green fluorescence of GFP-tagged LOX1 was observed to be distributed in the chloroplasts ( Figure 2 D), indicating that LOX1 protein is present in chloroplasts.

[0054] Example 4 Preparation of LOX1 mutant material

[0055] Predict the gRNA target of LOX1 exon through CRISPR-PLANT website and select targets of different fragments. Then log in to CRISPR RGEN Tools website to perform off-target analysis on the selected targets. After selecting the appropriate target, design knockout primers. Synthesize two pairs of specific primers:

[0056] Cas9-lox1-F(SEQ ID NO:4):AATAATGGTCTCTGGCGAGGGGC GCCGGTAGGCTCGGTTTTAGAGCTAGAAATAGC

[0057] Cas9-lox1-R(SEQ ID NO:5):ATTATTGGTCTCTAAACTGACGGTGGACAGGACCGCTGGCTTCTTGGTGCC

[0058] Using pCBC-MT1T2 plasmid as template, specific target primers were used for PCR amplification, and the product was inserted into pHUE411 vector to generate Cas9 vector. The japonica rice variety "Yunyin" was used as wild-type material (WT), and lox1 single knockout mutants were generated by CRISPR / Cas9 system. The lox1-positive transgenic lines were identified by sequencing, and the T3 seeds of these lines were used for subsequent analysis. The identification primer sequences are as follows:

[0059] OsU3-FD3 (SEQ ID NO:6): 5'-GACAGGCGTCTTCTACTGGTGC TAC-3'

[0060] TaU3-RD (SEQ ID NO:7): 5'-CTCACAAATTATCAGCACGCTA GTC-3'

[0061] Two homozygous lines were obtained through testing. At the same time, RNA was extracted from the leaves of the knockout lines and then converted into cDNA. The expression level was detected using fluorescence quantitative technology, and it was found that the expression level of LOX1 in the lox1 mutant was significantly lower than that in the wild type ( Figure 3 A). In addition, it was found that the protein translation of the two mutants was changed due to the mutation ( Figure 3 B) Then the homozygous seeds were planted in the experimental field and the phenotypic analysis was performed on the T3 generation plants.

[0062] LOX1-qPCR-F(SEQ ID NO:8):GAGCTCACCATCAAGGACTACLOX1-qPCR-R(SEQ ID NO:9):TAGAAGTCGATGTAATCCGACG

[0063] Example 5 Phenotype of lox1 knockout mutant at maturity

[0064] This example compares the differences in plant structure and grain shape between the two lox1 mutants and WT ( Figure 4 AB), phenotypic evaluation showed that disruption of LOX1 in the two knockout mutants resulted in decreased plant height and panicle length ( Figure 4 C, 5D), and similarly found that the yield per plant and fruit setting rate decreased, and the grain thickness and thousand-grain weight decreased significantly ( Figure 4 EH).

[0065] Example 6 The lox1 mutant reduces the tolerance of rice to drought stress

[0066] The experiment used T3 rice plants to be subjected to drought stress in plastic buckets filled with soil. Each replicate line consisted of 12 plants, with 3 replicates per line. Drought stress was applied by stopping irrigation for 14 days after the plants reached the five-leaf stage. Subsequently, the recovery rate and survival rate were monitored after re-watering the plants for 7 days. Drought stress conditions were simulated in plastic buckets at a soil depth of 0.5m.

[0067] The five-leaf stage plants were used as the analysis objects ( Figure 5 A). Under normal conditions, all strains grew normally with no significant differences ( Figure 5 B) When the plants were subjected to drought stress for 14 days, all knockout lines showed severe drought stress symptoms, and the plants were almost completely wilted compared to the wild-type lines. After 14 days of drought treatment, the plants were watered again. Four days after watering was resumed, fewer plants survived in the lox1 knockout lines than in the corresponding wild-type lines ( Figure 5 C) showed that knocking out lox1 reduced rice's tolerance to drought stress.

[0068] When plants are subjected to drought stress, ROS (Reactive oxygen species) accumulate in large quantities, resulting in an increase in the degree of membrane lipid peroxidation. In order to determine whether the level of ROS removal in transgenic plants has changed, this example performs DAB histochemical staining and hydrogen peroxide (H2O2) concentration determination on transgenic plants (lox#1, lox#2) and WT plants under drought stress. Physiological characteristics were measured according to the manufacturer's protocol (Solarbio), and hydrogen peroxide (H2O2) was detected using DAB staining. Before and after drought treatment, leaf samples were collected for quantitative determination of H2O2 content. In addition, embryo samples were collected from unaged and naturally aged rice seeds after 6 months, and the content of H2O2 was subsequently quantified.

[0069] Under drought treatment, WT plants had lighter DAB staining and less accumulation of hydrogen peroxide (H2O2), while lox1#1 and lox1#2 plants had darker DAB staining ( Figure 5 D), H2O2 accumulation and increased malondialdehyde (MDA) content, while catalase (CAT) activity was significantly reduced ( Figure 5 E, 5F, 5G). In addition, under drought conditions, lox1 downregulated the expression of genes related to the ROS scavenging system, including catalase B (OsCATB), catalase C (OsCATC), OssodCc1 (copper / zincsuperoxide dismutase 1), OsAPX2 (ascorbate peroxidase 2), OsPOX1 (peroxidase 1) ( Figure 5 H-5L).

[0070] Example 7 Disruption of LOX1 expression reduces seed vigor

[0071] Seed vigor is an important factor affecting seed germination and longevity. This example compares the evaluation of seed vigor of two lox1 mutants and WT.

[0072] Phenotypic evaluation showed that disruption of LOX1 in both knockout mutants resulted in decreased seed viability ( Figure 6 A), showing that under normal conditions, the germination potential, germination rate and germination index of the two lox1 mutants were significantly lower than those of the WT plants ( Figure 6 CE).

[0073] Further, the germination potential and germination rate of seeds under normal conditions and after 6 months of natural aging (storage under open conditions at room temperature for half a year) were investigated. In each experiment, 50 seeds of each plant, lox1 mutant and WT "Yunyin" were placed in a 9-cm diameter culture dish and cultured with 10 ml of distilled water in an incubator at 28±1°C, 100% relative humidity and 16-h light / 8-h dark cycle for 7 days. Seed vigor characteristics (germination potential, germination rate and germination index) were measured. Three biological replicates were performed for each sample.

[0074] After 6 months of natural aging, the two lox1 mutants lost seed viability ( Figure 6 B), which is manifested by germination potential, germination rate, and germination index being zero ( Figure 6 FH). This indicates that disruption of LOX1 expression will reduce seed vigor, and the seeds will completely lose vigor after 6 months of natural aging.

[0075] Rice seeds are subjected to oxidative stress during aging, and the activity of antioxidant enzymes in the body will undergo a series of changes. To further explore the effect of LOX1 on seed vigor, this study measured H2O2, MDA, and superoxide dismutase (SOD) in embryos of two lox1 mutants and WT that were not aged and aged for 6 months. The results showed that after six months of natural aging, WT plants accumulated less hydrogen peroxide (H2O2) and had lower MDA content, while lox1 mutant plants accumulated more H2O2 and had an increased content of malondialdehyde (MDA). Figure 6 I, J), SOD activity was significantly decreased ( Figure 6 K). This example further detected the expression of genes related to the ROS scavenging system. The results showed that after aging, LOX1 downregulated the expression of CATA (catalase A), CATB (catalase B), and CATC (catalase C) genes ( Figure 6 LN).

[0076] Example 8 Disruption of LOX1 affects the structure of cereal starch granules and the content of free fatty acids

[0077] During the storage of rice, nutrients such as starch in the endosperm are continuously consumed, causing the seed vitality to gradually decline. In order to study whether LOX1 affects the morphology of starch granules, this example performed scanning electron microscopy (SEM) analysis on the cross-sections of the seed endosperms of WT and lox1 mutant lines before and after natural aging. The seed endosperm structure of WT before and after natural aging was closely arranged, and the cell shape and size were uniform and regular. However, the endosperm structure of the two lox1 mutants before and after natural aging showed a loose, fragile, and irregular structure ( Figure 7 A).

[0078] In plants, lipid peroxidation and degradation are one of the important causes of seed aging, and the oxidation of polyunsaturated fatty acids (PUFAs) and free fatty acids will produce unsaturated fatty acid hydroperoxides. Therefore, it is speculated that the concentration of free fatty acids in rice embryos may be related to seed vigor. To verify this hypothesis, this example used a metabolomics method to detect the concentration of free fatty acids in embryos of WT and mutant lox1 before and after aging. It was found that before and after aging, the concentrations of many different types of free fatty acids in lox1, including LNA, LA, and ARA, were significantly higher than those in WT ( Figure 7 B-7F). The results showed that the free fatty acid content in rice embryos was negatively correlated with seed vigor.

[0079] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0080] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of OsLOX1 gene in regulating rice drought resistance and / or regulating rice seed vitality.

2. The use according to claim 1, characterized in that: Knocking out or silencing the OsLOX1 gene reduces the drought resistance of rice.

3. The use according to claim 2, characterized in that: The rice characteristics in the drought resistance include at least one of the following (1) to (6): (1) Growth of rice plant height and rice panicle length under drought stress; (2) Rice yield per plant under drought stress; (3) Grain setting rate, grain thickness, and 1000-grain weight of rice under drought stress; (4) Survival rate of rice under drought stress; (5) Hydrogen peroxide, malondialdehyde, and CAT contents in rice under drought stress; (6) Expression of genes related to the ROS scavenging system in rice under drought stress, wherein the genes related to the ROS scavenging system include at least one of OsCATB, OsCATC, OssodCc1, OsAPX2 and OsPOX1.

4. The use according to claim 1, characterized in that: Knocking out or silencing the OsLOX1 gene reduces the vigor of rice seeds.

5. The use according to claim 4, characterized in that: The characteristics of seed vitality include seed germination potential, germination rate, germination index and anti-aging property.

6. The use according to any one of claims 1 to 5, characterized in that: The nucleotide sequence of the OsLOX1 gene is as follows (a1) or (a2): (a1) the nucleotide sequence shown in SEQ ID NO: 1; (a2) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence expresses a protein with the same function.

7. The use according to any one of claims 1 to 5, characterized in that: The primer pair used to amplify the OsLOX1 gene includes a forward primer as shown in SEQ ID NO:2 and a reverse primer as shown in SEQ ID NO:

3.

8. The use according to any one of claims 1 to 5, characterized in that: The primer pair for knocking out the OsLOX1 gene includes a forward primer as shown in SEQ ID NO:4 and a reverse primer as shown in SEQ ID NO:

5.

9. A method for regulating agronomic traits of rice, characterized in that: The OsLOX1 gene is knocked out or silenced in rice to obtain rice with reduced tolerance to drought stress and / or rice with reduced seed vigor.

10. A method for regulating the free fatty acid content in rice seeds, characterized in that: Knocking out or silencing the OsLOX1 gene in rice can increase the content of free fatty acids in rice seeds.

Images