Hypobasidium fungus strain MYYFH20 for promoting germination of Mengyuan flower seeds and application of hypobasidium fungus strain MYYFH20

Abstract

The invention relates to a ceratobasidium fungus strain MYYFH20 for promoting germination of Mengyuan flower seeds and application, and belongs to the field of microorganisms. The strain MYYFH20 is preserved in the China General Microbiological Culture Collection Center (CGMCC) on October 21, 2024, the preservation number is CGMCC No.41580, and the strain is classified and named as ceratobasidium. According to the method for promoting germination of the Mengyu seeds, a symbiotic relationship is established between the ceratobasidium fungus strains and the Mengyu seeds, so that germination of the Mengyu seeds is promoted. The strain provided by the invention can effectively promote germination of seeds of Mengyufeng to form protocorms and growth and development of the protocorms to form seedlings.

Description

Technical Field

[0001] The present application relates to the field of microorganisms, and in particular to a Ceratium fungus strain MYYFH20 for promoting the germination of Mengyuan Jade Phoenix seeds and its application. Background Art

[0002] The seeds of orchids are tiny, consisting of a seed coat and an undifferentiated proembryo. The seed coat is hard and hydrophobic, consisting of a single layer of lignified cells; the embryo is not fully developed and consists of only 80-300 cells, with almost no nutrient storage. Under natural conditions, the germination of seeds needs to rely on specific symbiotic fungi to obtain nutrients. If symbiotic fungi that effectively promote the germination of orchid seeds can be obtained, they can be used for orchid seedling breeding, endangered species protection, and even industrial planting. For example, in the Gastrodia elata cultivation industry, Gastrodia elata seeds and small mushrooms germinate symbiotically to form Gastrodia elata, which then symbiotically develops with Armillaria mellea to form Gastrodia elata tubers; the seeds of Trichosanthes kirilowii (Azalea orchid) and the white false cap can form medicinal pseudobulbs after one year of direct seeding in the wild. Symbiotic fungi are extremely important germplasm resources for orchid seedling breeding.

[0003] The symbiotic germination process is relatively simple: on the basis of obtaining effective fungi for germination of certain orchid seeds, symbiotic fungi are inoculated while sowing seeds in artificial substrates or in the wild, and fungal symbiosis is used to promote seed germination and form seedlings. The application of orchid seed symbiotic germination technology has great promotion value in the return of rare and endangered orchids, and can lay the foundation for the return of orchids and provide a new idea for industrial development.

[0004] Habenaria myriotricha is a terrestrial herb that grows in grasslands at an altitude of 400-800 meters. It is found in the limestone seasonal rain forest at an altitude of 1,000 meters in Mengla County, my country. It was first discovered in my country in 2012. Its flower shape is unique and has a high ornamental value, but its distribution is small, and its habitat conditions are easily affected by human activities. The population is very small (there are only two populations in China, with a total of no more than 40 individuals). It is urgent to carry out species protection and resource development and utilization of Habenaria myriotricha. There is no report on the use of fungi to promote the seed propagation of Habenaria myriotricha. Summary of the invention

[0005] In order to solve or partially solve the problems existing in the related art, the present application provides a Ceratobasidium sp. MYYFH20 fungus strain for promoting the germination of Mengyuan Jade Phoenix seeds. The strain is isolated from the protocorms formed by the germination of Mengyuan Jade Phoenix seeds in the wild, and can effectively promote the germination of Mengyuan Jade Phoenix seeds to form protocorms and grow and develop into seedlings.

[0006] The present application also provides a method for promoting the germination of Mengyuan Jade Phoenix flowers seeds.

[0007] The Ceratobasidium sp. MYYFH20 fungus strain that promotes the germination of Mengyuan Jade Phoenix seeds in this application was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on October 21, 2024, with the deposit number CGMCC No.41580 and the classification name Ceratobasidium sp.

[0008] Furthermore, the fungal strain of the genus Anthoceras is isolated from the protocorms formed by the germination of Mengyuan Jade Phoenix seeds in the wild.

[0009] Furthermore, the method for promoting the germination of Mengyuan Jade Phoenix Flower seeds in the present application establishes a symbiotic relationship between the fungal strain of the genus Ceratonia and the Mengyuan Jade Phoenix Flower seeds to promote the germination of the Mengyuan Jade Phoenix Flower seeds.

[0010] Furthermore, the method for promoting the germination of Mengyuan Jade Phoenix flowers in the present application comprises the following steps:

[0011] (1) Preparation of inoculation materials: Activate the fungal strain of the genus Ceratium on a PDA culture dish. When the mycelium is close to filling the culture dish, make a cake of the culture medium with mycelium under a sterile condition for later use;

[0012] (2) Preparation of germination medium: preparing germination medium (oat medium) for germination of seeds of Mengyuan Yufenghua;

[0013] (3) Seed disinfection and sowing: The seeds of Mengyuan Yufenghua were disinfected and sown into the germination medium;

[0014] (4) Inoculation: placing the bacterial cake around the seeds of the magnolia oleifera to be promoted for germination that have been sown in the germination medium in step (2);

[0015] (5) Co-cultivation: Co-cultivating the seeds of the Mengyuan Yufenghua to be promoted to germinate with the fungal strain of the genus Ceratium.

[0016] Furthermore, the seeds are sterilized and sown in step (3) as follows: the seeds of Mengyuan Yufenghua are placed in a sodium hypochlorite solution containing 1% effective chloride ion concentration on a clean bench and soaked for 5 minutes, the seeds are rinsed with sterile water for 3 times, and the seeds are added to 1g·L -1 Shake well in the sterile agar suspension to make a seed suspension, use a pipette to absorb a certain amount of the seed suspension and evenly spread it in the germination medium.

[0017] Furthermore, the co-culture conditions are: first culture in a completely dark tissue culture room for 30 days, then adjust the light cycle to 12 / 12h L / D light-dark alternating culture, light intensity 2000lx; culture temperature is 23±1°C.

[0018] The germination of orchid seeds can be achieved through two methods: non-symbiotic germination culture and symbiotic germination culture. Although some orchid species can be cultured through non-symbiotic germination and have a high germination rate, the seedlings obtained in this way grow slowly when transplanted into nature, have poor resistance to pathogenic microorganisms, and have a low survival rate. At the same time, it is difficult to establish a symbiotic relationship with subsequent contact fungi, which seriously hinders subsequent growth. Symbiotic germination culture technology refers to the simultaneous sowing of orchid seeds and symbiotic fungi in a specific matrix (culture medium). This method can improve the germination rate of seeds, the growth rate of seedlings, and the survival rate of seedlings after transplantation into the natural environment.

[0019] Since the symbiotic relationship between orchid seeds and fungi is specific, the symbiotic fungi of different orchid seeds are different. Determining the effective fungi that can form a symbiotic relationship with Mengyuan Jade Flower seeds and promote their germination is a key link in breeding Mengyuan Jade Flower seedlings. The acquisition of symbiotic seedlings is the basis for carrying out the work of returning Mengyuan Jade Flower to its native habitat. The strain of the present invention cultivates Mengyuan Jade Flower seeds and different fungi and controls on an artificial matrix through a symbiotic germination experiment, and successfully obtains an effective strain that promotes the germination of Mengyuan Jade Flower seeds through a statistical analysis of the seed germination rate, thereby opening up a new way for efficiently cultivating seedlings using the symbiotic germination of Mengyuan Jade Flower seeds and fungi. The acquisition of this strain has important practical significance for the species protection of Mengyuan Jade Flower, which is rare and endangered and has important ornamental value, and the development of flower resources.

[0020] The beneficial effects of this application are:

[0021] The fungal strain of the genus Ceratonia in the present application can significantly promote the germination of Mengyuan Jade Phoenix seeds, and has important practical significance for obtaining symbiotic germination seedlings. It can be used for nursery seedling cultivation or direct seeding in the wild. Compared with tissue culture, it has the advantages of simple operation, no need for seedling hardening, and low cost. The seedlings have strong resistance to pathogens, high survival rate in the wild, and no tissue degeneration. It has application value in replacing tissue culture to obtain symbiotic seedlings. DETAILED DESCRIPTION

[0022] The embodiments of the present application will be described in more detail below with reference to examples. Although the embodiments of the present application are shown in the examples, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and the scope of the present application can be fully communicated to those skilled in the art.

[0023] Example 1

[0024] Isolation of the fungal strains of the genus Anthozoa

[0025] (1) In situ induction experiment

[0026] Take out the frozen Mengyuan Yufenghua seeds from -20℃ 24 hours in advance, and restore the seeds to room temperature for use. Take 0.3g of agar powder and put it into 300mL of pure water for sterilization to prepare a 0.1% agar suspension. Take a certain amount of seeds and put them into 0.1% agar suspension, shake them evenly to make the seeds completely suspended. Use a pipette to draw 100μl of seeds onto a glass slide, cover them with a coverslip, and count them under a stereomicroscope. Repeat 10 times, take the average count, and estimate the number of seeds contained in 1mL of seed suspension. The seed suspension in this in situ induction experiment contains approximately 86 seeds per milliliter.

[0027] This study improved the terrestrial orchid seed bag designed by Rasmussen and Whigham. The nylon cloth was cut into 6cm×3cm strips, folded in half, and sealed with an alcohol lamp on both sides. 1mL of seed suspension was pipetted into a 3cm×3cm seed bag made of nylon cloth, and the nylon cloth seed bag was sealed by heating with an alcohol lamp. After marking, 10 seed bags were strung together with needle and thread for easy burial.

[0028] The seed bags were placed in the natural habitat of Mengyuan Jade Phoenix in Mengla County. On June 7, 2023, the prepared seed bags were buried in the surface soil within 30 cm of the wild plants of Mengyuan Jade Phoenix (soil thickness 3-5 cm), covered with fallen leaves and other humus to shade the seed bags and keep the moisture in the seed bags, and covered with white plastic mesh to prevent rain erosion. Finally, a 5mL gun head was inserted nearby as a mark. A total of 90 seed bags were placed in this experiment. After 70 days, go to the research site to check the germination of the seed bags. When checking, clean the soil and attachments outside the seed bag, carefully cut it open along the seal with scissors, and if the seeds are found to have germinated, wrap them with wet paper towels and bring them back to the laboratory for subsequent fungal isolation experiments.

[0029] (2) Preparation of mycelium

[0030] Potato glucose medium (PDA medium) formula: 200g / L potato; 20g / L glucose; 16g / L agar, natural pH. Preparation method of PDA medium: weigh 200g peeled potato, cut into pieces of about 1cm, boil for 30min, filter the potato residue with 4 layers of gauze, add 20g glucose to the filtered solution, then add 16g agar and heat, stir and mix quickly with a glass rod until the agar is dissolved, let the solution stand and add pure water to 1L, divide it into 3 conical bottles, cover with rubber stoppers, wrap the bottle mouth with newspaper again, autoclave at 121℃, pressure 100kPa, sterilize for 20min. In the clean bench, pour it into a sterilized culture dish with a diameter of 9cm, each dish contains about 15mL of culture medium, and wait for it to cool down and set aside.

[0031] The method of configuring the test tube slope is to draw the prepared PDA culture medium solution into the glass test tube with a syringe, and the culture medium accounts for about 1 / 3 of the test tube volume. Use a rubber stopper to plug the test tube mouth tightly, tie 10 test tubes together with a rubber band, and then wrap them with newspaper to cover the interface between the rubber stopper and the test tube. Sterilize in an autoclave at 121℃ for 20 minutes, and then place the test tube on the laboratory table to form a slope for use.

[0032] (3) Preparation of mycelium

[0033] Symbiotic fungi in protocorms and rhizomes were separated by tissue block method. In a clean bench, the protocorms were disinfected with 75% ethanol for 2 minutes, rinsed with sterile water for 30 seconds, rinsed twice, disinfected with 1% NaClO solution for 5 minutes, and washed with sterile water for 3-5 times. The protocorms were taken out and placed in a sterile culture dish for later use. The protocorms were cut into small pieces with a sterile blade, and a small piece of tissue was taken with an inoculation needle so that the cut was attached to the surface of the PDA culture medium.

[0034] The isolation of symbiotic fungi from root tissues adopts the single hyphae separation method. Select tender roots of Mengyuan Yufenghua about 3 cm long, rinse with sterile water to remove the surface attachments and impurities of the root segments, and place them on a clean bench. Use a sterile scalpel to cut them into root segments of about 1 cm, and then use a scalpel to gently scrape off the root cover. Rinse the scraped root segments with sterile water once, disinfect with 75% ethanol for 30 seconds, rinse with sterile water again, disinfect with 1% NaClO solution for 2 minutes, and rinse with sterile water 3-5 times. Use a sterile scalpel to gently scrape the roots repeatedly to release the hyphae in a culture dish filled with sterile water. After standing in sterile water for 1-2 hours, observe the release of the hyphae under an optical microscope with a 10x objective lens. When the field of view of the hyphae appears in the eyepiece, use a 10μl pipette to absorb the single hyphae into the PDA culture medium and mark the inoculation position for easy observation.

[0035] (4) Mycelial mass culture

[0036] Write a label and the date of separation on the culture dish, seal it with a sealing film, and culture it in a mold incubator (25±2℃, dark conditions). When the mycelium grows, pick the tip of the mycelium and inoculate it on a new PDA culture medium. After marking, seal it with a sealing film and culture it in a mold incubator (conditions as above). This process can be repeated 3-5 times to obtain pure colonies.

[0037] (5) Strain purification

[0038] When hyphae grow out of the cut of the protocorm, use a sterile inoculation needle on a clean bench to pick up the tip of the hyphae at the edge of the growing fungal colony and inoculate it onto a new PDA medium. Repeat the above steps to obtain pure colonies.

[0039] (6) Naming

[0040] The purified fungus was stored in a test tube slant and named MYYFH20.

[0041] Specifically, in the clean bench, use a sterile inoculation needle to pick the edge hyphae of the purified fungi and inoculate them on the PDA slope. Use a rubber stopper to seal it tightly, and mark the strain and date. Place the inoculated test tube in a mold incubator at 25±2℃ for incubation. After the hyphae cover the test tube slope, place part of the test tube slope in a 4℃ refrigerator for storage.

[0042] Biodeposit Information:

[0043] The Ceratobasidium fungus strain MYYFH20 involved in this application was deposited on October 21, 2024 at the General Microbiology Center of the China Culture Collection Administration, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit number of CGMCC No. 41580 and a classification name of Ceratobasidium sp.

[0044] Identification of the fungal strains of the genus Anthozoa

[0045] Morphological identification:

[0046] Colony appearance and microscopic morphology: Use the cover glass insert culture method, culture in a mold incubator at 25±1℃ for 7 to 14 days, take the insert and make slides according to the conventional method. Select hyphae at different growth stages for observation and measurement according to observation needs.

[0047] The results showed that the bacterial species in the present application were cultured on a PDA plate for 7 days and their colonies were white without concentric rings; the mycelium had a rough texture and was tightly arranged; the mycelium diameter was 4.8-7.0 μm with septa, the cell length was 48.8-111.3 μm with branches, the branching angle was 60°-90°, there were septa not far from the branches, and there were septa at the angle within the mycelium away from the branches.

[0048] Molecular identification:

[0049] The primers used for PCR amplification were fungal universal primers ITS1 and ITS4.

[0050] The amplification reaction was performed on a Perkin Elmer PCR instrument, with the following PCR cycles: 94°C pre-denaturation for 3 min, 1 cycle; 94°C denaturation for 1 min, 51°C annealing for 45 s, 72°C extension for 45 s, 35 cycles; and finally 72°C extension for 7 min. The PCR product was recovered using the AxyPrep DNA gel recovery kit, and the PCR product of the purified strain was taken for DNA sequencing using the sequencer ABI3730-XL. The PCR amplification product was sent to Shanghai Paisono Biotechnology Co., Ltd. for sequencing.

[0051] The obtained ITS fragment sequence of the symbiotic fungus effective for seed germination of Mengyuan Yufenghua was subjected to BLAST comparison analysis in the database of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov / ), and its similarity with the strain CMML21-42 isolated from South Korea (GenBank No.: OR857248.1) was 100.00%.

[0052] The fungus involved in the present invention was identified as a fungus of the genus Ceratocystis based on colony, microscopic morphological characteristics and molecular biological methods.

[0053] The ITS sequence of Ceratium is as follows (SEQ ID NO.1):

[0054] GAGATCAGATCATAAATTAATTGTCTAACTTAATAGACTGTTAGAAGCGGTTCATCTGCA

[0055] TTTCCTGGCCACTTTTTACAGTGTCCTCAGCGAGTGATACTTATCACGCCGAGTGGAACC

[0056] AAGCATATACTGAGATCCAGCTAATAAATTTAAGAGGAGCAGACGTGAAATCTGCAAAAA

[0057] CCTCCAAGTCCAAAGCAAACCAGTTGAATTAACAAAAAATTTACTTTGAGAATTTCATGA

[0058] TACTCAAACAGGCATGCTCCAAGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGA

[0059] TGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGAT

[0060] GCGAGAGCCAAGAGATCCGTTGTTGAAACTTAGTTCTAATGATGGCGTTACATCAATTACA

[0061] TTCAATTTAATTAAATGAGTTTGTGTAATTAAGTAGACGGAAAACTAATTAAAGTCCTCC

[0062] GTCTCACAAGTGCACAGGTGTGTGTGGATGAAAGAGAAGGCGTGCACATGCCCCGAAAG

[0063] GGCCAGCGACAACCAACTCTACATTCATTCAATAATGATCCTTC

[0064] Example 2

[0065] Detection of the effectiveness of Ceratium spp. strains on the symbiotic germination of seeds of Echeveria spp.

[0066] (1) Preparation of inoculated materials: Piriformospora indica (YDLXB) preserved in the laboratory, PJXL strain derived from the protocorm of Jinxianlan, M1, M3 and M5 derived from the rhizomes of Mengyuan Yufenghua, M20 and M42 derived from the protocorm, and MR3, MR6 and MR7 strains derived from root tissue were activated on a 9 cm diameter PDA culture dish. When the mycelium was close to filling the culture dish, the culture medium with mycelium was aseptically prepared into a 1 cm diameter cake for later use; at the same time, a blank PDA culture medium was also prepared into a 1 cm diameter agar cake for later use;

[0067] (2) Prepare several plates of oatmeal culture medium and MS culture medium according to the experimental design and sterilize them for use.

[0068] (3) Seed disinfection and sowing: Place a small amount of Mengyuan Yufenghua seeds in a sodium hypochlorite solution containing 1% effective chloride ion concentration on a clean bench and soak for 5 min. Rinse the seeds with sterile water for 3 times and add 1 g·L -1 The seed suspension is prepared by shaking the sterile agar suspension thoroughly. A certain amount of the seed suspension is taken with a pipette and spread evenly in each petri dish. The role of sodium hypochlorite is to sterilize the seeds and soften the seed coat.

[0069] (4) Inoculation: 11 groups of 10 different strains of bacterial cakes and sterile PDA agar cakes (negative control) were inoculated into oatmeal culture medium; the same amount of seeds were sown on the positive control MS culture medium (positive control); a total of 288 dishes;

[0070] (5) Setting the light culture conditions: First, place the culture dish in a completely dark (0 / 24h L / D) tissue culture room for 30 days, then adjust the light cycle to 12 / 12h L / D light-dark alternation culture, light intensity 2000lx; culture temperature 23±1℃;

[0071] (6) Testing and data statistical analysis: After sowing, the germination and development of seeds were observed and recorded weekly. Six culture dishes were taken from each bacterial treatment group 30, 60, and 90 days after sowing and observed and counted under a stereomicroscope.

[0072] The different stages of seed germination of orchids are shown in Table 1. They are divided into five stages: stage 0 is described as the embryo is transparent, the seed coat is intact, and the seed has not germinated; stage 1 is described as the embryo absorbing water and swelling, but the seed coat still exists, which is considered germination; stage 2 is described as the embryo continues to swell, breaking through the seed coat, and forming a protocorm; stage 3 is described as the appearance of primary meristems and the formation of the first protrusion, that is, the stage of cotyledon formation; stage 4 is described as the growth of the first leaf, that is, the early stage of seedling development; stage 5 is described as the growth of the second leaf, that is, the formation of seedlings.

[0073] The number of seeds in each germination stage of different fungus treatment groups at different time periods was recorded. The data of different time periods were statistically analyzed. The seed germination rate, cotyledon formation rate, seedling formation rate and other indicators were calculated. The germination ratio of seeds at different stages was calculated. SPSS27.0 software was used to perform one-way analysis of variance and independent sample t-test on the experimental data. If the data conformed to normal distribution and variance homogeneity, the least significant difference method (LSD) was used for multiple comparisons. If the data did not conform to variance homogeneity, Tamhane T2 was used for multiple comparisons; if the data did not conform to normal distribution, the Mann-Whitney U test in non-parametric tests was used. Origin2023 was used to draw charts (N0: the number of seeds that did not absorb water and swell; N1: the number of seeds that germinated to the first stage, N2-N5 and so on). The protocorm formation rate (seed germination rate) = N2 + N3 + N4 + N5 / total number of seeds; the cotyledon formation rate = N3 + N4 + N5 / total number of seeds; the seedling formation rate = N4 + N5 / total number of seeds.

[0074] Table 1 Description of different germination stages of Mengyuan Yufenghua seeds

[0075]

[0076]

[0077] (7) Seed germination detection and data statistical analysis

[0078] After 30 days of symbiotic germination, most of the seeds in each treatment group were in the stage of water absorption and swelling. The positive control group (MS), M3, M20, M42 and MR3 treatment groups could promote seed germination and break through the seed coat to form protocorms. The seed germination rate of the M20 strain derived from the protocorm was significantly higher than that of other treatments, reaching 8.07±2.31%, and only the seeds of the M20 treatment group could grow to the cotyledon stage at 30 days, with a cotyledon formation rate of 0.74±0.4% (p<0.0001).

[0079] Table 2 Effects of different fungal treatments on seed germination of Mengyuan Jade Phoenix (30-day statistics)

[0080]

[0081] Note: The data in the table are mean ± standard error. Different lowercase letters in the same column represent that the corresponding mean values ​​are significantly different at the p < 0.05 level, the same below.

[0082] After 60 days of seed-fungal symbiotic culture, except for MR3, MR6, MR7 and PJXL, which could not promote further seed germination, the other strains could promote seed germination and form protocorms within 60 days, among which the germination rates of M20 and M42 strains were significantly higher than those of other treatments. The germination rate of M20 treatment group reached 16.14±3.82% at 60 days, and the germination rate of M42 treatment group was 10.43±5.29% at 60 days; the cotyledon formation rates of M20 and M42 treatment groups reached 9.1±3.96% and 7.89±5.13% at 60 days, which were significantly higher than those of the positive control treatment group (MS); only M20 and M42 treatment groups promoted the germination of seeds of Mengyuan Yufenghua to form seedlings within 60 days of symbiotic culture, and the seedling formation rates were 4.59±2.85% and 2.56±2.35%, respectively.

[0083] Table 3 Effects of different fungi on the germination of Mengyuan Jade Phoenix seeds (60-day statistics)

[0084]

[0085] After 90 days of fungal seed symbiosis, most of the seeds in the treatment groups were still in a state of water absorption and swelling. The MR3, MR6, MR7, and PJXL treatment groups could not promote seed germination to the protocorm stage. The 90-day seed germination rate of the M20 treatment group was the highest, reaching 18.14±5.79%, significantly higher than that of the other treatment groups; the germination rate of the M42 treatment group was also high, at 12.52±5.06%; the 90-day seed germination rate of the MS treatment group was 9.41±3.16%. Among the M1, M3, and M5 fungal treatment groups isolated from rhizomes, the 90-day seed germination rate of the M1 treatment group was 5.9±3.34%, significantly higher than that of the M3 and M5 treatment groups; although YDLXB could promote seed germination, the germination rate was low, only 1.06±0.32%. The M20, M42 and MS treatment groups can promote the germination of seeds to the cotyledon stage within 90 days, and the cotyledon formation rates of the M20 and M42 treatment groups were 10.33±4.8% and 7.11±3.61%, respectively, which were significantly higher than those of the MS treatment group. Only the M20 and M42 treatment groups can promote the rapid growth and development of Mengyuan Yufenghua seeds to form seedlings within 90 days, and their seedling formation rates were 7.21±4.03% and 5.87±3.13%, respectively.

[0086] Table 4 Effects of different fungi on the germination of Mengyuan Jade Phoenix seeds (90-day statistics)

[0087]

[0088] The above experiments confirmed that the M20 strain can significantly improve the germination rate of Mengyuan Yufenghua seeds in the early stage of symbiotic culture, which is equivalent to shortening the time of seed germination. More importantly, M20 promotes the earliest time for Mengyuan Yufenghua seeds to form seedlings, and the formation ratio is significantly higher than other fungal treatments, negative controls and positive controls. In the later stage of symbiotic culture, i.e., the seedling formation period, although the inoculation of symbiotic fungi isolated from different sources can also promote the germination of Mengyuan Yufenghua to a certain extent, the M20 strain isolated from the original corm of Mengyuan Yufenghua itself has the best germination-promoting effect. Mengyuan Yufenghua seeds and the strain of the present invention show strong specificity, and the M20 strain and Mengyuan Yufenghua seeds can be used to produce seedlings by symbiotic germination.

[0089] It should be noted that the M20 strain in this embodiment is the Ceratocystis fungus strain MYYFH20 mentioned in Example 1, which can be fully understood by those skilled in the art.

[0090] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A Ceratobasidium sp. fungus strain MYYFH20 for promoting the germination of Mengyuan Jade Phoenix Flower seeds, characterized in that: The strain MYYFH20 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 21, 2024, with the deposit number CGMCC No.41580 and the classification name of Ceratitis.

2. The fungus strain of the genus Anthocephalum according to claim 1, characterized in that The Angiospermum fungus strain is isolated from the protocorms formed by germination of Mengyuan Jade Phoenix seeds in the wild.

3. A method for promoting the germination of Mengyuan Yufenghua seeds, characterized in that: A symbiotic relationship is established between the Angiospermum fungus strain described in claim 1 and the Mengyuan Jade Phoenix Flower seeds to promote the germination of the Mengyuan Jade Phoenix Flower seeds.

4. The method for promoting germination of seeds of Mengyuan Yufenghua according to claim 3, characterized in that: The following steps are involved: (1) Preparation of inoculation materials: Activate the fungal strain of the genus Ceratium on a PDA culture dish. When the mycelium is close to filling the culture dish, make a cake of the culture medium with mycelium under a sterile condition for later use; (2) Preparation of germination medium: preparing germination medium (oat medium) for germination of seeds of Mengyuan Yufenghua; (3) Seed disinfection and sowing: The seeds of Mengyuan Yufenghua were disinfected and sown into the germination medium; (4) Inoculation: placing the bacterial cake around the seeds of the magnolia oleifera to be promoted for germination that have been sown in the germination medium in step (2); (5) Co-cultivation: Co-cultivating the seeds of the Mengyuan Yufenghua to be promoted to germinate with the fungal strain of the genus Ceratium.

5. The method for promoting germination of seeds of Mengyuan Yufenghua according to claim 4, characterized in that: The seeds are sterilized and sown after being disinfected in step (3): the seeds of Mengyuan Yufenghua are placed in a sodium hypochlorite solution containing 1% effective chloride ion concentration on a clean bench and soaked for 5 minutes, the seeds are rinsed with sterile water for 3 times, and the seeds are added to 1g·L -1 Shake well in the sterile agar suspension to make a seed suspension, use a pipette to absorb a certain amount of the seed suspension and evenly spread it in the germination medium.

6. The method for promoting germination of seeds of Mengyuan Yufenghua according to claim 4, characterized in that: The co-culture conditions are as follows: after culturing in a completely dark tissue culture room for 30 days, the light cycle is adjusted to 12 / 12hL / D light-dark alternating culture, the light intensity is 2000lx, and the culture temperature is 23±1°C.

7. Use of the fungal strain of the genus Ceratium according to any one of claims 1 to 2 or the method according to any one of claims 3 to 7 in promoting the germination of seeds of Mengyuan Yufenghua.

Images