Nucleic acid molecule related to potato anthocyanin accumulation and application thereof

Abstract

The invention discloses a nucleic acid molecule related to potato anthocyanin accumulation and application of the nucleic acid molecule, and belongs to the field of plant breeding. According to the application, two genes StMYB200 and StMYB210 are provided through GWAS analysis and RNA-seq, and it is proved through transgenic experiments and RNA-seq that the genes participate in accumulation of anthocyanin in potato pulp; the invention provides a 1.7 kb Indel nucleic acid molecule of a promoter region of the StMYB210 gene for the first time, and the nucleic acid molecule is associated with expression of the gene and anthocyanin accumulation of potato meat. The invention further develops a pair of efficient and stable co-dominant markers which can be used for screening germplasm of disomatic potatoes with anthocyanin in potato pulp.

Description

Technical Field

[0001] The present application relates to the field of plant breeding, and in particular to a nucleic acid molecule related to potato anthocyanin accumulation and an application thereof. Background Art

[0002] Anthocyanins are a type of flavonoid compound. They are the most effective antioxidants discovered by humans today, and they are also the most powerful free radical scavengers with anti-mutation functions. Products rich in anthocyanins are sought after by people because they meet people's needs for natural, safe and healthy products. The synthesis pathway of anthocyanins in plants is coordinated by structural genes and regulatory genes. The regulatory genes involved in anthocyanin synthesis are mainly MYB transcription factors, bHLH transcription factors and WD40 repeat proteins, which usually form MBW complexes to regulate the expression of structural genes in the anthocyanin pathway, thereby regulating the synthesis of anthocyanins in plants.

[0003] Potato (Solanum tuberosum L.) is one of the most important tuber crops. In nature, its tubers are rich in color, ranging from white to dark purple-blue, which is mainly attributed to the accumulation of anthocyanins and carotenoids. However, among cultivated varieties, potato tubers are mainly yellow and white. Although there are some potato varieties with red or purple skin, the edible part of the potato is the flesh, which is far from meeting people's needs.

[0004] There are three main loci reported for anthocyanin accumulation in potato tubers: Developer / Inhibitor (D / I), Red (R), and Purple (P). The R and P genes encode dihydroflavonol 4-reductase (DFR) and flavonoid 3',5'-hydroxylase (F3'5'H) on chromosomes 2 and 11, respectively; while the D / I locus is located on chromosome 10 and encodes the R2R3-MYB transcription factor Solanumtuberosum anthocyanin 2 (Stan2), which is responsible for regulating the specific accumulation of anthocyanins in potato skin. However, the specific coding gene of the Pigmented tuber flesh (Pf) locus that regulates the specific accumulation of anthocyanins in potato flesh is still unknown, and the lack of corresponding molecular markers has hindered the development of new potato varieties rich in anthocyanins. Summary of the invention

[0005] The present application identifies for the first time two genes StMYB200 and StMYB210 that regulate anthocyanin accumulation in potato flesh, which can be used to regulate anthocyanin accumulation in potato flesh, and provides for the first time a 1.7kbIndel nucleic acid molecule in the promoter region of the StMYB210 gene, which has the function of regulating anthocyanin accumulation in potato flesh. The present application further develops a pair of efficient and stable co-dominant markers that can be used for the screening of disomic potato germplasm containing anthocyanins in potato flesh.

[0006] In order to achieve the above-mentioned invention object, this application provides the following technical solutions:

[0007] First, the present application provides a nucleic acid molecule, whose nucleic acid sequence is shown in SEQ ID NO:1.

[0008] The sequence contains 10 repeat segments, each of which is about 100 bp in length and contains multiple MBSs elements, including two types: MBS1 (CAACGG) and MBS2 (ACCAA / ATCAAA).

[0009] Inserting it into the promoter region of StMYB210 gene can activate the expression of StMYB210.

[0010] The present application provides the use of the above nucleic acid molecules in regulating the accumulation of anthocyanins in potato flesh.

[0011] Specifically, the nucleic acid molecule binds to the StMYB200 protein and / or the StMYB210 protein to promote the accumulation of anthocyanins in potato flesh.

[0012] Specifically, the nucleic acid molecule is located in the promoter region of the StMYB210 gene.

[0013] Both StMYB200 protein and StMYB210 protein can activate the expression of StMYB210 by binding to the MBSs elements in the above-mentioned nucleic acid molecules, thereby activating the expression of the anthocyanin synthesis structural gene StDFR and accumulating anthocyanins in potato flesh.

[0014] Specifically, the amino acid sequence of the StMYB200 protein is shown in SEQ ID NO:2, and the amino acid sequence of the StMYB210 protein is shown in SEQ ID NO:3.

[0015] The present application provides a primer pair, the sequences of which are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0016] StMYB210pro-Indel-F:GATCGCACATTATATGGCCCT(SEQ NO:4),

[0017] StMYB210pro-Indel-R: GTCACCTCCTTGATATGTGGCC (SEQ NO: 5).

[0018] The primer pair is a co-dominant marker primer developed based on the nucleic acid molecule, and the genotype of potato, such as homozygous insertion genotype, heterozygous genotype or homozygous non-insertion genotype, can be determined by identifying whether the nucleic acid molecule exists.

[0019] The present application also provides the use of the above primer pair in at least one of the following:

[0020] (1) Screening or identifying potato genotypes based on the above nucleic acid molecules;

[0021] (2) screening or identifying potato materials containing or not containing the above nucleic acid molecules;

[0022] (3) Assisted potato breeding or variety improvement, or preparation of related products;

[0023] (4) Cultivating potato varieties rich or not rich in anthocyanins, or preparing related products.

[0024] Preferably, the product comprises a kit.

[0025] The present application provides a kit, which contains reagents for detecting the above-mentioned nucleic acid molecules.

[0026] Preferably, the reagent comprises the above primer pair. The sequences of the primer pair are shown in SEQ NO:4 and SEQ NO:5.

[0027] The present application provides a method for screening potato plants, the method comprising: identifying whether the genome of the potato plant contains the above nucleic acid molecule to screen the potato plant.

[0028] Preferably, the above primers are used to perform PCR amplification on the genome of potato plants, and the PCR amplification products are sequenced or electrophoresed to determine whether the potato plants to be tested contain the above nucleic acid molecules.

[0029] The present application also provides a method for producing or cultivating potatoes with anthocyanin-rich flesh, the method comprising:

[0030] The StMYB200 protein and the StMYB210 protein are expressed in a recipient potato plant which lacks the StMYB200 protein and / or the StMYB210 protein.

[0031] Preferably, the promoter region for expressing the StMYB210 protein contains the above-mentioned nucleic acid molecule.

[0032] In some embodiments, the method comprises: introducing a StMYB200 protein expression vector into a recipient potato plant, wherein the recipient potato plant is a potato plant lacking StMYB200 protein expression; and / or; introducing a StMYB210 protein expression vector into a recipient potato plant, wherein the recipient potato plant is a potato plant lacking StMYB210 protein expression.

[0033] Specifically, the introduction method includes introduction by genetic engineering and / or introduction by hybrid breeding.

[0034] In one embodiment, the promoter sequence for expressing the StMYB210 protein containing the above-mentioned nucleic acid molecule is shown as SEQ ID NO:6.

[0035] In one embodiment, the nucleic acid sequence encoding the StMYB200 protein is shown as SEQ ID NO:7, and the nucleic acid sequence encoding the StMYB210 protein is shown as SEQ ID NO:8.

[0036] The present application also provides a method for producing or cultivating potatoes whose flesh does not contain anthocyanins, the method comprising:

[0037] The expression of StMYB200 and / or StMYB210 proteins in silencing receptor potato plants, wherein the amino acid sequence of the StMYB200 protein is shown in SEQ ID NO:2, and the amino acid sequence of the StMYB210 protein is shown in SEQ ID NO:3.

[0038] In some embodiments, the method of silencing expression includes knocking out the coding gene of StMYB200 and / or StMYB210 protein, its promoter region, etc.

[0039] In some embodiments, the method of silencing expression includes gene editing technology, RNAi technology, etc.

[0040] The beneficial effects of the present application are as follows: the present application identifies and proves for the first time that two R2R3-MYB transcription factor genes DM8C10G21200 (StMYB200) and DM8C10G21210 (StMYB210 / Stan2 / StAN1) are genes encoded by the Pf site and are involved in the accumulation of anthocyanins in potato flesh; at the same time, the 1.7 kb insert fragment (SEQ ID NO: 1) in the StMYB210 promoter provided by the present application is proved to be related to the expression of StMYB210, and the insert fragment is necessary for the accumulation of anthocyanins in potato flesh. Potato materials with anthocyanin accumulation in potato flesh must contain the insert fragment, which can be used to breed potato varieties rich in anthocyanins and accelerate the breeding of colored potatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Genome-wide association analysis of potato flesh color.

[0042] Figure 2 is the gene distribution of the Pf locus.

[0043] Figure 3 Analysis of the expression patterns of candidate genes at the Pf locus in the peel and flesh of diploid potato 01-58 and RH.

[0044] Figure 4 Schematic diagram of sequence mutations in StMYB200 and StMYB210 knockout strains.

[0045] Figure 5 Figure 2 shows the tuber phenotype of StMYB200 and StMYB210 knockout lines.

[0046] Figure 6 Expression analysis of structural genes in anthocyanin biosynthesis pathway in StMYB200 and StMYB210 knockout lines.

[0047] Figure 7 Schematic diagram of the structure of the two haplotypes of the StMYB210 gene in the 01-58 strain.

[0048] Figure 8 Identification of white and red fleshed potato lines in the self-pollinated progeny lines of 01-58 and the 1.7 kb insertion in their StMYB210 promoter.

[0049] Fig. 9 This is the expression level analysis of the pf / pf and Pf / Pf strains of the self-pollinated progeny of 01-58.

[0050] Fig.10 Schematic diagram of the structure of the 1.7 kb insertion sequence of the StMYB210 promoter in the Pf haplotype.

[0051] Fig.11 This is the 1.7 kb insertion sequence of the StMYB210 promoter in the Pf haplotype (the sequence marked in red is MYB binding site 1 (MBS1), and the sequence marked in blue is MYB binding site 2 (MBS2)).

[0052] Fig.12 The 1.7 kb insertion sequence for StMYB200 and StMYB210 activates the expression of StMYB210 by binding to the StMYB210 promoter.

[0053] Fig.13The tuber phenotypes of 24 diploid potato materials and the identification and expression analysis of the 1.7 kb insertion of the StMYB210 gene were analyzed.

[0054] Fig.14 Statistics for identification of the 1.7 kb insertion of the StMYB210 gene in 354 diploid potato materials. DETAILED DESCRIPTION

[0055] In some embodiments of the present application, a genome-wide association study (GWAS) was conducted on 135 diploid potato materials, and a major effect site Pf for potato flesh color regulation was identified at the end of chromosome 10. Combined with genome annotation and transcriptome analysis, it was speculated that two tandem R2R3-MYB transcription factors DM8C10G21200 (StMYB200) and DM8C10G21210 (StMYB210) may be candidate genes for the Pf site.

[0056] In some embodiments of the present application, gene editing technology is used to provide evidence that the above two R2R3-MYB transcription factors are involved in the accumulation of anthocyanins in potato flesh. These two transcription factors are necessary for the accumulation of anthocyanins in potato flesh. Transcriptome sequencing analysis further shows that StMYB200 and StMYB210 are involved in the accumulation of anthocyanins in potato flesh.

[0057] In some embodiments of the present application, a promoter sequence of the StMYB210 gene is provided, and a 1.7 kb insertion / deletion (Indel) is found for the first time in the promoter region of the StMYB210 gene; a pair of efficient and stable co-dominant markers (the marker primers are StMYB210pro-Indel-F / -R) are developed based on the 1.7 kb Indel fragment in the promoter region of the StMYB210 gene, and the co-dominant marker primers can accurately identify the homozygous or heterozygous genotype of the 1.7 kb Indel in the StMYB210 promoter; the marker primers are used to amplify the 01-58 self-pollinated progeny lines, and it is found that the white potato flesh lines all belong to the pf / pf genotype without the 1.7 kb insertion, while the red potato flesh lines all belong to the Pf / Pf genotype containing the 1.7 kb insertion.

[0058] In some embodiments of the present application, expression level analysis and biochemical experiments are provided to prove that StMYB200 and StMYB210 activate the expression of StMYB210 by binding to the 1.7 kb insertion fragment in the StMYB210 promoter, thereby affecting the accumulation of anthocyanins in potato flesh.

[0059] In some embodiments of the present application, 24 diploid potato materials (including 4 wild species with white skin and white flesh, and 20 local varieties (11 potatoes with no anthocyanin accumulation and 9 potatoes with anthocyanin accumulation)) were amplified using the provided co-dominant marker primers (the marker primers are StMYB210pro-Indel-F / -R), and potato flesh RNA was extracted for semi-quantitative experiments, confirming that the 1.7kb insertion fragment in the StMYB210 promoter is associated with the expression of the gene and the accumulation of anthocyanins in the potato flesh, and that potato materials with anthocyanin accumulation in the potato flesh must contain the insertion fragment. The StMYB210 promoter of 354 diploid potato materials (100 wild materials with colorless flesh, 211 local varieties with no anthocyanin accumulation in flesh, and 43 local varieties with anthocyanin accumulation in flesh) was amplified and identified using co-dominant marker primers (marker primer is StMYB210pro-Indel-F / -R). This further proved from the perspective of natural populations that the presence of the 1.7kb insertion fragment is associated with the accumulation of anthocyanins in potato flesh, and that potato materials with anthocyanin accumulation in flesh must contain this insertion fragment.

[0060] The nucleic acid molecule provided in the present application includes the sequence shown in SEQ ID NO:1. According to a preferred embodiment of the present invention, the nucleic acid molecule provided is the sequence shown in SEQ ID NO:1. The nucleic acid molecule provided can also be a DNA fragment containing the nucleotide sequence shown in SEQ ID NO:1, that is, the nucleotide sequence other than the 5' end and / or 3' end of SEQ ID NO:1, which is also the sequence of the StMYB210 gene in the potato genome, for example, it can contain the upstream and downstream sequences of the 5' end and / or 3' end of SEQID NO:1 in the StMYB210 gene in the potato genome. It can be understood by those skilled in the art that as long as the sequence shown in SEQ ID NO:1 in the potato genomic DNA is amplified or detected, only the nucleic acid molecule can be detected or amplified. The length of the DNA fragment is an appropriate length, but is not particularly limited.

[0061] In order to better understand the present application, the present application is further specifically described below through the following embodiments, but it should not be understood as a limitation of the present application. Some non-essential improvements and adjustments made by technicians in this field based on the above invention content are also considered to fall within the scope of protection of the present application.

[0062] In the examples, the test methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified.

[0063] Example 1: Discovery of potato flesh color regulatory genes StMYB200 and StMYB210

[0064] In order to identify the genetic loci that regulate potato flesh color, this application selected 135 diploid potato materials and planted them in the experimental base. After the tubers matured, the phenotype of potato flesh color was evaluated. Among the 135 materials, 26 had red or purple flesh color, and 109 had white or yellow flesh color. Combined with the published genome resequencing data of these 135 materials, GWAS analysis of potato flesh color trait was performed, and a significant locus was identified at the end of chromosome 10, such as Figure 1 The previously identified anthocyanin regulatory site Pigmented tuber flesh (Pf) is closely linked to the D / I site located on chromosome 10, so the site identified in this application is also named Pf site.

[0065] According to the genome annotation information of the potato reference genome DM (v8.1), it was found that the Pf site identified in this application contains a MYB gene cluster near it, including 8 R2R3-MYB transcription factors: StMYB120, StMYB130, StMYB170, StMYB180, StMYB200, StMYB210, StMYB240 and StMYB270, as shown in Fig. Figure 2 At the same time, the present application conducted transcriptome sequencing analysis on the potato skin and potato flesh of the diploid potato material 01-58 with red skin and red flesh and the potato material RH89-039-16 (RH) with white skin and white flesh, and found that only StMYB200 and StMYB210 among the 8 R2R3-MYB transcription factors were highly expressed in red potato flesh, but almost not expressed in white potato flesh, such as Figure 3 This indicates that StMYB200 and StMYB210 may be candidate genes of the Pf locus, involved in the regulation of anthocyanin synthesis in potato flesh.

[0066] Example 2: Functional verification of StMYB200 and StMYB210 genes regulating anthocyanin accumulation in potato flesh

[0067] In order to verify whether StMYB200 and StMYB210 are involved in the regulation of anthocyanins in potato flesh, this application uses DM (v8.1) as the reference genome, and uses the CRISPRdirect online analysis website (https: / / crispr.dbcls.jp / ) to design sgRNA targets for StMYB200 and StMYB210 genes, respectively, with 2 designed for each gene; and the pCAMBIA2300MGFPuv-sgRNACas vector construction method (see Chinese Agricultural Science 2023, 56 (11): 2223-2236) was used to construct the StMYB200 and StMYB210 gene dual target knockout vectors StMYB200Cas and StMYB210Cas. The specific vector construction primer information sequence is as follows (the bold and underlined are sgRNA or its complementary sequence, and the rest are vector construction linker sequences):

[0068]

[0069] Plasmids StMYB200Cas and StMYB210Cas were transformed into red-skinned and red-fleshed diploid potato material 01-58 using Agrobacterium GV3101, and positive plants were screened. The positive plants obtained from the preliminary screening were PCR amplified and sequenced, and the mutation type of each strain was analyzed based on the sequencing results. Finally, a homozygous knockout mutant of StMYB200, StMYB200ko1, and two homozygous knockout mutants of StMYB210, StMYB210ko1 and StMYB210ko2, were obtained. Figure 4 shown.

[0070] The mutants obtained above were propagated in large quantities and planted in the experimental base, and wild-type potatoes WT (non-transgenic 01-58) were planted as a control. After the tubers matured, the phenotype of the tubers was investigated. Figure 5 As shown, compared with WT, the potato flesh of the StMYB200 knockout strain StMYB200ko1 and the StMYB210 knockout strains StMYB210ko1 and StMYB210ko2 changed from red to white, indicating that StMYB200 and StMYB210 are both involved in the regulation of anthocyanin accumulation in potato flesh. The lack of expression of either of them will result in the inability of potatoes to effectively accumulate anthocyanins and the potato flesh will turn white.

[0071] In addition, RNA was extracted from the 01-58, StMYB200ko1 and StMYB210ko1 lines for RNA-seq analysis, and it was found that the knockout of StMYB200 and StMYB210 had different degrees of influence on the expression of structural genes in the phenylpropanoid pathway ( Figure 6). In the knockout lines, except for F3'H, ANS-2 and ANS-3, the expression levels of structural genes such as CHS, CHI, F3H, F3'5'H, DFR, ANS-1 and ANS-4 related to the flavonoid metabolic pathway and genes related to the anthocyanin metabolic pathway were significantly downregulated. This further indicates that StMYB200 and StMYB210 are involved in the regulation of anthocyanin synthesis in potato flesh.

[0072] Example 3: Discovery of 1.7 kb Indel in the StMYB210 gene promoter

[0073] In order to further analyze the specific regulatory mechanism of StMYB200 and StMYB210, the present application selected the red-skinned and red-fleshed diploid potato material 01-58 to amplify the gene sequences of the two. The promoter sequence of the StMYB210 gene was significantly different between the two haplotypes, and there was an insertion deletion (Indel) of 1757 bp (1.7 kb) at the -34 bp position upstream of the start codon ATG, as shown in Figure 2. Figure 7 The specific 1757 bp (1.7 kb) insertion sequence is shown in SEQ ID NO.1.

[0074] Example 4: Development and verification of molecular markers for the 1.7 kb Indel in the promoter region of the StMYB210 gene

[0075] Based on the differences in the promoter region of the StMYB210 gene between the two haplotypes of 01-58, a pair of co-dominant marker primers were designed by selecting the conservative regions on both sides of the 1.7 kb Indel. The primer positions are as follows Figure 7 The primer sequences are shown below:

[0076]

[0077] The specific genotyping method is as follows:

[0078] (1) Extracting genomic DNA of the strain to be tested;

[0079] (2) Using the DNA extracted in step (1) as a template, using co-dominant molecular markers (StMYB210pro-Indel-F / -R) and GXL DNA Polymerase (Takara, R050Q) was used for PCR amplification. The specific reaction system is as follows:

[0080]

[0081]

[0082] The reaction procedure is as follows:

[0083]

[0084] (3) Using 1% agarose gel electrophoresis, the homozygous strain containing the 1.7 kb insertion showed a 2328 bp band, the homozygous strain without the 1.7 kb insertion showed a 570 bp band, and the heterozygous strain showed both 2328 bp and 570 bp bands.

[0085] The red-skinned and red-fleshed diploid potato material 01-58 contains the S-locus inhibitor (Sli) gene and can be self-fertilized to produce an F2 segregating population. In the F2 population, the color of the potato flesh is segregated, with white-skinned and white-fleshed lines and red-skinned and red-fleshed lines, such as Figure 8 a and Figure 8 b. The above-developed co-dominant molecular marker (StMYB210pro-Indel-F / -R) was further used to perform genotyping on the white-skinned and white-fleshed lines and the red-skinned and red-fleshed lines in the 01-58_F2 population according to the above system. It was found that the StMYB210 promoter region of the white-skinned and white-fleshed lines did not contain a 1.7 kb insertion, while the red-skinned and red-fleshed lines all contained a 1.7 kb insertion fragment, and some of the lines were homozygous insertions, such as Figure 8 c and Figure 8 d. This indicates that the co-dominant molecular marker (StMYB210pro-Indel-F / -R) is a pair of efficient and stable markers that can accurately identify the homozygous or heterozygous genotype of the 1.7 kb Indel in the StMYB210 promoter; it was also found that the 1.7 kb insertion in the 01-58_F2 population is necessary for the accumulation of anthocyanins in potato flesh.

[0086] Example 5: StMYB200 and StMYB210 activate StMYB210 by binding to the 1.7 kb insert in the StMYB210 promoter

[0087] In order to further clarify whether the 1.7 kb insertion in the StMYB210 promoter affects gene expression, the present application used the above co-dominant molecular marker (StMYB210pro-Indel-F / -R) to identify homozygous pf / pf lines without 1.7 kb insertion and homozygous Pf / Pf lines with 1.7 kb insertion from the 01-58_F2 population, and extracted RNA from the potato flesh of these lines for RT-qPCR analysis. Fig. 9As shown in the figure, the StMYB200 gene was expressed in both the pf / pf and Pf / Pf lines, but its expression level was higher in the Pf / Pf line than in the pf / pf line; while the StMYB210 and StDFR genes were normally expressed in the Pf / Pf line, but were almost not expressed in the pf / pf line. This indicates that the 1.7kb insertion in the StMYB210 promoter may lead to high expression of the StMYB210 gene in potato flesh, thereby activating the expression of the anthocyanin synthesis structural gene StDFR and accumulating anthocyanins in potato flesh.

[0088] The present application analyzed the 1.7 kb insertion sequence in the StMYB210 promoter and found that the sequence contained 10 repeat fragments, each of which was about 100 bp long and contained a MYB binding site (MBS2, ACCAA / ATCAAA); at the same time, the present application identified another 4 different types of MYB binding sites (MBS1, CAACGG) in the 1.7 kb insertion sequence, such as Fig.10 and Fig.11 Therefore, it is speculated that StMYB200 and StMYB210 may activate the expression of StMYB210 by binding to these MBSs elements.

[0089] In order to prove this speculation, the present application amplified the promoter of the StMYB210 gene from the pf / pf and Pf / Pf strains of the 01-58_F2 population, respectively, and recombined with the pGreenII0800-LUC vector as a reporter gene vector; at the same time, the coding regions of the StMYB200 and StMYB210 genes were amplified from the potato flesh of the Pf / Pf strain of the 01-58_F2 population, and an overexpression vector was constructed as an effector. The above vectors were transformed into Agrobacterium GV3101, respectively, and transiently co-transformed into Nicotiana benthamiana for a Dual-LUC test. The results showed that the Pf-StMYB210 promoter containing a 1.7kb insertion could be activated by StMYB200 or StMYB210, but both could not activate the pf-StMYB210 promoter without a 1.7kb insertion, such as Fig.12 a and Fig.12 b. The promoter sequence of the StMYB210 gene in the Pf / Pf strain is shown in SEQ ID NO: 6. The coding region sequence of StMYB200 is shown in SEQ ID NO: 7, and its amino acid sequence is shown in SEQ ID NO: 2. The coding region sequence of the StMYB210 gene is shown in SEQ ID NO: 8, and its amino acid sequence is shown in SEQ ID NO: 3.

[0090] The present application amplified the sequence containing MBS1 and MBS2 elements from the 1.7 kb insert fragment and recombined it with the pAbAi vector; at the same time, the coding regions of StMYB200 and StMYB210 genes were constructed into the pGADT7 vector for yeast one-hybrid assay. The results showed that both StMYB200 and StMYB210 could bind to the 1.7 kb insert sequence in the StMYB210 promoter, such as Fig.12 c and Fig.12 d. In addition, the present application synthesized probes according to the sequences of MBS1 and MBS2 elements, and recombined the coding regions of StMYB200 and StMYB210 genes into the prokaryotic expression vector pET-30a(+), induced the expression of the two proteins and performed EMSA experiments. The results showed that StMYB200 could bind to the MBS1 element, and StMYB210 could bind to both MBS1 and MBS2 elements, such as Fig.12 The above results preliminarily confirmed that StMYB200 and StMYB210 activated the expression of StMYB210 by binding to the 1.7 kb insertion fragment in the StMYB210 promoter, which significantly increased the accumulation of anthocyanins in potato flesh, thereby obtaining red-fleshed potatoes.

[0091] Example 6: Association analysis between potato flesh color and the 1.7 kb insert of the StMYB210 gene in 24 diploid potato germplasms

[0092] This application selected 24 diploid potato materials, of which 4 were wild species with white skin and white flesh, 11 were local varieties with yellow or white flesh, and 9 were local varieties with purple or red flesh, such as Fig.13 As shown in a. The StMYB210 promoter of the 24 materials was amplified using the codominant molecular marker (StMYB210pro-Indel-F / -R) developed above according to the above system, and it was found that the StMYB210 promoter of the 4 wild species did not contain the 1.7 kb insertion fragment; among the 11 yellow or white potato local varieties, 5 materials contained the 1.7 kb insertion fragment, and 6 materials did not contain the 1.7 kb insertion fragment; 9 purple or red potato local varieties all contained the 1.7 kb insertion fragment, of which 2 materials were 1.7 kb homozygous insertions, such as Fig.13 In addition, RNA was extracted from the 24 materials for semi-quantitative testing, and it was found that StMYB210 was expressed in all materials containing the 1.7 kb insertion fragment, such as Fig.13c. Therefore, it is believed that the 1.7kb insertion in the StMYB210 promoter is associated with the expression of the gene and the accumulation of anthocyanins in potato flesh, and potatoes with anthocyanin accumulation in potato flesh must have this insertion fragment. Potatoes with a 1.7kb insertion fragment but white or yellow potato flesh may be caused by the lack of expression of StMYB200 or other anthocyanin synthesis pathway genes.

[0093] Example 7: Identification and analysis of a 1.7 kb insert in the promoter of the StMYB210 gene in diploid potato germplasm

[0094] This application uses the above-developed codominant molecular marker (StMYB210pro-Indel-F / -R) to perform genotyping on 354 diploid potato materials (100 wild materials with colorless flesh, 211 local varieties with no anthocyanin accumulation in flesh, and 43 local varieties with anthocyanin accumulation in flesh) according to the above system. The results showed that the StMYB210 promoter of wild materials did not contain a 1.7 kb insert; more than half of the StMYB210 promoters of local varieties with no anthocyanin accumulation in flesh contained a 1.7 kb insert; the StMYB210 promoters of 43 local varieties with anthocyanin accumulation in flesh all contained a 1.7 kb insert, such as Fig.14 As shown. These results further prove from the perspective of natural populations that the presence of the 1.7kb insertion fragment in the StMYB210 promoter is associated with the accumulation of anthocyanins in potato flesh. Potatoes that accumulate anthocyanins in potato flesh must have this insertion fragment, which can be used as a reference for the breeding of anthocyanin-rich potato germplasm. Similarly, local varieties containing the 1.7kb insertion fragment but without anthocyanin accumulation in potato flesh may be caused by the lack of expression of StMYB200 or other anthocyanin synthesis pathway genes.

[0095] It should be noted that the specific parameters or some reagents in the above embodiments are specific embodiments or preferred embodiments under the conception of the present application, and are not intended to limit the present application; those skilled in the art may make adaptive adjustments within the conception and protection scope of the present application.

Claims

1. A nucleic acid molecule, characterized in that The nucleic acid sequence of the nucleic acid molecule is shown in SEQ ID NO:

1.

2. Use of the nucleic acid molecule according to claim 1 in regulating the accumulation of anthocyanins in potato flesh.

3. The use according to claim 2, characterized in that The nucleic acid molecule binds to the StMYB200 protein and / or the StMYB210 protein to promote the accumulation of anthocyanins in potato flesh.

4. The use according to claim 3, characterized in that The amino acid sequence of the StMYB200 protein is shown in SEQ ID NO:2, and the amino acid sequence of the StMYB210 protein is shown in SEQ ID NO:

3.

5. A primer pair, characterized in that: The sequences of the primer pair are shown in SEQ ID NO:4 and SEQ ID NO:

5.

6. Use of the primer pair according to claim 5 in at least one of the following: (1) Screening or identifying potato genotypes based on the nucleic acid molecule of claim 1; (2) Screening or identifying potato materials containing or not containing the nucleic acid molecule of claim 1; (3) Assisted potato breeding or variety improvement, or preparation of related products; (4) Cultivating potato varieties rich in or without anthocyanins, or preparing related products.

7. A kit, characterized in that: The kit contains reagents for detecting the nucleic acid molecule of claim 1.

8. A method for screening potato plants, characterized in that The method comprises: identifying whether the genome of the potato plant contains the nucleic acid molecule of claim 1.

9. A method for producing potatoes with anthocyanin-rich flesh, characterized in that: The method comprises: StMYB200 protein and StMYB210 protein are expressed in recipient potato plants. Preferably, the promoter region for expressing StMYB210 protein contains the nucleic acid molecule according to claim 1.

10. A method for producing potatoes without anthocyanins, characterized in that: The method comprises: Silencing the expression of StMYB200 and / or StMYB210 proteins in anthocyanin-rich receptor potato plants.

Images