CRISPR (clustered regularly interspaced short palindromic repeats) / Cas-based kit for isothermal rapid visual detection of tomato mosaic virus and detection method of CRISPR / Cas-based kit

Abstract

The invention discloses a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas-based kit for isothermal rapid visual detection of tomato mosaic virus and a detection method of the CRISPR / Cas-based kit. The invention belongs to the technical field of plant quarantine, and particularly relates to a CRISPR / Cas-based kit for isothermal rapid visual detection of tomato mosaic virus and a detection method thereof. The composition for identifying the tomato mosaic virus comprises crRNA specific to nucleic acid to be detected, an RT-RPA primer pair, Cas12 protein and a fluorescent reporter probe, the RT-RPA primer pair is composed of a primer ToMV-F and a primer ToMV-R, and the fluorescent reporter probe is a single-chain RNA with one end connected with a fluorophore and the other end connected with a quenching group. According to the present invention, the rapid, accurate and visual detection of the to-be-detected sample can be achieved, the advantages of good specificity, high sensitivity, convenient operation, high detection efficiency and the like are provided, and the basic requirements of field and port detection can be met.

Description

Technical Field

[0001] The invention belongs to the technical field of plant quarantine, and particularly relates to a kit for isothermal rapid visual detection of tomato mosaic virus based on CRISPR / Cas and a detection method thereof. Background Art

[0002] Tomato mosaic virus (ToMV) is a positive-sense single-stranded RNA virus belonging to the genus Tobamovirus of the family Virgaviridae. It mainly harms tomatoes (Lycopersiconesculentum) and peppers, and most Solanaceae plants are susceptible to the disease. The main symptoms of leaves infected by ToMV are light green or dark green mosaic, mottled, and sometimes deformed young leaves; tendril symptoms are prone to appear when the temperature is below 20℃ in winter, and the plants become dwarfed; mottled symptoms also appear on some fruits; diseased plants form long necrotic streaks on the stems or petioles, causing necrosis of stems, leaves or fruits.

[0003] ToMV is widely distributed throughout the world and can be spread through mechanical inoculation, grafting, and contact between plants. It can also be transmitted through seeds. The seed transmission rate of tomatoes can reach 94%, and the virus exists in the external mucus and seed coat of the seeds. Sometimes there are viruses in the endosperm, but no viruses are found in the embryo. Seedlings are easily infected with the virus when transplanted. The virus's infectious activity can be maintained for at least 9 years in seeds with virus-infected endosperm.

[0004] Recombinase polymerase amplification (RPA) is a technology for isothermal amplification of target genes with recombinase and polymerase as core components and single-stranded binding proteins as auxiliary components. It can rapidly amplify target fragments in a short time (30 minutes) under constant temperature (37-42°C), and then separate the target bands for detection by conventional gel electrophoresis. It can also be combined with lateral flow chromatography strips and fluorescent probes for detection. The CRISPR / Cas system consists of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated proteins (Cas), which can recognize and cut specific nucleic acid sequences, thereby further increasing specificity and sensitivity on the basis of RPA. The CRISPR / Cas system has now been developed into a rapid, portable, low-cost, and highly sensitive molecular detection tool, which has made a major breakthrough in virus detection. Since the optimum temperature for Cas to exert its nuclease function is close to the reaction temperature of RPA, the two can be used together, that is, RPA is responsible for isothermal amplification of the target sequence to increase the copy number of the target sequence, and Cas is responsible for specific identification of the target sequence and relies on fluorescent reporter probes to visualize the detection results. The combination of RPA and CRISPR / Cas system can obtain a detection technology with higher sensitivity and specificity than the single RPA technology. With the richness of fluorescent reporter molecule modifications in the CRISPR / Cas system, it can achieve rapid, accurate and visual detection of the target.

[0005] There have been some studies on isothermal amplification technology in the field of pathogen detection, which can improve detection efficiency. Among them, RPA technology is a relatively simple isothermal amplification technology that is easy to combine with other sensor systems to achieve rapid, isothermal, and visual detection. There are no reports on CRISPR / Cas-based isothermal rapid visual detection technology for tomato mosaic virus, let alone CRISPR / Cas-based isothermal rapid visual detection kits for tomato mosaic virus. Summary of the invention

[0006] The technical problem to be solved by the present invention is how to simply and quickly identify whether tomato mosaic virus exists in tomato mosaic virus or plant samples.

[0007] In order to solve the above technical problems, the present invention provides a composition for identifying tomato mosaic virus.

[0008] The composition for identifying tomato mosaic virus provided by the present invention comprises crRNA specific to a nucleic acid to be detected, an RT-RPA primer pair, a Cas12 protein and a fluorescent reporter probe, wherein the RT-RPA primer pair consists of a primer ToMV-F and a primer ToMV-R, and the fluorescent reporter probe is a single-stranded RNA having a fluorescent group connected to one end and a quenching group connected to the other end;

[0009] The primer ToMV-F is as follows (b1) or (b2):

[0010] (b1) a single-stranded DNA molecule represented by Sequence 1 in the Sequence Listing;

[0011] (b2) a DNA molecule in which sequence 1 is subjected to nucleotide substitution and / or deletion and / or addition and has the same function as sequence 1;

[0012] The primer ToMV-R is as follows (b3) or (b4):

[0013] (b3) a single-stranded DNA molecule represented by Sequence 2 of the Sequence Listing;

[0014] (b4) a DNA molecule in which sequence 2 is subjected to nucleotide substitution and / or deletion and / or addition and has the same function as sequence 2;

[0015] The crRNA of the nucleic acid to be detected is as follows (b5) or (b6):

[0016] (b5) a single-stranded DNA molecule represented by Sequence 3 of the Sequence Listing;

[0017] (b6) a DNA molecule in which sequence 3 is subjected to nucleotide substitution and / or deletion and / or addition and has the same function as sequence 3;

[0018] The nucleotide sequence of the single-stranded RNA of the fluorescent reporter probe is sequence 4 in the sequence table.

[0019] In the above composition, the composition also includes a reagent for nucleic acid amplification.

[0020] In the above composition, the nucleic acid amplification is reverse transcriptase recombinase polymerase amplification technology (abbreviated as RT-RPA / RAA isothermal amplification).

[0021] The present invention also provides a kit for identifying tomato mosaic virus, wherein the kit contains the composition described above.

[0022] The Cas12 protein may be LbCas12a (Cpf1).

[0023] The molar ratio of the LbCas12a (Cpf1) to the crRNA is 1:5.

[0024] The final concentrations of the LbCas12a (Cpf1) and the crRNA are 200 nM and 1000 nM, respectively.

[0025] The fluorescent reporter probe may be FQ, and the final concentration of the FQ is 400 nM.

[0026] The present invention also provides the use of the above-mentioned composition in any of the following:

[0027] a1) Preparation of products for identification or differentiation of tomato mosaic virus;

[0028] a2) Identification or differentiation of tomato mosaic virus;

[0029] a3) preparing a product for detecting whether a sample to be tested contains tomato mosaic virus;

[0030] a4) Detecting whether the sample to be tested contains tomato mosaic virus.

[0031] The present invention also provides the use of the above-mentioned kit in any of the following:

[0032] b1) Preparation of products for identification or differentiation of tomato mosaic virus;

[0033] b2) Identification or differentiation of tomato mosaic virus;

[0034] b3) preparing a product for detecting whether a sample to be tested contains tomato mosaic virus;

[0035] b4) Detecting whether the sample to be tested contains tomato mosaic virus.

[0036] The preparation method of the kit comprises the following steps (I) or (II):

[0037] (I) packaging each primer or probe in the composition described above separately;

[0038] (II) The primers or probes in the composition described above are mixed together in appropriate proportions.

[0039] The present invention also provides the use of the above-mentioned composition and kit in a device for environmental pollution monitoring, food safety testing or disease diagnosis.

[0040] The present invention provides a method for detecting tomato mosaic virus, comprising using the above-mentioned composition to detect whether a sample to be tested contains tomato mosaic virus nucleic acid.

[0041] The present invention provides a method for identifying or assisting in identifying whether a pathogen sample to be tested is tomato mosaic virus, comprising the following steps:

[0042] Extract the nucleic acid of the pathogen sample to be tested; use the nucleic acid as a template, use the primers ToMV-F and ToMV-R in the above-mentioned composition to perform RT-RPA / RAA amplification to obtain RT-RPA / RAA amplification products, and then use the crRNA probe, Cas12 protein and fluorescent reporter probe in the above-mentioned composition to perform color development reaction; the specific determination method is as follows:

[0043] If the product of the color development reaction emits green fluorescence under blue light, the pathogen sample to be tested contains at least tomato mosaic virus;

[0044] If the product of the color development reaction does not emit green fluorescence under blue light, the pathogen sample to be detected is not tomato mosaic virus.

[0045] The present invention provides a method for identifying or assisting in identifying whether a sample to be tested is infected with tomato mosaic virus, comprising the following steps:

[0046] Extract the nucleic acid of the sample to be tested; use the nucleic acid as a template, use the primers ToMV-F and ToMV-R in the composition described above to perform RT-RPA / RAA amplification to obtain RT-RPA / RAA amplification products, and then use the crRNA probe, Cas12 protein and fluorescent reporter probe in the composition described above to perform color development reaction; the specific determination method is as follows:

[0047] If the product of the color development reaction emits green fluorescence under blue light, the sample to be tested contains tomato mosaic virus;

[0048] If the product of the color development reaction does not emit green under blue light, the sample to be tested does not contain tomato mosaic virus.

[0049] The reaction system of the color development reaction can be as follows: 2 μL RT-RPA / RAA amplification product, 2 μL 10×NEBuffer3.1, 0.5 μL 40U / μL RNAse inhibitor, 0.5 μL 0.1mmol / L DTT, 2 μL 10 μmol / L ToMV-crRNA, 0.8 μL 5 μmol / L LbCas12a (Cpf1), 0.8 μL 10 μmol / L fluorescent reporter molecule FQ, 0.8 μL ddH 2 O 11.4 μL. The reaction conditions of the color development reaction may be as follows: 37° C. for 15 minutes.

[0050] In a specific embodiment, in the aforementioned method, the reaction system of the RT-RPA / RAA amplification is calculated as follows in 50 μL:

[0051]

[0052] The reaction conditions of the RT-RPA / RAA amplification are: 42° C. for 15 minutes.

[0053] The RT-RPA primer pair or the crRNA probe and fluorescent reporter probe described above also fall within the scope of protection of the present invention.

[0054] The present invention also provides the use of the RT-RPA primer pair or the crRNA probe and the fluorescent reporter probe described above in any of the following:

[0055] c1) Use of the RT-RPA primer pair or the crRNA probe and fluorescent reporter probe described above in the preparation of a product for detecting tomato mosaic virus;

[0056] c2) Use of the aforementioned RT-RPA primer pair or the aforementioned crRNA probe and fluorescent reporter probe in identifying tomato mosaic virus;

[0057] c3) Use of the RT-RPA primer pair or the crRNA probe and fluorescent reporter probe described above in identifying whether the virus to be tested is tomato mosaic virus.

[0058] The present invention provides a rapid constant temperature visualization detection method for nucleic acid of tomato mosaic virus based on reverse transcriptase recombinase polymerase amplification technology and CRISPR / Cas sensing technology. The method uses the total RNA of the sample as a template, performs reverse transcriptase recombinase polymerase amplification and CRISPR / Cas color development reaction, and determines the result under blue light (440-460nm) after the reaction. The present invention can achieve rapid, accurate and visualized detection of the target, has the advantages of good specificity, high sensitivity, easy operation, high detection efficiency, etc., and can meet the basic needs of field and port detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 The effect of different concentrations of fluorescent reporter molecule FQ on the results of rapid constant temperature visual detection of tomato mosaic virus. The final concentrations of FQ were 100, 200, 300, 400, 600, and 800 nM, respectively. NC: negative control. 2 O replaces the template.

[0060] Figure 2 The effects of different Cas12a / crRNA concentration ratios on the results of rapid constant temperature visual detection of tomato mosaic virus were shown in Figure 2. The Cas12a / crRNA concentration ratios were 2:1, 1:1, 1:2, 1:5, and 1:10, respectively, where NC was negative control and ddH 2 O replaces the template.

[0061] Figure 3 When the concentration ratio of Cas12a / crRNA is 1:5, the effects of different final concentrations of Cas12a / crRNA on the results of rapid constant temperature visual detection of tomato mosaic virus are shown in Figure 5. The final concentrations of Cas12a / crRNA are 12.5nM / 62.5nM, 25nM / 125nM, 50nM / 250nM, 100nM / 500nM, 200nM / 1000nM, and 400nM / 2000nM, respectively. NC: negative control, with ddH 2 O replaces the template.

[0062] Figure 4 The results are the specificity test results of the rapid constant temperature visualization detection technology of tomato mosaic virus. The interfering viruses are Arabis mosaic virus (ArMV), cucumber mosaic virus (CMV), pepper mild mottle virus (PMMoV), tomato brown rugose fruit virus (ToBRFV), tomato mottlemosaic virus (ToMMV), tomato ringspot virus (ToRSV), tobacco ring spot virus (TRSV), tobacco mosaic virus (TMV), and tomato spotted wilt virus (TSWV). NC: negative control, ddH 2 O replaces the template.

[0063] Figure 5 These are the sensitivity test results of the rapid constant temperature visualization detection technology for tomato mosaic virus, among which, tube 1: ToMV positive sample RNA concentration is 17.2 ng / μL; tube 2: ToMV positive sample RNA concentration is 1.72 ng / μL; tube 3: ToMV positive sample RNA concentration is 172 pg / μL; tube 4: ToMV positive sample RNA concentration is 17.2 pg / μL; tube 5: ToMV positive sample RNA concentration is 1.72 pg / μL; tube 6: ToMV positive sample RNA concentration is 172 fg / μL; tube 7: ToMV positive sample RNA concentration is 17.2 fg / μL; tube 8: ToMV positive sample RNA concentration is 1.72 fg / μL; tube 9: ToMV positive sample RNA concentration is 172 ag / μL; tube 10: ToMV positive sample RNA concentration is 17.2 ag / μL; NC: negative control, with ddH2 O replaces the template.

[0064] Figure 6 These are the results of the sensitivity test of the tomato mosaic virus RT-PCR system, where M: trans2k plus marker; Lane 1: RT-PCR product obtained when the RNA concentration of the ToMV-positive sample was 17.2 ng / μL; Lane 2: RT-PCR product obtained when the RNA concentration of the ToMV-positive sample was 1.72 ng / μL; Lane 3: RT-PCR product obtained when the RNA concentration of the ToMV-positive sample was 172 pg / μL; Lane 4: RT-PCR product obtained when the RNA concentration of the ToMV-positive sample was 17.2 pg / μL; Lane 5: RT-PCR product obtained when the RNA concentration of the ToMV-positive sample was 1.72 pg / μL; Lane 6: RT-PCR product obtained when the RNA concentration of ToMV positive sample was 172fg / μL; Lane 7: RT-PCR product obtained when the RNA concentration of ToMV positive sample was 17.2fg / μL; Lane 8: RT-PCR product obtained when the RNA concentration of ToMV positive sample was 1.72fg / μL; Lane 9: RT-PCR product obtained when the RNA concentration of ToMV positive sample was 172ag / μL; Lane 10: RT-PCR product obtained when the RNA concentration of ToMV positive sample was 17.2ag / μL; NC: negative control, ddH 2 O replaces the template.

[0065] Figure 7 These are the test results of field samples using the rapid constant temperature visualization detection technology for tomato mosaic virus. Numbers 1-10 are the test results of 10 tomato, pepper and soil samples. NC: negative control, P: positive control. DETAILED DESCRIPTION

[0066] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0067] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0068] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0069] The DNA extraction phenol reagent in the following examples is a DNA extraction reagent, which is a mixture of Tris-saturated phenol, chloroform and isoamyl alcohol in a volume ratio of 25:24:1, purchased from Beijing Solebow Technology Co., Ltd. (T0250); 1×NEBuffer 3.1 contains 50mM NaCl, 10mM Tris-HCl, 10mM MgCl 2 , 100 μg / ml BSA, pH 7.9, purchased from New England Biolabs, Inc. (B6002V), RNAse inhibitor is an RNase inhibitor purchased from Promega (Beijing) Biotechnology Co., Ltd. (N2615), and LbCas12a (Cpf1) is a recombinant CRISPR-Cas12a protein (Lb), purchased from Shanghai Huicheng Biotechnology Co., Ltd. (E-002).

[0070] The tomato mosaic virus (ToMV) in the following examples has been recorded in: Zhang Yongjiang, Ma Rongqun, Xin Yanyan, et al. Establishment of barcode identification method for tobacco mosaic virus [J]. Hubei Agricultural Science, 2015, 54(11): 2624-2627; Arabis mosaic virus (ArMV) has been recorded in: Zhao Xiaoli, Yang Shujiang, Chen Hongyun, et al. Detection of Arabis mosaic virus by droplet digital RT-PCR [J]. Plant Quarantine, 2021; Pepper mild mottle virus (PMMoV) has been recorded in: Zhang Yongjiang, Li Guifen, Ma Jie, et al. Detection of pepper mild mottle virus in pepper seeds [J]. Anhui Agricultural Science, 2007, 35(14): 4228-4229; Tomato ringspot virus (PMMoV) has been recorded in: Zhang Yongjiang, Li Guifen, Ma Jie, et al. Detection of pepper mild mottle virus in pepper seeds [J]. Anhui Agricultural Science, 2007, 35(14): 4228-4229; Tobacco ring spot virus (TRSV) has been recorded in: Cao Cheng, Wei Meisheng, Zhang Yongjiang, et al. Rapid detection of tomato ring spot virus and tobacco ring spot virus RT-PCR amplicons by double colloidal gold chromatography [J]. Chinese Agricultural Science Bulletin, 2011, 27(22):5; Tobacco ring spot virus (TRSV) has been recorded in: Wei Meisheng, Li Guifen, Ma Jie, et al. Development of magnetic immunochromatographic test strips for tobacco ring spot virus [J]. Plant Quarantine, 2014, 28(2):4; Tobacco mosaic virus (TMV) has been recorded in: Zhang Yongjiang, Ma Rongqun, Xin Yanyan, et al. Establishment of barcode identification method for tobacco mosaic virus [J]. Hubei Agricultural Science, 2015, 54(11):2624-2627; Tomato brown rugose fruit virus (ToBRFV), tomato mottle mosaic virus (TMV) virus (ToMMV), cucumber mosaic virus (CMV), and tomato spotted wilt virus (TSWV). The public can obtain the biological material from the applicant. The biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0071] Example 1. Design and synthesis of primers and probes

[0072] RT-PPA primers were screened and designed for the reference sequence ToMV (219 bp, GenBank: MG456601.1), aiming to make the selected primers applicable to tomato mosaic virus, specifically amplify the target fragment, the target sequence of which is sequence 5 in the sequence table, and each target fragment can clearly emit green fluorescence in the color development reaction. The specific designed primer sequences are as follows:

[0073] Primer pairs for specific RT-RPA amplification of tomato mosaic virus (ToMV):

[0074] ToMV-F: 5'-CTTACTCAATCACTTCTCCATCGCAATTTGTG-3' (sequence 1)

[0075] ToMV-R: 5'-CATTGTACCTGTACACCTTATAAACATCGCC-3' (SEQ ID NO: 2)

[0076] CRISPR / Cas12a crRNA probe for tomato mosaic virus (ToMV) RT-RPA amplification products:

[0077] ToMV-crRNA1:

[0078] 5'-UAAUUUCUACUAAGUGUAGAUAAACACAGCAAGCAAGAACUACU-3' (SEQ ID NO: 3)

[0079] Fluorescent reporter FQ:

[0080] FQ: 5'-FAM-CCGGAAAAAAAAAAAACCGG-BHQ1-3' (sequence 4)

[0081] BHQ1 is a quenching group and FAM is a fluorescent group. The above primers and probes were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0082] The target sequence is: 5'-CTTACTCAATCACTTCTCCATCGCAATTTGTGTTTTTGTCATCTGTATG GGCTGACCCTATAGAATTGTTAAACGTTTGTACAAATTCGTTAGGTAACCAGTTTCAAACACAGCAAGCAAGAA CTACTGTTCAACAGCAGTTCAGCGAGGTGTGGAAACCTTTCCCTCAGAGCACCGTCAGATTTCCTGGCGATGTTTATAAGGTGTACAGGTACAATG-3' (sequence 5)

[0083] Example 2: Establishment of an isothermal rapid visualization detection system for tomato mosaic virus based on CRISPR / Cas

[0084] 1. Establishment of RT-RPA amplification system

[0085] The RT-RPA amplification system with a total system of 50 μL was established using the RNA of the sample to be tested as the template. 29.4 μL Abuffer was added to the dry powder tube to fully dissolve, and 2 μL RNA template, 2.5 μL B buffer, 2 μL 10 μmol / L ToMV-F, 2 μL 10 μmol / L ToMV-R, and ddH 2 O 12.1μL, mix well and react at 42℃ for 15 minutes.

[0086] A buffer is a hydration buffer, B buffer is magnesium acetate, and the dry powder is recombinant enzyme, polymerase, and buffer salt lyophilized powder, all of which are included in the RNA Constant Temperature Rapid Amplification Kit (Basic Type)-II (WLRB8207KIT).

[0087] 2. Establishment of color reaction system

[0088] Take the RT-RPA reaction product, add DNA extraction phenol reagent, mix the extraction reaction solution at 1:1, centrifuge at 12000rpm for 5min, take 2μL of the supernatant, and obtain the RT-RPA / RAA amplification product for color reaction.

[0089] Add 2 μL RT-RPA / RAA amplification product, 2 μL 10×NEBuffer 3.1, 0.5 μL 40U / μL RNAseinhibitor, 0.5 μL 0.1mmol / L DTT, 2 μL 5 μmol / L ToMV-crRNA, 0.8 μL 10 μmol / L LbCas12a (Cpf1), 0.8 μL 5 μmol / L fluorescent reporter molecule FQ, and ddH on ice. 2O 11.4 μL and mix thoroughly.

[0090] The color reaction conditions are: after mixing evenly, react at a constant temperature of 37°C for 15 minutes.

[0091] 3. Optimization of reaction conditions of color development system

[0092] 1) Optimization of the final concentration of the fluorescent reporter molecule FQ in the color reaction system

[0093] According to step 2 above, the final concentrations of the fluorescent reporter molecule FQ were set to 100, 200, 300, 400, 600, and 800 nM, respectively, and other experimental conditions remained unchanged to optimize the final concentration of the fluorescent reporter molecule.

[0094] The test results are as follows Figure 1 As shown, from Figure 1 It can be seen that when the final concentration of FQ reaches 400nM, the green fluorescence intensity in the centrifuge tube reaches the brightest. As the concentration continues to increase, the brightness no longer increases, and 400nM is finally selected.

[0095] 2) Optimization of Cas12a / crRNA concentration ratio in the color reaction system

[0096] According to the above step 2, the Cas12a / crRNA concentration ratio was set to 2:1, 1:1, 1:2, 1:5, and 1:10, respectively, and other experimental conditions remained unchanged to optimize the Cas12a / crRNA concentration ratio.

[0097] The test results are as follows Figure 2 As shown in the results, when the Cas12a / crRNA concentration ratio was 1:5, the green fluorescence intensity in the centrifuge tube reached the brightest, and the final Cas12a / crRNA concentration ratio was 1:5.

[0098] 3) Optimization of Cas12a / crRNA concentration in the color reaction system

[0099] After determining the Cas12a / crRNA concentration ratio, the Cas12a / crRNA concentration ratios were set to 12.5nM / 62.5nM, 25nM / 125nM, 50nM / 250nM, 100nM / 500nM, 200nM / 1000nM, and 400nM / 2000nM, respectively, and other experimental conditions remained unchanged to optimize the Cas12a / crRNA concentration.

[0100] The test results are as follows Figure 3 As shown, when the added concentration of Cas12a / crRNA was 200nM / 1000nM, the green fluorescence intensity in the centrifuge tube reached the brightest, and the final added concentration of Cas12a / crRNA was 200nM / 1000nM.

[0101] Combined with the above optimization experiments, the final color development system was determined as follows: 2 μL RT-RPA / RAA amplification product, 2 μL 10×NEBuffer 3.1, 40 U / μL RNAse inhibitor 0.5 μL, 0.1 mmol / L DTT 0.5 μL, 10 μmol / L ToMV-crRNA 2 μL, 5 μmol / L LbCas12a (Cpf1) 0.8 μL, 10 μmol / L fluorescent reporter molecule FQ 0.8 μL, ddH 2 O 11.4 μL.

[0102] 4. Detection and result determination

[0103] The reaction products of the color development system according to step 3 were mixed on ice, transferred to a 37°C environment for incubation for 15 minutes, and then observed under blue light (440-460nm). If the reaction centrifuge tube emits green fluorescence, the pathogen to be tested is tomato mosaic virus; if the reaction centrifuge tube does not emit green fluorescence, the pathogen to be tested is not tomato mosaic virus. 2 O replaced the RNA template in the reaction system (abbreviated as NC) as a negative control.

[0104] When the primer-probe combination obtained under the above conditions is used to detect plant samples, the plant samples can be sampled and total RNA can be extracted according to the following method.

[0105] Sampling method: In order to make the established CRISPR / Cas-based isothermal rapid visualization technology more widely applicable, according to the distribution characteristics of viruses and bacteria in melon plants, seeds, leaves, stems, flowers, fruits and roots can be used as sampling sites. All sampling sites can be directly ground to extract plant total RNA. Environmental samples such as soil can also be sampled and tested.

[0106] Method for extracting total RNA: RNAprep Pure Plant Total RNA Extraction Kit was used to extract plant total RNA according to the instructions.

[0107] Example 3: Specificity verification of the isothermal rapid visual detection system for tomato mosaic virus based on CRISPR / Cas

[0108] The commonly found viruses on peppers and tomatoes, including arabis mosaic virus (ArMV), tomato mosaic virus (ToMV), cucumber mosaic virus (CMV), pepper mild mottle virus (PMMoV), tomato brown rugosefruit virus (ToBRFV), tomato mottle mosaic virus (ToMMV), tomato ringspot virus (ToRSV), tobacco ring spot virus (TRSV), tobacco mosaic virus (TMV) and tomato spotted wilt virus (TSWV), were used as test samples. All the above viruses were detected, isolated and preserved by China Institute of Inspection and Quarantine.

[0109] The total RNA of the above virus was extracted as a template, and the CRISPR / Cas-based isothermal rapid visualization detection system established in Example 2 (2 μL RT-RPA / RAA amplification product, 2 μL 10×NEBuffer 3.1

[0110] 、40U / μL RNAse inhibitor 0.5μL、0.1mmol / L DTT 0.5μL、0.5μmol / L ToMV-crRNA 2μL、0.25μmol / L LbCas12a (Cpf1) 0.8μL、0.5μmol / L fluorescent reporter molecule FQ 0.8μL、ddH 2 O 11.4μL. ) to amplify it to verify whether the CRISPR / Cas-based isothermal rapid visualization detection system would be interfered with by other viruses. 2 O replaced the RNA template in the reaction system (abbreviated as NC) as a negative control.

[0111] The results are as follows Figure 4 As shown, only the centrifuge tube containing ToMV has obvious green fluorescence, while the other centrifuge tubes have no fluorescence, indicating that the established CRISPR / Cas-based isothermal rapid visualization detection system is not interfered by other viruses.

[0112] Example 4: Sensitivity test of the isothermal rapid visual detection system of tomato mosaic virus based on CRISPR / Cas

[0113] The ToMV positive sample RNA in Example 2 was used as a template, and total RNA was extracted according to the method of Example 2. The extracted total RNA was diluted in a ten-fold concentration gradient, and then 2 μL of the template was taken from each diluted sample for isothermal rapid visualization detection based on CRISPR / Cas to determine the detection sensitivity. 2 O replaced the RNA template in the reaction system (abbreviated as NC) as a negative control.

[0114] The conventional RT-PCR detection method is as follows:

[0115] Primer pairs for specific RT-PCR amplification of tomato mosaic virus (ToMV):

[0116] ToMV-PCR-F: 5'-CGAGAGGGGCAACAAACAT-3' (sequence 6)

[0117] ToMV-PCR-R: 5'-ACCTGTCTCCATCTCTTTGG-3' (SEQ ID NO: 7)

[0118] System reference full gold II One-Step RT-PCR SuperMix Kit was used to prepare a 20 μL total reaction system, including 4 μL of the ToMV positive sample RNA in Example 2, 0.4 μL each of ToMV-PCR-F and ToMV-PCR-R (10 μmol / L), II One-Step Enzyme Mix 0.4μL, 2×TS II One-StepReaction Mix 10μL, ddH 2 O 4.8 μL. Reaction conditions: 45°C for 30 min; 94°C for 5 min; 94°C for 30 s, 58°C for 30 s, 72°C for 40 s, 35 cycles; 72°C for 10 min.

[0119] The results are as follows Figure 5 and Figure 6 As shown, the sensitivity of the CRISPR / Cas-based isothermal rapid visual detection was 172 ag / μL, while the sensitivity of conventional RT-PCR detection was 1.72 pg / μL. The sensitivity of the CRISPR / Cas-based isothermal rapid visual detection established in Example 2 was 10,000 times that of conventional PCR detection.

[0120] Example 5: Application of the CRISPR / Cas-based isothermal rapid visualization detection method for tomato mosaic virus

[0121] The seeds or leaves of tomatoes and peppers and soil samples sent for inspection in various regions were used as materials, as shown in Table 1. Total RNA was extracted as a template to verify the feasibility of the CRISPR / Cas-based isothermal rapid visualization detection technology established in the present invention. 2 O (NC) was used as a negative control, and the ToMV-positive sample (P) was used as a positive control.

[0122] Table 1 Test samples

[0123]

[0124] Test results such as Figure 7 As shown, the detection technology established by the present invention can detect the target virus in tomato, pepper and soil samples from different regions, indicating that the application of the present invention is universal.

[0125] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A composition for identifying tomato mosaic virus, the composition comprising crRNA specific to the nucleic acid to be detected, an RT-RPA primer pair, a Cas12 protein and a fluorescent reporter probe, the RT-RPA primer pair consisting of a primer ToMV-F and a primer ToMV-R, the fluorescent reporter probe is a single-stranded RNA having a fluorescent group at one end and a quenching group at the other end; the primer ToMV-F is as follows (b1) or (b2): (b1) a single-stranded DNA molecule represented by Sequence 1 in the Sequence Listing; (b2) a DNA molecule in which sequence 1 is subjected to nucleotide substitution and / or deletion and / or addition and has the same function as sequence 1; The primer ToMV-R is as follows (b3) or (b4): (b3) a single-stranded DNA molecule represented by Sequence 2 of the Sequence Listing; (b4) a DNA molecule in which sequence 2 is subjected to nucleotide substitution and / or deletion and / or addition and has the same function as sequence 2; The crRNA of the nucleic acid to be detected is as follows (b5) or (b6): (b5) a single-stranded DNA molecule represented by Sequence 3 of the Sequence Listing; (b6) a DNA molecule in which sequence 3 is subjected to nucleotide substitution and / or deletion and / or addition and has the same function as sequence 3; The nucleotide sequence of the single-stranded RNA of the fluorescent reporter probe is sequence 4 in the sequence table.

2. The composition according to claim 1, characterized in that: The composition also includes reagents for performing nucleic acid amplification.

3. The composition according to claim 2, characterized in that: The nucleic acid amplification is reverse transcriptase recombinase polymerase amplification.

4. A kit for identifying tomato mosaic virus, characterized in that: The kit contains the composition according to any one of claims 1 to 3.

5. Use of the composition according to any one of claims 1 to 3 in any of the following: a1) Preparation of products for identification or differentiation of tomato mosaic virus; a2) Identification or differentiation of tomato mosaic virus; a3) preparing a product for detecting whether a sample to be tested contains tomato mosaic virus; a4) Detecting whether the sample to be tested contains tomato mosaic virus.

6. Use of the kit according to claim 4 in any of the following: b1) preparing products for the identification or differentiation of tomato mosaic virus; b2) Identification or differentiation of tomato mosaic virus; b3) preparing a product for detecting whether a sample to be tested contains tomato mosaic virus; b4) Detecting whether the sample to be tested contains tomato mosaic virus.

7. Use of the composition according to any one of claims 1 to 3 or the kit according to claim 4 in a device for environmental pollution monitoring, food safety testing or disease diagnosis.

8. A method for detecting tomato mosaic virus, comprising using the composition according to any one of claims 1 to 3 to detect whether a sample to be tested contains tomato mosaic virus nucleic acid.

9. A method for identifying or assisting in identifying whether a pathogen sample to be tested is tomato mosaic virus, comprising the following steps: Extract the nucleic acid of the pathogen sample to be tested; use the nucleic acid as a template, use the composition of claim 1 to perform RT-RPA / RAA amplification, obtain RT-RPA / RAA amplification products, and then use the crRNA probe, Cas12 protein and fluorescent reporter probe described in any one of claims 1-3 to perform a color reaction; the specific determination method is as follows: If the product of the color development reaction emits green fluorescence under blue light, the pathogen sample to be tested contains at least tomato mosaic virus; if the product of the color development reaction does not emit green fluorescence under blue light, the pathogen sample to be tested does not contain tomato mosaic virus.

10. A method for identifying or assisting in identifying whether a sample to be tested is infected with tomato mosaic virus, comprising the following steps: Extract the nucleic acid of the sample to be tested; use the nucleic acid as a template, use the composition of claim 1 to perform RT-RPA / RAA amplification, obtain RT-RPA / RAA amplification products, and then use the crRNA probe, Cas12 protein and fluorescent reporter probe described in any one of claims 1-3 to perform a color development reaction; the specific determination method is as follows: If the product of the color development reaction emits green fluorescence under blue light, the sample to be tested contains tomato mosaic virus; if the product of the color development reaction does not emit green fluorescence under blue light, the sample to be tested does not contain tomato mosaic virus.

Images