Mycoplasma hyopneumoniae multi-antigen fusion protein and vaccine composition and application thereof

Abstract

The invention discloses a mycoplasma hyopneumoniae multi-antigen fusion protein and a vaccine composition and application thereof, and belongs to the technical field of genetic engineering and vaccines. The fusion protein comprises an escherichia coli heat-labile enterotoxin LTB, a mycoplasma hyopneumoniae antigen protein P97R1, a mycoplasma hyopneumoniae lipoprotein 418 and a mycoplasma hyopneumoniae surface antigen protein P46 from the N terminal to the C terminal in the sequence. The vaccine composition comprises the fusion protein and an adjuvant acceptable in veterinary medicine. A vaccine prepared from the fusion protein has the advantages of higher pertinence and immunogenicity, the cell and humoral immune response level is remarkably improved, and meanwhile, the fusion protein is easy to purify and prepare and suitable for large-scale industrial production.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and vaccine technology, and in particular, relates to a Mycoplasma hyopneumoniae multi-antigen fusion protein, a preparation method thereof, a vaccine composition and application thereof. Background Art

[0002] Mycoplasma pneumonia in pigs is a chronic wasting disease caused by infection with Mycoplasma hyopneumoniae (Mhp). It not only causes a 12%-16% decrease in the growth rate of pigs and delays the market release of commercial pigs by 10-30 days (Shao Guoqing, Liu Maojun, Jin Min. Establishment of an indirect ELISA method for detecting antibodies to Mycoplasma hyopneumoniae. Journal of Jiangsu Agricultural Sciences, 2007, 23: 437-441), but also damages the pig's bronchi, cilia and macrophages, reduces the body's immune clearance ability (Ye Baohong, Yang Liu. Current status of immunological research on Mycoplasma hyopneumoniae. Journal of Yulin College, 2009, 192.2), causes secondary infection and mixed infection, and is one of the main pathogens causing porcine respiratory syndrome (PRDC) (Maes D, Segales J, Meyns T, et al. Control of Mycoplasma hyopneumoniae infections in pigs. Vet Microbiol, 2008, 126: 297-309). The disease is characterized by high contact, high infectivity and high morbidity. In my country, the infection rate of Mycoplasma hyopneumoniae is as high as 50%-80%, and the infected pigs excrete the virus for up to 254 days (Pieters et al. An assessment of the duration of Mycoplasma hyopneumoniae infection in an experimentally infected population of pigs. Vet Microbiol. 2009, 134 (3-4): 261-6). The direct economic losses caused to my country's pig industry each year are more than 4 billion, and it is a major epidemic disease that seriously restricts the economic development of the pig industry.

[0003] At present, porcine mycoplasma pneumonia is mainly controlled by drugs and vaccines. Since mycoplasma swine pneumonia lacks cell walls and is insensitive to commonly used antibiotics that act on cell walls (such as β-lactamase antibiotics, etc.), once the pig herd is infected, it will be very difficult to control and purify it, and the long-term use of antibiotics does not conform to the current new trend and new demand of "antibiotic reduction and restriction" in livestock and poultry farming. Vaccination is an important means of preventing and controlling porcine mycoplasma pneumonia. More than 70% of pig farms in many countries around the world use Mhp vaccines to control the spread of the disease. Common Mhp vaccines include: "Rebex" inactivated vaccine developed by Pfizer Pharmaceuticals Co., Ltd. of the United States; "Porcine Klebsiella pneumoniae" commercial inactivated vaccine prepared by Merial Animal Health Co., Ltd. with Algeldrate as an immune adjuvant; an inactivated vaccine developed by Fort Dow Animal Health Company of the United States with polyethylene resin as an immune adjuvant; "Ingelfa" inactivated vaccine developed by Boehringer Ingelheim of Germany, etc. In fact, only 5%-10% of domestic pig farms have been vaccinated with mycoplasma vaccines, and are heavily dependent on imports. According to statistics in 2017, the total amount of domestic porcine mycoplasma pneumonia vaccine has reached 77 million doses, which is still less than half of the total amount of imported porcine mycoplasma pneumonia vaccine (186 million doses). It is urgent to achieve the localization of porcine mycoplasma pneumonia vaccine.

[0004] The cultivation conditions of Mycoplasma hyopneumoniae are extremely harsh and the cultivation cost is high, which leads to the high price of inactivated Mycoplasma pneumoniae vaccines. How to reduce the production cost of Mycoplasma pneumoniae vaccines and improve the immune level of vaccines, especially the cellular immune level, is the key to achieving or even breaking through the "bottleneck" technology of imported vaccines. It is also an urgent task to solve the bottleneck of Mycoplasma pneumoniae vaccine production and improve the cost-effectiveness and competitiveness of domestic vaccines.

[0005] The development of a low-cost, safe and efficient new subunit vaccine for porcine mycoplasma pneumonia using genetic engineering methods will become an important direction for preventing and treating the disease and achieving a curve overtaking of domestic vaccines. Escherichia coli heat-labile enterotoxin LTB is an important mucosal immune adjuvant, commonly used in commercial vaccines, which can significantly enhance cellular immune responses (Knapp, MA et al. Immunomodulatory regulation by heat-labile enterotoxins and potential therapeutic applications. Expert Rev Vaccines, 2021, 20, (8), 975-987). The P97 gene of Mycoplasma hyopneumoniae encodes a ciliary adhesin, which is an important key factor related to the respiratory colonization of Mycoplasma hyopneumoniae. The main antigen of P97 is distributed in the R1 region (AAKPV / E tandemly repeated short peptide sequence) at its C-terminus (Minion FC, Adams C, Hsu T. R1 region of P97 mediates adherence of Mycoplasma hyopneumoniae to swinecilia. Infect Immun, 2000, 68: 3056-3060). P46 is a surface antigen protein of Mycoplasma hyopneumoniae, which can induce an early immune response in the host. P97 and P46 are often used as the preferred target genes for vaccine design and are used in the development and research of genetically engineered vaccines of Mycoplasma hyopneumoniae.

[0006] At present, there is no approved commercial subunit vaccine for porcine mycoplasma pneumonia in China. The reported subunit vaccines for porcine mycoplasma pneumonia can often induce high levels of humoral immune antibodies (Simionatto, S. et al. Immunological characterization of Mycoplasma hyopneumoniae recombinant proteins. Comparative immunology, microbiology and infectious diseases, 2012, 35, (2), 209-16), but the cellular immune activation effect is poor. Cellular immunity is the key to effective prevention and control of porcine mycoplasma pneumonia. Only when both humoral immunity and cellular immunity levels are maintained at a high level can ideal protection be provided to pigs (Beuckelaere, L. et al. Different local, innate and adaptive immune responses are induced by two commercial Mycoplasma hyopneumoniae bacterins and an adjuvantalone. Front Immunol, 2022, 13, 1015525). Summary of the invention

[0007] In view of the deficiencies in the prior art, the object of the present invention is to provide a fusion protein LTB-P97R1-418-P46 that can significantly enhance the body's cellular immune response, a DNA molecule encoding the fusion protein, a preparation method and application of the fusion protein, and a vaccine composition prepared using the fusion protein.

[0008] In order to achieve the above technical purpose, the inventors have found that the hypothetical lipoprotein 418 protein encoded by the MHP168L_418 gene of Mycoplasma hyopneumoniae is 3.55 times more abundant in Mycoplasma hyopneumoniae strains than in vaccine strains by in-depth study of the whole genome of Mycoplasma hyopneumoniae and using differential proteomics technology. Adhesion experiments have confirmed that the 418 protein plays an important role in the process of Mycoplasma hyopneumoniae targeting adhesion to respiratory cilia and porcine alveolar macrophages, and its antibodies can effectively block the adhesion of Mycoplasma hyopneumoniae to porcine cilia and porcine alveolar macrophages. In addition, the 418 protein can induce apoptosis of immune cells such as porcine alveolar macrophages, monocytes, and lymphocytes, and the antibody of the 418 protein can block the process of apoptosis of immune cells. In view of the important role of the 418 protein in the pathogenesis of Mycoplasma hyopneumoniae, after immunizing animals with it as an antigen, the body can be induced to produce corresponding antibodies, blocking ciliary adhesion, cell adhesion and apoptosis of immune cells, thereby reducing the infection ability of Mycoplasma hyopneumoniae. Furthermore, the inventors used 418, P97R1 and P46 proteins as antigens, and prepared vaccines in series with Escherichia coli heat-labile enterotoxin LTB and immunized animals. The experimental results showed that the vaccine could induce the body to produce higher levels of IgG and IgM humoral immune antibodies, and the IFN-γ produced by the body was 2.73 times that of the Boehringer commercial vaccine immunization group (P < 0.001), and the induced CD3 + CD4 + The differentiation level was 1.38 times that of the Boehringer vaccine (P < 0.001), and the induced CD3 + CD8 + The differentiation level was 1.14 times that of the Boehringer vaccine (P<0.05), and the cellular immunity level induced by the LTB-P97R1-418-P46 vaccine was significantly better.

[0009] Based on the above research results, the object of the present invention is achieved as follows: a fusion protein, the fusion protein comprising, from N-terminus to C-terminus, Escherichia coli heat-labile enterotoxin LTB, Mycoplasma hyopneumoniae antigen protein P97R1, Mycoplasma hyopneumoniae lipoprotein 418 and Mycoplasma hyopneumoniae surface antigen protein P46.

[0010] Further preferably, in the fusion protein as described above, wherein: the amino acid sequence of the Escherichia coli heat-labile enterotoxin LTB is shown in SEQ ID NO.1 in the sequence listing, the amino acid sequence of the Mycoplasma hyopneumoniae antigen protein P97R1 is shown in SEQ ID NO.3 in the sequence listing, the amino acid sequence of the Mycoplasma hyopneumoniae lipoprotein 418 is shown in SEQ ID NO.5 in the sequence listing, and the amino acid sequence of the surface antigen protein P46 of the Mycoplasma hyopneumoniae is shown in SEQ ID NO.7 in the sequence listing.

[0011] Further preferably, the fusion protein as described above is formed by connecting Escherichia coli heat-labile enterotoxin LTB, Mycoplasma hyopneumoniae antigen protein P97R1, Mycoplasma hyopneumoniae lipoprotein 418 and Mycoplasma hyopneumoniae surface antigen protein P46 in series using a connecting peptide, and the Mycoplasma hyopneumoniae surface antigen protein P46 is P46 with the signal peptide removed. Still further preferably, the amino acid sequence of the fusion protein as described above is shown in SEQ ID NO.9 in the sequence table.

[0012] At the same time, the present invention also provides a DNA molecule encoding the above fusion protein. The applicant obtained an artificially synthesized expression of the Mycoplasma hyopneumoniae fusion gene LTB-P97R1-418-P46 by genetic engineering, which is a DNA molecule of the fusion protein obtained by connecting the Escherichia coli heat-labile enterotoxin LTB and the Mycoplasma hyopneumoniae P97R1 gene and 418 gene in series by the Linker method (the base sequence of the Linker is: GGCAGCGGCAGCGGCAGCGGCAGC), and deleting the termination codon (TAA) of the LTB gene and the 418 gene, and fusing the P46 gene with the signal peptide removed at the C-terminus of the 418 gene by the Linker method. Further preferably, the nucleotide sequence of the DNA molecule of the fusion gene LTB-P97R1-418-P46 is shown in SEQ ID NO.10 in the sequence table.

[0013] In addition, the present invention also provides a method for preparing the above fusion protein, which comprises sequentially constructing a cloning vector and an expression vector of the fusion protein through genetic engineering technology, transforming the expression vector, and then expressing, purifying and identifying the fusion protein. Specifically, the fusion protein of the present invention is prepared by the following method: inserting the above-mentioned Mycoplasma hyopneumoniae fusion gene LTB-P97R1-418-P46 into the NcoI and XhoI sites of the prokaryotic expression vector pET-30a(+) to construct a recombinant plasmid pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46, and transforming the recombinant plasmid into Escherichia coli to obtain a recombinant Escherichia coli BL21 / pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46. We named the recombinant Escherichia coli BL21 / pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46, Escherichia coli BL21 / pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46.

[0014] Furthermore, the present invention also provides a porcine mycoplasma pneumonia vaccine composition, characterized in that the vaccine composition comprises the above-mentioned fusion protein and a veterinarily acceptable adjuvant. Further preferably, the adjuvant is Gel02 PR adjuvant.

[0015] Finally, the present invention provides the use of the above fusion protein in the preparation of vaccines or drugs for preventing and / or treating diseases related to Mycoplasma hyopneumoniae.

[0016] Compared with the prior art, the advantages and advancements of the present invention include:

[0017] (1) A fusion LTB-P97R1-418-P46 protein was obtained. The immunogenicity of this fusion protein was significantly higher than that of a single antigen protein, laying the foundation for the development of a new porcine mycoplasma pneumonia vaccine.

[0018] (2) The fusion protein LTB-P97R1-418-P46 is a concatenation of the Escherichia coli heat-labile enterotoxin LTB gene and multiple dominant antigen genes of Mycoplasma hyopneumoniae, making it more targeted and immunogenic, and significantly improving the levels of cellular and humoral immune responses.

[0019] (3) The fusion protein LTB-P97R1-418-P46 of the present invention has a relatively low-cost gene resource, and the subunit vaccine based on the LTB-P97R1-418-P46 fusion protein has a high expression level, is easy to purify and prepare, and is suitable for large-scale industrial production. Compared with conventional inactivated vaccines and attenuated vaccines, the cost of the porcine mycoplasma pneumonia subunit vaccine prepared by the present invention is significantly reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : is a schematic diagram of the construction of the recombinant plasmid pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46 in the present invention.

[0021] Figure 2 : is a gel image of the purified LTB-Linker-P97R1-Linker-418-Linker-P46, P46, P97R1, 418 recombinant proteins of the present invention. Markings in the figure: M: protein molecular weight; Lane 1: purification of P46 recombinant protein; Lane 2: purification of P97R1 recombinant protein; Lane 3: purification of 418 recombinant protein; Lane 4: purification of LTB-Linker-P97R1-Linker-418-Linker-P46 fusion protein.

[0022] Figure 3: IFN-γ secretion levels of spleen lymphocytes after immunization with different recombinant subunit vaccines. Marking instructions in the figure: L946 is the LTB-Linker-P97R1-Linker-418-Linker-P46 subunit vaccine immunization group.

[0023] Figure 4 :CD3 after immunization with different recombinant subunit vaccines + CD4 + Lymphocyte differentiation level. Marking instructions in the figure: L946 is the LTB-Linker-P97R1-Linker-418-Linker-P46 subunit vaccine immunization group.

[0024] Figure 5 :CD3 after immunization with different recombinant subunit vaccines + CD8 + Lymphocyte differentiation level. Marking instructions in the figure: L946 is the LTB-Linker-P97R1-Linker-418-Linker-P46 subunit vaccine immunization group.

[0025] Figure 6 : Detection of IgM antibody levels in serum of BALB / c mice after immunization with different recombinant subunit vaccines LTB-Linker-P97R1-Linker-418-Linker-P46, P46, P97R1, 418, Gel02 PR adjuvant and phosphate buffered saline (PBS). Markings in the figure: L946 is the LTB-Linker-P97R1-Linker-418-Linker-P46 subunit vaccine immunization group.

[0026] Figure 7 : Detection of IgG antibody levels in serum of BALB / c mice after immunization with different recombinant subunit vaccines LTB-Linker-P97R1-Linker-418-Linker-P46, P46, P97R1, 418, Gel02 PR adjuvant and phosphate buffered saline (PBS). Markings in the figure: L946 is the LTB-Linker-P97R1-Linker-418-Linker-P46 subunit vaccine immunization group. DETAILED DESCRIPTION

[0027] Example 1: Construction of LTB-P97R1-418-P46 fusion gene

[0028] 1. Cultivation of Mycoplasma hyopneumoniae

[0029] The revived fresh MHP168 strain F107 was inoculated into the Mycoplasma hyopneumoniae culture medium at a ratio of 1:10 and cultured in a 37°C incubator. The bacteria could be collected when the culture medium changed from clear red to clear yellow, i.e., when the pH value of the culture medium dropped from 7.6 to 6.8.

[0030] 2. Extraction of Mycoplasma Genomic DNA

[0031] Mycoplasma genomic DNA was extracted using a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number: DP302). The specific steps are as follows:

[0032] (1) Take 1-5 mL of Mycoplasma hyopneumoniae culture medium and centrifuge at 12,000 r / min for 30 min. Aspirate the supernatant as much as possible.

[0033] (2) Add 200 μL of buffer GA to the bacterial pellet and shake until the bacteria are completely suspended.

[0034] (3) Add 20 μL of proteinase K solution to the tube and mix well.

[0035] (4) Add 220 μL of buffer GB, shake for 15 seconds, and place at 70°C for 10 minutes. The solution should become clear and centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0036] (5) Add 220 μL of anhydrous ethanol and vortex to mix thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0037] (6) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12,000 r / min for 30 seconds, pour out the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0038] (7) Add 500 μL of buffer GD to the adsorption column CB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 r / min for 30 sec, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0039] (8) Add 600 μL of rinse solution PW to the adsorption column CB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 r / min for 30 sec, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0040] (9) Repeat operation (8).

[0041] (10) Place the adsorption column CB3 in a collection tube and centrifuge at 12,000 r / min for 2 min. Pour away the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0042] (11) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50-200 μL of elution buffer TE to the middle of the adsorption membrane, let it stand at room temperature for 2-5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution in a centrifuge tube.

[0043] (12) Determine the concentration and use MHP168 strain-specific 16sRNA primers to amplify and detect whether the extracted genomic DNA is correct.

[0044] 3. Primer design (see Table 1)

[0045] Table 1 PCR primers

[0046]

[0047] The underlined parts in the primer sequences in Table 1 are the corresponding restriction sites. The sequences in bold in the P97R1 primer, 418 primer and P46 primer are the nucleotide sequences of the linker. The primers in Table 1 were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0048] 4. Synthesis of LTB gene

[0049] With reference to the gene sequence of LTB (GenBank accession number QED76467.1), Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the LTB gene (see sequence listing as shown in SEQ ID NO.2).

[0050] 5. Amplification of P46, 418 and P97R1 genes

[0051] The genomic DNA of Mycoplasma hyopneumoniae strain 168 (Liu W, Feng ZX, Fang LR, et al. Complete genome sequence of Mycoplasma hyopneumoniae strain 168. Journal of Bacteriology. 2011, 193: 1016-1017) was used as a template to amplify the P97R1 (GenBank accession number ADQ90328.1), 418 (GenBank accession number AGM22196.1) and P46 genes (GenBank accession number ADQ90718.1) using Prime STAR.

[0052] The system for PCR amplification is shown in Table 2:

[0053] Table 2 PCR amplification system

[0054]

[0055] The amplification conditions of the P97R1 gene sequence are: 94.0°C for 5 min pre-denaturation followed by cycling, the cycling parameters are: 98.0°C for 10 s, 59.0°C for 15 s, 72.0°C for 30 s, and a final extension at 72.0°C for 10 min after 35 cycles. The amplified PCR product was analyzed by 0.8% agarose gel electrophoresis, and a 252 bp DNA fragment (P97R1) was obtained by PCR amplification (see SEQ ID NO. 4 in the sequence table).

[0056] The amplification conditions of the 418 gene sequence were: 98.0℃5min pre-denaturation followed by cycling, and the cycle parameters were: 98.0℃10s, 52.0℃15s, 72.0℃2min, and 72.0℃ final extension for 10min after 35 cycles. The amplified PCR product was analyzed by 0.8% agarose gel electrophoresis, and a 1809bp DNA fragment (missing the stop codon) was obtained by PCR amplification. TAA 418 gene), and optimized the TGA codon in the 418 gene to TGG by site-directed mutagenesis PCR (the nucleotide sequence of the optimized 418 gene is shown in the sequence table SEQ ID NO.6).

[0057] The amplification conditions of the P46 gene sequence were: 95.0℃5min pre-denaturation followed by cycling, and the cycling parameters were: 98.0℃10s, 59.0℃15s, 72.0℃1.5min, and 72.0℃ extension for 10min after 35 cycles. The amplified PCR product was analyzed by 0.8% agarose gel electrophoresis, and a 1146bp DNA fragment was obtained by PCR amplification (missing the signal peptide sequence: ATGAAAAAAATGCTTAG AAAAAAATTTTTGTATTCATCAGCTATTTATGCAACTTCG CTTGCATCAATTATTGCATTTGTTGCAGCAGGTTG TGGACAGACAGAATCAGGTTC G ), and the TGA codon in the P46 gene was optimized to TGG by site-directed mutagenesis PCR (the nucleotide sequence of the optimized P46 gene is shown in the sequence table SEQ ID NO.8).

[0058] 6. Construction of recombinant plasmid pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46

[0059] The P46 gene was amplified by PCR using primers P46-F and P46-R to obtain the P46 gene lacking the P46 N-terminal signal peptide. The gene fragment was recovered and double-digested with Not I and Xho I, and then inserted between the NotI and Xho I sites of pET-30a (+) (Novagen, Germany) to obtain the recombinant plasmid pET30a-P46. The 418 gene (removing the stop codon) was further amplified using primers 418-F and 418-R, and the obtained PCR product was double-digested with Not I and Sal I, and then connected to the pET30a-P46 plasmid digested with Not I and Sal I to obtain the recombinant plasmid pET30a-418-Linker-P46. The R1 region of the P97 gene was amplified using primers P97-F and P97-R. The obtained PCR product was double-digested with BamH I and Sal I, and then ligated with the pET30a-418-Linker-P46 plasmid digested with BamH I and Sal I to obtain the recombinant plasmid pET30a-P97R1-Linker-418-Linker-P46. The LTB gene was amplified using LTB-SF and LTB-SF primers. The amplification conditions of the LTB gene sequence were: 98.0℃5min pre-denaturation followed by cycling, and the cycling parameters were: 98.0℃10s, 55.2℃15s, 72.0℃30s, and 72.0℃ final extension for 10min after 35 cycles. The obtained PCR product was double-digested with BamH I and Nco I, and then connected with the pET30a-P97R1-Linker-418-Linker-P46 plasmid digested with BamH I and Nco I to obtain the LTB-P97R1-418-P46 fusion gene and the prokaryotic expression plasmid pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46 expressing the fusion gene. Enzyme digestion and sequencing confirmed that the recombinant plasmid was constructed correctly. The structure of the recombinant plasmid pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46 is shown in the figure below. Figure 1 shown.

[0060] 7. Construction of recombinant plasmids pET32a-P97R1, pET30a-418, and pET32a-P46 (for comparison with the immune effect of a single gene in comparative experiments)

[0061] Using the genomic DNA of Mycoplasma hyopneumoniae strain 168 (Liu W, Feng ZX, Fang LR, et al. Complete genome sequence of Mycoplasma hyopneumoniae strain 168. Journal of Bacteriology. 2011, 193: 1016-1017) as a template, primers P1 and P2 were used to amplify the DNA fragment P97R1, primers P3 and P4 were used to amplify the DNA fragment 418, and primers P5 and P6 were used to amplify the DNA fragment P46. PCR amplification system refers to Table 2. The amplification conditions of the P97R1 gene sequence are as follows: pre-denaturation at 94.0°C for 3 min before entering the cycle, and the cycle parameters are as follows: 98.0°C for 10 s, 59.0°C for 15 s, 72.0°C for 30 s, and a final extension at 72.0°C for 10 min after 35 cycles; the amplification conditions of the 418 gene sequence are as follows: pre-denaturation at 98.0°C for 5 min before entering the cycle, and the cycle parameters are as follows: 98.0°C for 10 s, 52.0°C for 15 s, 72.0°C for 2 min, and a final extension at 72.0°C for 10 min after 35 cycles; the amplification conditions of the P46 gene sequence are as follows: pre-denaturation at 95.0°C for 5 min before entering the cycle, and the cycle parameters are as follows: 98.0°C for 10 s, 59.0°C for 15 s, 72.0°C for 1.5 min, and a final extension at 72.0°C for 10 min after 35 cycles. The amplification results were detected by 0.8% agarose gel electrophoresis, and the target fragments were purified and recovered. The purified amplification products P97R1 and P46 were double-digested with BamH I and Xho I, and then cloned into the corresponding sites (BamH I and Xho I) of the prokaryotic expression vector pET-32a(+) (Novagen, Germany) to obtain recombinant plasmids pET32a-P46 and pET32a-P97R1 expressing the P46 and P97R1 genes, respectively. The purified amplification product 418 was double-digested with BamH I and Sal I, and then cloned into the corresponding sites (BamH I and Sal I) of the prokaryotic expression vector pET-30a(+) (Novagen, Germany) to obtain the recombinant plasmid pET30a-418 expressing the 418 gene. The TGA codon in the 418 gene and P46 gene was further optimized to TGG by site-directed mutagenesis PCR. The constructed plasmids were confirmed to be correctly constructed after restriction digestion and PCR identification, and sequencing confirmed that there was no base mismatch.

[0062] Example 2: Prokaryotic expression of recombinant plasmid pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46

[0063] 1. Plasmid Transformation

[0064] The expression plasmid pET30a-LTB-Linker-P97R1-Linker-418-Linker-P46 (kanamycin resistance) containing the Mycoplasma hyopneumoniae LTB-P97R1-418-P46 fusion gene was transformed into Escherichia coli BL21 competent cells.

[0065] The specific operations are as follows:

[0066] (1) Transfer 100 μL of E. coli BL21 competent cell suspension to a sterile 1.5 ml EP tube, add 3 μL of ligation product, gently rotate to mix the contents, and place on ice for 30 min.

[0067] (2) Heat shock the centrifuge tube in a circulating water bath preheated to 42°C for 90 seconds.

[0068] (3) Quickly transfer the centrifuge tube to an ice bath and allow the cells to cool for 1 to 2 minutes.

[0069] (4) Add 400 μL of LB medium to each tube. Heat the medium to 37°C in a water bath, then transfer the centrifuge tube to a 37°C shaker and incubate for 50 minutes to allow the bacteria to recover. To achieve effective transformation, the speed should not exceed 225 rpm during recovery.

[0070] (5) Take 100 μL of the transformed competent cells and transfer them to an LB agar plate containing the corresponding antibiotics. Use a sterile curved glass rod to evenly spread the transformed cells on the surface of the agar plate.

[0071] (6) Incubate the plate at 37°C until the liquid is absorbed, then invert the plate for incubation. Colonies should appear after 12 to 16 hours.

[0072] 2. Prokaryotic Expression

[0073] Pick a single colony for expansion and culture, use a plasmid mini-extraction kit (Tiangen Biochemical Technology Co., Ltd.) to extract its plasmid for enzyme digestion identification and preserve the bacterial solution. After correct identification, the preserved bacterial solution was revived at a volume ratio of 1:1000. The next day, induce at a volume ratio of 1:100. Induce at a final concentration of 1mM IPTG, 37°C and 180r / min. Take 1mL of sample before and 3h, 4h, 5h and 6h after induction, and use the bacterial induced product of E.coli BL21 (DE3) transformed with the pET-30a vector as a blank control. After centrifugation at 12000r / min for 1min, add 100μL ddH 2After resuspending the bacterial solution, add 25 μL 5× Loading Buffer, boil in boiling water at 100°C for 10 minutes, and ice bath for 10 minutes. Then, analyze the sample by 12% SDS-PAGE to determine whether the recombinant prokaryotic protein is expressed. When performing SDS-PAGE detection, all samples are centrifuged at 10,000 r / min for 1 minute before loading, and the sample located on the upper surface of the sample liquid is extracted for loading. After confirming that the prokaryotic recombinant protein can be stably expressed, induce 100 mL of recombinant bacteria again, break it with a high-pressure crusher, centrifuge it at 12,000 r / min for 10 minutes, boil the supernatant and precipitate separately, and perform 10% SDS-PAGE detection.

[0074] Example 3: Purification of LTB-Linker-P97R1-Linker-418-Linker-P46 Fusion Protein

[0075] The LTB-Linker-P97R1-Linker-418-Linker-P46 fusion protein expressed in soluble form was purified using AKTA FPLC (Amersham Biosciences UPC-900) as follows:

[0076] (1) Centrifuge 200 mL of bacterial suspension after 5 hours of induction at 12,000 r / min for 1 min, discard the supernatant, resuspend the precipitate in Binding Buffer (1 / 10), place in a -80°C refrigerator, freeze and thaw three times, and then use an ultra-high pressure wave crusher to break it until it is clear. Centrifuge at 12,000 r / min for 30 min, take the supernatant, filter it with a 0.22 μm filter membrane, and place it on ice for later use.

[0077] (2) Turn on the analyzer, then turn on the computer, select UNICORNS.1.0, select default, and click OK.

[0078] (3) Select System control, place probes A and B in 20% anhydrous ethanol, and turn on Manual → Pump → Pump Wash → A: ON, B: ON → Execute; Flow → Flow Rate 1.0 mL / min, and start pumping until the system automatically cleans.

[0079] (4) While anhydrous ethanol is flowing, the protein purification column is loaded into the designated position and anhydrous ethanol is continued to flow to clean the purification column, about 30 mL.

[0080] (5) Pause → After cleaning the probe (Pump A and Pump B) with distilled water, place Pump A in Binding Buffer and Pump B in Elution Buffer → Continue. Gradient 0.0% does not require adjustment.

[0081] (6) After about 60 mL, when the red and blue lines are parallel, Pause, clean pump A, and place in the sample. Continue at 0.5 mL / min. After the sample is loaded, Pause, clean pump A, and place in Binding Buffer. Continue until the red line drops to the lowest point. Then flow another 10 mL to start elution at a flow rate of 1.0 mL / min.

[0082] (7) Starting from 10%, different elution concentrations can be used for elution. Each time a different elution concentration is changed, the red and blue lines must remain parallel to each other. The final value is 100%, and all samples are collected at the peak of each elution concentration.

[0083] (8) Pause, clean pumps A and B, and place them in anhydrous ethanol. Continue until the red and blue lines drop to the lowest level and become parallel. End. Remove the purification column, close all operating windows, and turn off the analyzer and computer.

[0084] (9) The concentration of the purified protein was determined by spectrophotometer, and its purity was tested by SDS-PAGE. The purified protein was stored at -80°C for subsequent experiments. Figure 2 shown.

[0085] Example 4: Biological experiment on the immune efficacy of the subunit vaccine of the present invention and the control vaccine on mice

[0086] Immunization procedure of BALB / c mice: 48 5-6 week old female BALB / c mice were divided into 8 groups, namely PBS control group, Gel02 PR adjuvant immunization group, recombinant protein P46 immunization group, recombinant protein P97R1 immunization group, recombinant protein 418 immunization group, recombinant protein LTB-Linker-P97R1-Linker-418-Linker-P46 (L946) immunization group, 6 mice in each group, hind leg intramuscular injection, group immunization according to Table 3, 2 immunizations in total, 35 days after the first immunization, the second immunization was performed. Blood was collected by negative pressure on the tail vein 35, 42, and 56 days after the first immunization, serum was separated, and the antibody level in the serum was detected.

[0087] Table 3: Experimental groups of mice for Mycoplasma hyopneumoniae recombinant subunit vaccine

[0088]

[0089] Example 5: Determination of IFN-γ secretion level

[0090] IFN is an important cytokine involved in Th1 cell immune response. After the stimulation of mouse spleen lymphocytes, the expression of IFN-γ was detected by Mouse IFN-γImmunoassay Kit. The specific operation method is as follows:

[0091] (1) Pipette 50 μL of culture supernatant from each culture well, add an equal amount of sample diluent, and then add it to the ELISA plate coated with anti-mouse IFN-γ monoclonal antibody; at the same time, add different concentrations of standard samples to other wells of the same ELISA plate (100 μL / well) to draw a standard curve.

[0092] (2) After incubating the ELISA plate at 37°C for 1 h, wash the plate four times.

[0093] (3) Add 100 μL / well of biotinylated antibody working solution, incubate at 37°C for 1 h, and wash the plate four times.

[0094] (4) Add 100 μL / well of enzyme conjugate working solution, incubate at 37°C for 1 h, and wash the plate four times.

[0095] (5) Add 100 μL / well of color developer and incubate at 37°C for 15-20 min in the dark.

[0096] (6) Add 100 μL / well of stop solution, mix well, and measure OD immediately 450nm value.

[0097] (7) Based on the OD value and corresponding concentration of the standard, a standard curve and a linear relationship between OD value and concentration were drawn to calculate the IFN-γ content of the sample.

[0098] The test results are as follows Figure 3 As shown, the L946 fusion protein immunization group can significantly activate the body's IFN-γ secretion, and the IFN-γ secretion activated by the fusion protein is significantly higher than that of the single protein immunization group and the P46+P97R1 combined immunization group, with a very significant difference (P<0.01). The IFN-γ level activated by the L946 immunization group is 2.73 times that activated by the Boehringer commercial vaccine immunization group, with a very significant difference (P<0.001).

[0099] Example 6: Detection of lymphocyte differentiation in spleen by flow cytometry

[0100] The spleen is the largest immune organ in the body, and mature CD3 + T cells, which can differentiate into CD4 + and CD8 + There are two T cell subtypes, CD8 +It is a suppressive / cytotoxic T cell that can specifically kill target cells infected by pathogens. + It is an auxiliary / inducible T cell that can affect the maturation and activation of cytotoxic T cells and is closely related to cellular immunity.

[0101] Flow cytometry was used to detect CD3 + CD4 + 、CD3 + CD8 + Differentiation ratio of lymphocytes. Separate the lymphocytes in the spleen with lymphocyte separation fluid, take a small amount of cell fluid, dilute it 50 times with PBS, and then count the cells under a microscope. Take 2×10 6 Place the cells in a new 1.5 mL centrifuge tube, dilute to 1 mL with ice-cold PBS, centrifuge at 2000 rpm for 5 min at 4°C, discard part of the supernatant, and keep 100 μL of suspended cells. Take the tube with more cells as four controls, namely, an empty tube, a CD3 + 、CD4 + 、CD8 + (Antibodies were diluted with PBS according to the instructions), and 10 μL of each of the three antibodies was added to each tube of the remaining samples, and incubated at room temperature for 15 minutes in the dark. After incubation, the cells were washed twice with PBS, centrifuged at 4°C 2000 rpm for 5 minutes, and 200-300 μL was retained for the last time, and the cells were resuspended, poured into the flow tube, and analyzed on the machine.

[0102] The test results are as follows Figure 4 , Figure 5 As shown. L946 fusion protein immunization group induced CD3 + CD4 + The differentiation level of L946-immunized group was significantly higher than that of the single protein immunization group and the P46+P97R1 combined immunization group (P<0.01). + CD4 + The differentiation level was 1.38 times that of the group immunized with Boehringer commercial vaccine, and the difference was extremely significant (P < 0.001). + CD8 + The differentiation level was significantly higher than that of the single protein immunization group (P<0.001), and lower than that of the P46+P97R1 combined immunization group. + CD8 + The differentiation level was 1.14 times that of the group immunized with Boehringer commercial vaccine, and the difference was significant (P<0.05).

[0103] Considering the IFN-γ secretion level and lymphocyte differentiation level, the L946 vaccine immunization group induced a better level of cellular immunity.

[0104] Example 7: Detection of specific IgM antibodies in serum

[0105] IgM is mainly secreted and synthesized by plasma cells in the spleen and lymph nodes, and is distributed in the blood, body fluids and exocrine fluids. It has powerful bactericidal, complement activation, immune conditioning and agglutination effects, and plays a key role in resisting early infections. As the infection time goes by, its antibody level gradually decreases. The specific IgM antibody level in the serum is detected by the ELISA method. The specific operation method is as follows:

[0106] (1) Dilute the ultrasonically disrupted Mhp whole bacterial protein with ELISA coating solution to a final concentration of 4 μg / mL, add 100 μL to each well, seal with plastic wrap, and incubate at 4°C overnight;

[0107] (2) Discard the solution, wash 5 times with PBST, 3 min / time, 300 μL per well, pat dry after the last wash. Add 200 μL of blocking solution (PBS solution containing 5% skim milk) to each well, and block at 37°C for 1 h;

[0108] (3) After washing, pat dry, dilute the mouse serum to be tested with PBS at a ratio of 1:800, 100 μL per well, and incubate at 37°C for 1 h;

[0109] (4) After washing, pat dry, dilute HRP-labeled goat anti-mouse IgM antibody with PBS at a ratio of 1:5000, 100 μL per well, and incubate at 37°C for 1 h;

[0110] (5) After washing, pat dry and add soluble TMB single component (HRP substrate), 100 μL per well, and develop color at 37°C in the dark for 15-20 min;

[0111] (6) 100 μL stop solution was added to each well, and the microplate reader was shaken at low speed for 5 seconds, and the OD was measured. 450nm .

[0112] The test results are as follows Figure 6 The level of early IgM induced by the L946 fusion protein immunization group was higher than that of the Boehringer commercial vaccine immunization group, higher than that of the P46+P97R1 combined immunization group, and slightly lower than that of the 418 protein immunization group.

[0113] Example 8: Detection of specific IgG antibodies in serum

[0114] IgG antibodies play a role in activating complement and neutralizing a variety of toxins in immune response. The level of specific IgG antibodies in serum is detected by ELISA method. The specific operation method is as follows:

[0115] (1) Dilute the Mhp whole bacterial protein with coating solution to a final concentration of 4 μg / mL, add 100 μL to each well, seal the well with plastic wrap, and incubate at 4°C overnight;

[0116] (2) Discard the solution and wash 5 times with PBST, 3 min / time, 300 μL per well, and pat dry for the last wash. Prepare 5% (W / V) skim milk blocking solution with PBS, block 200 μL per well, and incubate at 37°C for 1 h;

[0117] (3) After washing, pat dry, dilute the mouse serum to be tested with PBS at a ratio of 1:800, and incubate 100 μL per well at 37°C for 1 h;

[0118] (4) After washing, pat dry, dilute HRP-labeled goat anti-mouse IgG antibody with PBS at a ratio of 1:5000, 100 μL per well, and incubate at 37°C for 1 h;

[0119] (5) After washing, pat dry and add soluble TMB single component (HRP substrate), 100 μL per well, and develop color at 37°C in the dark for 15-20 min;

[0120] (6) 100 μL stop solution was added to each well, and the microplate reader was shaken at medium speed for 5 seconds, and the OD was measured. 450nm .

[0121] The test results are as follows Figure 7 The IgG level induced by the L946 fusion protein immunization group was higher than that of the single protein immunization group and the P46+P97R1 combined immunization group, but lower than that of the Boehringer commercial vaccine immunization group.

[0122] summary:

[0123] From the perspective of humoral immunity, the level of early IgM induced by the L946 fusion protein immunization group was higher than that of the Boehringer commercial vaccine immunization group, and the level of IgG induced by the L946 fusion protein immunization group was lower than that of the Boehringer commercial vaccine immunization group, but significantly higher than that of the single protein immunization group. Overall, the level of humoral immunity induced by the L946 vaccine immunization group was comparable to that of the Boehringer commercial vaccine immunization group.

[0124] From the perspective of cellular immunity, the IFN-γ secretion level induced by the L946 vaccine group was 2.73 times that of the Boehringer commercial vaccine group, and the difference was extremely significant (P < 0.001). + CD4 + The differentiation level was 1.38 times that of the group immunized with Boehringer commercial vaccine, and the difference was extremely significant (P < 0.001). + CD8+ The differentiation level was 1.14 times that of the Boehringer commercial vaccine immunization group, with a significant difference (P < 0.05). Overall, the cellular immunity level induced by the L946 vaccine was significantly better.

Claims

1. A fusion protein, characterized in that The fusion protein comprises, from N-terminus to C-terminus, heat-labile enterotoxin LTB of Escherichia coli, antigen protein P97R1 of Mycoplasma hyopneumoniae, lipoprotein 418 of Mycoplasma hyopneumoniae and surface antigen protein P46 of Mycoplasma hyopneumoniae.

2. The fusion protein according to claim 1, characterized in that The amino acid sequence of the Escherichia coli heat-labile enterotoxin LTB is shown in SEQ ID NO.1, the amino acid sequence of the Mycoplasma hyopneumoniae antigen protein P97R1 is shown in SEQ ID NO.3, the amino acid sequence of the Mycoplasma hyopneumoniae lipoprotein 418 is shown in SEQ ID NO.5, and the amino acid sequence of the Mycoplasma hyopneumoniae surface antigen protein P46 is shown in SEQ ID NO.

7.

3. The fusion protein according to claim 1, characterized in that The fusion protein is formed by connecting Escherichia coli heat-labile enterotoxin LTB, Mycoplasma hyopneumoniae antigen protein P97R1, Mycoplasma hyopneumoniae lipoprotein 418 and Mycoplasma hyopneumoniae surface antigen protein P46 in series using a connecting peptide, and the Mycoplasma hyopneumoniae surface antigen protein P46 is P46 with a signal peptide removed.

4. The fusion protein according to any one of claims 1 to 3, characterized in that The amino acid sequence of the fusion protein is shown in SEQ ID NO.

9.

5. A DNA molecule encoding the fusion protein of claim 1.

6. The DNA molecule according to claim 5, characterized in that The nucleotide sequence of the DNA molecule is shown as SEQ ID NO.

10.

7. A method for preparing the fusion protein according to any one of claims 1 to 3, characterized in that: The method comprises the steps of sequentially constructing a cloning vector and an expression vector of the fusion protein through genetic engineering technology, transforming the expression vector, and then expressing, purifying and identifying the fusion protein.

8. A porcine mycoplasma pneumonia vaccine composition, characterized in that: The vaccine composition comprises the fusion protein according to any one of claims 1 to 3 and a veterinarily acceptable adjuvant.

9. The porcine mycoplasma pneumonia vaccine composition according to claim 8, characterized in that: The adjuvant is Gel02PR adjuvant.

10. Use of the fusion protein according to any one of claims 1 to 3 in the preparation of vaccines or drugs for preventing and / or treating diseases related to Mycoplasma hyopneumoniae.

Images