Application of minor muscle nutritional protein domain 2-containing inhibitor in preparation of nerve growth promoting medicine

Abstract

The invention provides an application of an inhibitor containing 2 (dybindin domain containing 2, Dbndd2) in a small muscle nutritional protein domain in preparation of a medicine for promoting nerve growth, and a preparation method of the inhibitor containing 2 (dybindin domain containing 2, Dbndd2). The invention discloses that knock-down of Dbndd2 gene expression can promote neuronal axon growth and damaged nerve regeneration for the first time, which indicates that Dbndd2 can be used as a drug design target, and a Dbndd2 inhibitor can promote neuronal axon growth and is used for treating traumatic nerve injury and neurodegenerative diseases related to nerve injury.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the use of a dysbindin domain containing 2 (Dbndd2) inhibitor in the preparation of a drug for promoting nerve growth. Background Art

[0002] Traumatic nerve injury can cause damage to neuronal axons, resulting in interruption of nerve conduction, causing severe sensory and motor dysfunction, leading to complications such as pain, burning sensation, paresthesia, fibrosis and muscle atrophy, which seriously damage the patient's quality of life. In the pathological process of neurodegenerative diseases such as amyotrophic lateral sclerosis and glaucoma, neuronal axons also undergo significant structural and morphological changes. Analyzing the molecular mechanism of axon growth, exploring molecules that hinder axon regeneration, and using molecular inhibitors can promote the regeneration of damaged axons, which will help promote the recovery of neurodegenerative diseases related to traumatic nerve injury or axon injury.

[0003] Dorsal root ganglion (DRG) neurons are pseudo-monopolar neurons with peripheral processes projecting to peripheral nerves and central processes projecting to the spinal cord. After DRG neuron peripheral processes are damaged, the damaged axons can achieve a certain degree of functional recovery. However, DRG neuron central processes are difficult to regenerate after damage, causing serious sensory dysfunction. After DRG neuron peripheral processes are damaged, genes that show a downward trend in DRG and DRG neuron central processes are damaged, genes that show an opposite upward trend in DRG may hinder the regeneration of neuronal axons.

[0004] Dysbindin domain containing 2 (Dbndd2), also known as casein kinase-1 binding protein, is involved in the negative regulation of protein kinase activity. Studies have found that dysbindin domain containing 2 can reduce α-synuclein Ser129 phosphorylation and oligomerization, and reduce the level of insoluble α-synuclein by binding to casein kinase-1, and is an important potential target for delaying the progression of α-synuclein disease. At present, there are no reports on the role of dysbindin domain containing 2 in the process of nerve regeneration. Summary of the invention

[0005] The present invention analyzes the genes that show expression changes in DRG after peripheral and central processes of DRG neurons are damaged, and finds that in DRG, the gene Dbndd2 encoding the small dystrophin domain containing 2 is downregulated after peripheral process damage and upregulated after central process damage. By knocking down Dbndd2, it is found that reducing the gene expression of Dbndd2 can promote the growth of neuronal axons and the regeneration of damaged nerves, indicating that Dbndd2 inhibitors can be used to prepare drugs that promote nerve growth.

[0006] The specific technical solutions of the present invention are as follows: Application of dysbindin domain containing 2 (Dbndd2) inhibitors in the preparation of drugs promoting nerve growth.

[0007] The Dbndd2mRNA NCB1 Reference Sequence of the present invention: NM 001047111.2 (SEQ ID NO: 1).

[0008] In the application described in the present invention, the inhibitor is a negative regulator of the dystrophin domain-containing 2 protein or its encoding gene, including protein inhibitors targeting the dystrophin domain-containing 2 protein, nucleic acid aptamers and / or interfering RNA, gRNA, microRNA, small molecule compound inhibitors of the dystrophin domain-containing 2 encoding gene and inhibitors of the above combinations.

[0009] In a specific example of the present invention, the negative regulator is siRNA and / or vector-based shRNA targeting the dystrophin domain-containing 2 gene.

[0010] The sequence of the siRNA targeting the dystrophin domain-containing 2 gene is as follows: si-r-Dbndd2 001 positive strand: 5'GAAGUUCUUCGAGGACAUU 3', SEQ ID NO: 6; si-r-Dbndd2 001 antisense strand: 3'CUUCAAGAAGCUCCUGUAA 5', SEQ ID NO: 7; si-r-Dbndd2 002 positive strand: 5'GGUGGAAUUUAUUGACCUU 3', SEQ ID NO: 8; si-r-Dbndd2 002 antisense strand: 3'CCACCUUAAAUAACUGGAA 5', SEQ ID NO: 9; si-r-Dbndd2 003 positive strand: 5'GCAGUCCAAAUCCAAGUGA 3', SEQ ID NO: 10; si-r-Dbndd2 003 antisense strand: 3'CGUCAGGUUUAGGUUCACU 5', SEQ ID NO:11.

[0011] The shRNA comprises a sense strand segment, an antisense strand segment and a stem-loop structure connecting the sense strand segment and the antisense strand segment. The sequence is shown in SEQ ID No: 14.

[0012] In the application of the present invention, the nerve is a peripheral nerve, preferably a spinal nerve.

[0013] In a specific example of the present invention, the nerve is the sciatic nerve.

[0014] The drug of the present invention can promote axon growth and can be used for treating traumatic nerve injury or neurodegenerative diseases associated with axon injury.

[0015] Another object of the present invention is to provide a dystrophin domain-containing 2 inhibitor, which is a small interfering RNA or shRNA AAV virus of the dystrophin domain-containing 2 gene.

[0016] The present invention discovered the differentially expressed gene Dbndd2 in DRG after peripheral and central processes of rat DRG neurons were damaged by transcriptome sequencing, and verified it by tissue immunofluorescence staining experiments. It was found that Dbndd2 was downregulated after peripheral process damage of DRG neurons, and upregulated after central process damage ( Figure 1 ), suggesting that the different changes in the expression of Dbndd2 after peripheral and central process damage may be one of the reasons for the difference in axon regeneration ability after peripheral and central process damage of DRG neurons. By detecting the changes in Dbndd2 in DRG neurons of newborn and adult rats through single-cell sequencing, it was found that the expression of Dbndd2 decreased during development ( Figure 2 ), suggesting that Dbndd2 may have a role in promoting nerve growth during development. Primary neonatal rat DRG neurons were cultured and transfected with siRNA fragments targeting Dbndd2. It was found that Dbndd2 siRNA transfection could significantly reduce the expression of Dbndd2, indicating that Dbndd2 siRNA is an effective inhibitor of Dbndd2 ( Figure 3 A). Reduced expression of Dbndd2 significantly increased the axon length of DRG neurons in neonatal rats ( Figure 3 B and 3C). Transfection of siRNA fragments against Dbndd2 in primary adult rat DRG neurons also reduced the expression of Dbndd2 and significantly increased the axon length of adult rat DRG neurons ( Figure 4). DRG neurons of adult rats with knockdown of Dbndd2 still had longer axon lengths on a cell culture dish coated with myelin, an inhibitor of axon growth, compared with those transfected with control siRNA, indicating that reducing the expression of Dbndd2 is still beneficial to axon growth in an inhibitory microenvironment ( Figure 5 Using a microfluidic chamber to construct an in vitro DRG neuron axon injury model, it was found that knocking down the expression of Dbndd2 significantly accelerated the regeneration process of DRG neuron axons in adult rats after injury ( Figure 6 ). After intrathecal injection of AAV virus that knocked down the expression of Dbndd2 in adult rats, sciatic nerve injury was performed. It was found that knocking down the expression of Dbndd2 in rats was beneficial to the growth of damaged nerves ( Figure 7-Figure 8 ).

[0017] The Dbndd2 of the present invention can be directly used as a drug target to design drugs (inhibitors) that inhibit its expression. Through interaction with drugs, the expression of Dbndd2 in neurons is inhibited, thereby playing a role in regulating nerve growth.

[0018] Advantages of the present invention: The research results of the present invention show that the expression of Dbndd2 can be reduced by Dbndd2 inhibitors, thereby improving the ability of neuronal process growth and axon regeneration. Dbndd2 inhibitors can be used to treat traumatic nerve injury and neurodegenerative diseases related to axonal injury by promoting nerve growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The changes of Dbndd2 in DRG after peripheral and central processes of DRG neurons in adult rats were damaged. Figure 1 A shows the expression trend of Dbndd2 gene in DRG detected by transcriptome sequencing after peripheral and central processes of DRG neurons in adult rats were damaged. Figure 1 B is the expression of DBNDD2 protein in DRG after peripheral and central processes of DRG neurons in adult rats were damaged by tissue immunofluorescence.

[0020] Figure 2 The changes of Dbndd2 in DRG neurons of newborn and adult rats. The tSNE diagram shows the distribution of Dbndd2 in neuronal cells in the cell atlas of DRG tissues of newborn and adult rats detected by single-cell sequencing. Figure 1 B is the average expression level of Dbndd2 gene in DRG tissues of newborn red-skinned SD rats and adult SD rats detected by single-cell sequencing.

[0021] Figure 3 To investigate the effect of knocking down Dbndd2 on axon growth of DRG neurons in neonatal rats. Figure 3A shows the expression of Dbndd2 gene after transfection of control siRNA or Dbndd2 siRNA in primary cultured neonatal rat dorsal root ganglion neurons. Figure 3 B shows the results of Tuj1 staining of axons of DRG neurons in neonatal rats after transfection with control siRNA or Dbndd2 siRNA. The scale bar is 50 μm. Figure 3 C is the statistics of the longest and total lengths of DRG neuron axons in newborn rats).

[0022] Figure 4 The effect of knocking down Dbndd2 on axon growth of DRG neurons in adult rats. Figure 4 A shows the expression of Dbndd2 gene after transfection of control siRNA or Dbndd2 siRNA in primary cultured adult rat dorsal root ganglion neurons. Figure 4 B shows the results of Tuj1 staining of axons of DRG neurons in adult rats after transfection with control siRNA or Dbndd2 siRNA. The scale bar is 50 μm. Figure 4 C is the statistics of the longest and total lengths of DRG neuron axons in adult rats).

[0023] Figure 5 The effect of knocking down Dbndd2 on the axons of adult rat DRG neurons grown on culture dishes coated with myelin, an inhibitor of axon growth. Figure 5 A shows the results of Tuj1 staining of axons of adult rat DRG neurons on a myelin-coated dish after transfection with control siRNA or Dbndd2 siRNA. The scale bar is 50 μm. Figure 5 (B) Statistics of the longest and total lengths of DRG neuron axons in adult rats.

[0024] Figure 6 To investigate the effect of knocking down Dbndd2 on the regeneration of DRG neurons after axonal injury in adult rats. Figure 6 A shows the Tuj1 staining results of regenerated axons after lateral transection of the axon of adult rat DRG neurons transfected with control siRNA or Dbndd2 siRNA in the microfluidic cell culture system. The scale bar is 50 μm. Figure 6 B is the statistics of regenerated axon length).

[0025] Figure 7 The interference effect of control shRNA or Dbndd2shRNA AAV on Dbndd2 gene and the infection effect in neuronal cells in DRG tissue were observed in adult rats after intrathecal injection of control shRNA or Dbndd2shRNA AAV. Figure 7 A shows the expression of Dbndd2 gene in DRG tissue after intrathecal injection of control shRNA or Dbndd2 shRNA AAV in adult rats. Figure 7 B shows the expression of EGFP fluorescent tag protein in DRG tissue after intrathecal injection of control shRNA AAV in adult rats. Figure 7 C shows the expression of DBNDD2 protein in DRG tissue after intrathecal injection of Dbndd2shRNA AAV in adult rats.

[0026] Figure 8 This is the effect of intrathecal injection of Dbndd2shRNA AAV on axon regeneration after sciatic nerve injury in adult rats. Figure 8 A shows the staining result of SCG10, a marker of regenerated sensory nerve, in the sciatic nerve of rats after sciatic nerve injury. The scale bar is 1000 μm. Figure 8 B is the statistics of nerve regeneration length at the sciatic nerve 3 days after sciatic nerve injury). DETAILED DESCRIPTION The specific steps of the present invention are described below by way of examples, but are not limited to the examples.

[0028] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art.

[0029] The present invention is further described in detail below in conjunction with specific examples and with reference to data. It should be understood that this embodiment is only for illustrating the present invention and is not intended to limit the scope of the present invention in any way.

[0030] In the following examples, various processes and methods not described in detail are conventional methods well known in the art.

[0031] The present invention is further described below in conjunction with specific embodiments.

[0032] Example 1 Investigation of the relationship between DRG neuron damage and Dbndd2 in adult rats 1. Sciatic Nerve Injury of DRG Neurons in Adult Rats Adult Sprague Dawley rats were cut obliquely at the hip to expose the nerves, and the sciatic nerve was transected or clamped 1 cm above the bifurcation of the tibial nerve and the common peroneal nerve to establish a rat DRG neuron peripheral process injury model. Rats with only sciatic nerve exposure but no injury were selected as the peripheral process injury sham operation group.

[0033] Dorsal root root injury of DRG neurons in adult rats The dorsal root of DRG nerve axons in adult Sprague Dawley rats was exposed at the point where they entered the spinal cord, and then transected or crushed to establish a rat DRG neuron central process injury model. Rats in which only the dorsal root was exposed but not injured were selected as the peripheral process injury sham operation group.

[0034] Collection and sequencing of DRG tissue from adult rats One day after adult rats underwent peripheral or central process injury of DRG neurons or the corresponding sham operation group, DRG tissue was obtained, tissue RNA was extracted, and mRNA was separated and fragmented. cDNA was synthesized using mRNA as a template, and gene expression was quantified by transcriptome sequencing to analyze the changes in gene expression after peripheral or central process injury of DRG neurons.

[0035] Figure 1 A is the transcriptome sequencing analysis of the changes in the Dbndd2 gene in DRG tissue after peripheral or central processes of DRG neurons were damaged. The transcriptome sequencing results showed that compared with the sham operation group of DRG neurons, the expression of Dbndd2 gene in DRG tissue was significantly reduced one day after peripheral processes of DRG neurons were damaged. In contrast to the changes in Dbndd2 after peripheral processes of DRG neurons were damaged, compared with the sham operation group of DRG neurons, the expression of Dbndd2 gene in DRG tissue showed an up-regulated trend one day after central processes of DRG neurons were damaged.

[0036] The DRG tissue obtained above was taken, and after tissue fixation, it was embedded, sliced ​​and stained, incubated with DBNDD2 antibody, and then incubated with fluorescently labeled secondary antibody to detect the expression and localization of DBNDD2 protein in the DRG tissue.

[0037] Figure 1 B is the expression of DBNDD2 protein in DRG tissue after peripheral or central processes of DRG neurons were damaged by immunofluorescence staining. The results showed that the expression of DBNDD2 protein in DRG tissue decreased after peripheral processes of DRG neurons were damaged, while the expression increased after central processes of DRG neurons were damaged.

[0038] Example 2 Gene expression in neuronal cells in dorsal root ganglion tissues of newborn and adult rats Dorsal root ganglion tissues of newborn red skin and adult Sprague Dawley rats were obtained, digested with type I collagenase and trypsin, and the cell suspension was obtained after removing dead cells. The cell suspension was washed and resuspended with a PBS solution containing 0.04% BSA. The cell suspension was loaded on 10×Chromium, and barcode-labeled micromagnetic beads were added. The oil droplets were isolated to form GEMs and then recovered and transferred. After cell lysis, single-cell sequencing was performed using Illumina NovaSeq. The cell map was visualized using t-SNE nonlinear clustering, and the characteristic expression genes of each cell group were determined using the FindAllMarkers function to analyze the gene expression in neuronal cells in dorsal root ganglion tissues of newborn and adult rats.

[0039] Figure 2The expression of Dbndd2 gene in neurons of DRG of newborn and adult rats was detected by t-SNE nonlinear clustering. The results showed that the expression of Dbndd2 gene in neurons of dorsal root ganglia of newborn rats was lower than that in neurons of adult rats, indicating that the expression of Dbndd2 gene increased during development, suggesting that Dbndd2 may hinder the growth of neuronal axons.

[0040] Example 3 Effect of Dbndd2 siRNA on axon growth of rat neurons 1. Collection and Culture of Primary Neonatal Rat DRG Neurons DRG tissue of newborn red skin Sprague Dawley rats was taken, cut into small pieces, digested with collagenase, centrifuged, the pellet was resuspended, the cell suspension was placed in 15% BSA, and the pellet containing dorsal root ganglion neurons was obtained after centrifugation. Neonatal rat DRG neurons were cultured using Neurobasal medium containing B27 and L-glutamine.

[0041] Collection and culture of primary adult rat DRG neurons DRG tissues of adult Sprague Dawley rats were obtained, cut into small sections, digested with collagenase for 2 hours, digested with trypsin for 30 minutes, centrifuged, and the precipitate was resuspended in Neurobasal A medium containing B27 and L-glutamine, filtered with a cell strainer, and adult rat DRG neurons were inoculated in poly-L-lysine-coated culture dishes for culture.

[0042] Transfection of primary newborn and adult rat DRG neurons Press Lipofectamine TM RNAiMAX transfection reagent instructions: Dbndd2 siRNA was transfected into cultured primary newborn and adult DRG neurons to reduce the expression of Dbndd2 in neurons.

[0043] The inhibitor and inhibitor control of Dbndd2 were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. The Dbndd2 siRNA sequence used was: si-r-Dbndd2 001 positive strand: 5'GAAGUUCUUCGAGGACAUU 3', SEQ ID NO: 6; si-r-Dbndd2 001 antisense strand: 3'CUUCAAGAAGCUCCUGUAA 5', SEQ ID NO: 7; si-r-Dbndd2 002 positive strand: 5'GGUGGAAUUUAUUGACCUU 3', SEQ ID NO: 8; si-r-Dbndd2 002 antisense strand: 3'CCACCUUAAAUAACUGGAA 5', SEQ ID NO: 9; si-r-Dbndd2 003 sense strand: 5'GCAGUCCAAAUCCAAGUGA 3', SEQ ID NO:10; si-r-Dbndd2 003 antisense strand: 3'CGUCAGGUUUAGGUUCACU 5', SEQ ID NO:11.

[0044] The inhibitor control was a meaningless random sequence, the sense strand was 5'GGCUCUAGAAAAGCCUAUGC 3' (SEQ ID NO: 12), and the antisense strand was 3'CCGAGAUCUUUUCGGAUACG 5' (SEQ ID NO: 13).

[0045] Transfection reagent Lipofectamine TM RNAiMAX was produced by Invitrogen (Invitrogen, Carlsbad, CA, USA), and cell transfection was performed according to the instruction manual.

[0046] RNA from the primary DRG neuron cells cultured above was taken and reverse transcribed using Oligo dT primer. RT-PCR experiments were performed using Applied Biosystems Stepone real-time PCR System and SYBR Green Premix ExTaq. Pre-denaturation was performed at 95°C for 2 minutes; then 40 PCR cycles were performed at 95°C for 5 seconds and 60°C for 10 seconds. Gapdh was used as an internal reference to detect the Ct values ​​of the target gene Dbndd2 and the internal reference Gapdh, and the relative expression of Dbndd2 was calculated by the ΔΔCt method.

[0047] The primer sequences for the target gene Dbndd2 are as follows: Dbndd2(forward): 5'CGTCAGACAGGACCACATCC 3' (SEQ ID NO: 2).

[0048] Dbndd2(reverse): 5'TGTCTCCTCCCCCATCACTT 3' (SEQ ID NO: 3).

[0049] The primer sequences of the internal reference gene Gapdh are as follows: Gapdh (forward): 5'ACAGCAACAGGGTGGTGGAC 3' (SEQ ID NO: 4).

[0050] Gapdh(reverse): 5'TTTGAGGTGCAGCGAACTT 3' (SEQ ID NO: 5).

[0051] Figure 3 A is the expression of Dbndd2 detected by RT-PCR after DRG neurons of neonatal rats were transfected with control siRNA or Dbndd2 siRNA. The results showed that after DRG neurons of neonatal rats were transfected with Dbndd2 siRNA, the gene expression of Dbndd2 in neurons was significantly reduced, indicating that Dbndd2 siRNA can inhibit the gene expression of Dbndd2 in DRG neurons of neonatal rats and is an effective inhibitor of Dbndd2.

[0052] Figure 4 A is the expression of Dbndd2 detected by RT-PCR after DRG neurons of adult rats were transfected with control siRNA or Dbndd2 siRNA. The results showed that after DRG neurons of adult rats were transfected with Dbndd2 siRNA, the gene expression of Dbndd2 in neurons was significantly reduced, indicating that Dbndd2 siRNA can inhibit the gene expression of Dbndd2 in DRG neurons of adult rats.

[0053] 4. Neuronal Axon Growth Detection The newborn or adult rat DRG neurons transfected with the control siRNA or Dbndd2 siRNA were obtained, and the DRG neurons were inoculated into cell culture dishes. The cells were fixed after climbing the slides, and Tuj1 staining was performed by cell immunofluorescence to observe the length of Tuj1-labeled neuronal axons and detect the effect of Dbndd2 inhibitor on neuronal axon growth.

[0054] Figure 3 B is a representative image of Tuj1 staining of DRG neurons of neonatal rats transfected with control siRNA or Dbndd2 siRNA (scale bar, 50 μm). Figure 3 C is the longest and total length of axons of neonatal rat DRG neurons transfected with control siRNA or Dbndd2 siRNA. The results showed that after transfection with Dbndd2 siRNA, the longest and total length of axons of neonatal rat DRG neurons increased significantly, indicating that Dbndd2 inhibitors can promote the growth of axons of neonatal rat DRG neurons.

[0055] Figure 4B is a representative image of Tuj1 staining of adult rat DRG neurons transfected with control siRNA or Dbndd2 siRNA (scale bar, 50 μm). Figure 4 C is the longest and total length of axons of adult rat DRG neurons transfected with control siRNA or Dbndd2 siRNA. The results showed that after transfection with Dbndd2 siRNA, the longest and total length of axons of adult rat DRG neurons increased significantly, indicating that Dbndd2 inhibitors can promote the growth of axons of adult rat DRG neurons.

[0056] 5. Axonal Growth Assay of Neurons on Myelin-Coated Cell Culture Dishes Myelin, an axon growth inhibitor, was extracted from adult rat nerve tissue, and myelin was used to coat cell culture dishes. DRG neurons of adult rats transfected with control siRNA or Dbndd2 siRNA were taken, and the DRG neurons were inoculated into myelin-coated cell culture dishes, and the cells were fixed after climbing the slices, and Tuj1 staining was performed by cell immunofluorescence to observe the length of Tuj1-labeled neuronal axons, and to detect the effect of Dbndd2 inhibitor on neuronal axons growing on myelin-coated cell culture dishes.

[0057] Figure 5 A is a representative image of Tuj1 staining of adult rat DRG neurons transfected with control siRNA or Dbndd2 siRNA on myelin-coated cell culture dishes (scale bar, 50 μm). Figure 5 B is the longest and total length of axons of adult rat DRG neurons transfected with control siRNA or Dbndd2 siRNA on myelin-coated cell culture dishes. The results showed that after transfection with Dbndd2 siRNA on myelin-coated cell culture dishes, the longest and total length of axons of adult rat DRG neurons increased significantly, indicating that Dbndd2 inhibitors can promote the growth of axons of adult rat DRG neurons in the inhibitory microenvironment of myelin.

[0058] 6. Detection of regeneration of damaged axons of neurons Adult rat neurons were inoculated in a microfluidic cell culture system. After the axons of dorsal root ganglion neurons grew to the axon side, the axons were cut off by vacuum suction to prepare an in vitro dorsal root ganglion neuron axotomy model. Tuj1 staining was performed by cell immunohistochemistry, and the length of Tuj1-labeled neuronal axons regenerated after injury was observed on the axon side of the microfluidic cell culture system to detect the regeneration of neuronal axons.

[0059] Figure 6A is a representative Tuj1 staining image of regenerating axons after axon injury in adult rat DRG neurons transfected with control siRNA or Dbndd2 siRNA in a microfluidic cell culture system (scale bar, 50 μm). Figure 6 B is the length of regenerated axons in adult rat DRG neurons transfected with control siRNA or Dbndd2 siRNA after axon injury. The results showed that after transfection with Dbndd2 siRNA, the regenerated length of adult rat DRG neurons after axon injury became longer, indicating that Dbndd2 inhibitors can promote the regeneration of damaged axons in adult rat DRG neurons.

[0060] Example 4 Effect of Dbndd2 shRNA on sciatic nerve regeneration in adult rats Adult Sprague Dawley rats were cut open along the midline of the back with surgical scissors at the L4-L6 segment, and the muscles of the lumbar spinous processes on both sides were cut open with ophthalmic scissors to expose the intervertebral space. A microinjection pump was used to perform intrathecal injection of control shRNA virus (pAAV-U6-shRNA (NC)-CMV-EGFP-WPRE) or Dbndd2 shRNA virus (pAAV-U6-shRNA (Dbndd2)-CMV-EGFP-WPRE). The viruses used were packaged by Shanghai Heyuan Biotechnology Co., Ltd. The shRNA sequence selected for packaging AAV virus is shown in SEQ ID NO: 14.

[0061] Figure 7 A shows the expression of Dbndd2 gene and protein in DRG tissue by RT-PCR and tissue immunofluorescence staining 21 days after intrathecal injection of control shRNA virus or Dbndd2 shRNA AAV virus in adult rats. The results showed that after intrathecal injection of Dbndd2 shRNA AAV virus in adult rats, the gene and protein expression of Dbndd2 in DRG tissue decreased, indicating that Dbndd2 shRNA AAV virus is an effective inhibitor of Dbndd2.

[0062] Figure 8 A shows the results of staining of SCG10, a marker of regenerated sensory nerve, in adult rats 21 days after intrathecal injection of control shRNA virus or Dbndd2 shRNA AAV virus. The sciatic nerve was injured and samples were collected by perfusion 3 days later (scale bar, 1000 μm). Figure 8B is the length of damaged nerve regeneration in adult rats that were intrathecally injected with control shRNA virus or Dbndd2shRNA AAV virus 3 days after sciatic nerve injury. The results showed that after Dbndd2 shRNA AAV virus was intrathecally injected into adult rats to knock down the gene expression of Dbndd2, the regeneration length of damaged sciatic nerve became longer, indicating that Dbndd2 inhibitors can promote the regeneration of damaged nerves in adult rats.

Claims

1. Application of dystrophin domain 2 inhibitors in the preparation of drugs that promote nerve growth.

2. The use according to claim 1, characterized in that The inhibitor is a negative regulator of the dystrophin domain-containing 2 protein or its encoding gene.

3. The use according to claim 2, characterized in that The negative regulators include protein inhibitors targeting dystrophin domain-containing 2 protein, nucleic acid aptamers and / or interfering RNA, gRNA, microRNA, small molecule compound inhibitors and inhibitors of the above combinations.

4. The use according to claim 3, characterized in that The negative regulator is a siRNA and / or a vector-based shRNA targeting the dystrophin domain-2 gene.

5. The use according to claim 4, characterized in that The siRNA sequence targeting the dystrophin domain-containing 2 gene is as follows: si-r-Dbndd2 001 positive strand: 5'GAAGUUCUUCGAGGACAUU 3', SEQ ID NO: 6; si-r-Dbndd2 001 antisense strand: 3'CUUCAAGAAGCUCCUGUAA 5', SEQ ID NO: 7; si-r-Dbndd2 002 positive strand: 5'GGUGGAAUUUAUUGACCUU 3', SEQ ID NO: 8; si-r-Dbndd2 002 antisense strand: 3'CCACCUUAAAUAACUGGAA 5', SEQ ID NO: 9; si-r-Dbndd2 003 positive strand: 5'GCAGUCCAAAUCCAAGUGA 3', SEQ ID NO: 10; si-r-Dbndd2 003 antisense strand: 3'CGUCAGGUUUAGGUUCACU 5', SEQ ID NO: 11; The shRNA comprises a sense strand segment, an antisense strand segment and a stem-loop structure connecting the sense strand segment and the antisense strand segment, and the sequence is shown in SEQ ID No:

14.

6. The use according to claim 1, characterized in that The nerves are peripheral nerves.

7. The use according to claim 6, characterized in that The nerve is a spinal nerve.

8. The use according to claim 7, characterized in that The nerve is the sciatic nerve.

9. The use according to claim 1, characterized in that The medicine is a medicine for treating nerve damage or neurodegenerative diseases related to nerve damage.

10. A dystrophin domain 2 inhibitor, characterized in that AAV virus containing small interfering RNA or shRNA for the dystrophin domain 2 gene.

Images