RNA interference fragment combination for inhibiting Sclerotinia sclerotiorum SsTOR gene expression, application and method

Abstract

The invention discloses an RNA interference fragment combination for inhibiting sclerotinia sclerotiorum SsTOR gene expression, application and a method. The invention provides an RNA interference fragment combination. The RNA interference fragment combination contains at least one of a combination 1, a combination 2 and a combination 3. The nucleotide sequences of the RNA interference fragment in the combination 1 are as shown in SEQ ID NO: 1 and SEQ ID NO: 3; the nucleotide sequences of the RNA interference fragment in the combination 2 are as shown in SEQ ID NO: 5 and 6; the nucleotide sequences of the RNA interference fragment in the combination 3 are shown as SEQ ID NO: 8 and SEQ ID NO: 9. According to the method, the RNA interference fragment of the characteristic sequence of the target sclerotinia sclerotiorum TOR gene (SsTOR) is designed and is introduced into the genomes of arabidopsis thaliana and rape; in the sclerotinia sclerotiorum infection process, the expression of the SsTOR gene is inhibited, the infection process is blocked, and arabidopsis and rape varieties with strong sclerotinia rot resistance are obtained.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an RNA interference fragment combination, application and method for inhibiting the expression of SsTOR gene of Sclerotinia sclerotiorum. Background Art

[0002] Sclerotinia is the number one disease of rapeseed, known as the "cancer" of rapeseed, which seriously endangers the safety of oilseeds in my country. Sclerotinia is caused by Sclerotinia sclerotiorum, which can infect more than 400 species in 208 genera of 75 families, including Cruciferae, Leguminosae and Solanaceae. Sclerotinia spores first infect the petals. After the petals fall to the leaves, the hyphae further infect the leaves and infect the entire plant through the vascular tissue, causing the plant to rot, and eventually forming black sclerotia in the stems and siliques; Sclerotinia sclerotiorum sclerotia can overwinter in the soil for the next round of infection.

[0003] At present, some rapeseed varieties with good resistance to sclerotinia have been widely promoted, such as Zhongyou 821, Zhongshuang 11, Zhongyouza 39, Zhongyouza 19 and Zhongyouza 501, but no rapeseed germplasm resources immune to sclerotinia have been found. Recently, through genome-wide association analysis of rapeseed germplasm resources, Chinese scientists have cloned some genetic loci related to sclerotinia resistance, including BnaA05.RLK902 1 and BnaA07.MKK9 2 Creating rapeseed varieties with high resistance to Sclerotinia sclerotiorum is an important means to ensure the safety of oilseeds in my country, but it is difficult to achieve this in a short period of time through traditional breeding methods.

[0004] The use of host-induced gene silencing (HIGS) technology to control plant diseases is currently a popular research method that can quickly enhance plant disease resistance. Design RNA interference fragments that target specific genes of pathogens (pathogenic microorganisms or pathogenic insects), introduce interference fragments into plants through transgenic methods, and produce small interfering RNAs in plants; after the invasion or feeding of pathogens, these small interfering RNAs are absorbed by the pathogens and specifically bind to the mRNA of the target gene, inducing the degradation of the mRNA, thereby inhibiting the expression of important genes of the pathogen and weakening its pathogenicity. The effectiveness of this method has been widely verified in Arabidopsis and many economic crops.

[0005] Target of Rapamycin TOR (Target of Rapamycin) is a serine / threonine protein kinase with very conserved functions in eukaryotes. It regulates cell proliferation and growth by integrating nutrition, hormones and energy signals, and is the main regulator of eukaryotic growth and development. In the genome of S. sclerotiorum, there is a homologous protein similar to the Saccharomyces cerevisiae TOR kinases Tor1 (47.25%) and Tor2 (48.7%), which is SsTOR. The SsTOR-silenced strain showed a significant decrease in hyphal growth rate, abnormal development of sclerotia and infection pads, and significantly decreased pathogenicity. SsTOR regulates cell growth, stress response, cell wall integrity, autophagy and pathogenicity (Jiao Wenli. Study on the mechanism of sclerotinia development and pathogenicity mediated by the autophagy protein kinase SsAtg1 in Sclerotinia cells [D]. Jilin University, 2023. DOI: 10.27162 / d.cnki.gjlin.2023.000359.). Therefore, it is crucial to cultivate disease-resistant plants that target and inhibit SsTOR expression, but there is still a lack of relevant plant varieties that are effectively resistant to diseases. Summary of the invention

[0006] The purpose of the present invention is to overcome the above-mentioned deficiencies of the prior art and to provide a combination, application and method of RNA interference fragments for inhibiting the expression of the SsTOR gene of Sclerotinia sclerotiorum.

[0007] The invention determines specific target fragments (F1, F2 and F3) on the SsTOR gene of Sclerotinia sclerotiorum, designs RNA interference fragments, inhibits the expression of the SsTOR gene of Sclerotinia sclerotiorum, and blocks the infection of Sclerotinia sclerotiorum to plants.

[0008] The first object of the present invention is to provide an RNA interference fragment combination.

[0009] The second object of the present invention is to provide a recombinant expression vector.

[0010] The third object of the present invention is to provide the use of the RNA interference fragment combination or the recombinant expression vector in improving plant resistance to Sclerotinia sclerotiorum, cultivating Sclerotinia sclerotiorum-resistant plants and / or preventing and controlling plant Sclerotinia sclerotiorum diseases.

[0011] The fourth object of the present invention is to provide a method for inhibiting the expression of SsTOR gene in Sclerotinia sclerotiorum.

[0012] A fifth object of the present invention is to provide a method for improving plant resistance to Sclerotinia sclerotiorum.

[0013] A sixth object of the present invention is to provide a method for cultivating plants resistant to Sclerotinia sclerotiorum.

[0014] The seventh object of the present invention is to provide a method for preventing and controlling plant sclerotinia disease.

[0015] In order to achieve the above object, the present invention is implemented by the following scheme:

[0016] The present invention provides an RNA interference fragment combination, wherein the RNA interference fragment combination comprises at least one of combination 1, combination 2 and combination 3;

[0017] The nucleotide sequences of the RNA interference fragments in combination 1 are shown in SEQ ID NOs: 1 and 3;

[0018] The nucleotide sequences of the RNA interference fragments in combination 2 are shown in SEQ ID NOs: 5 and 6;

[0019] The nucleotide sequences of the RNA interference fragments in combination 3 are shown in SEQ ID NOs: 8 and 9.

[0020] The invention provides a recombinant expression vector, which contains the RNA interference fragment combination.

[0021] In a specific embodiment of the present invention, the nucleotide sequence of the recombinant expression vector containing the RNA interference fragment combination 1 is shown as SEQ ID NO: 4, the nucleotide sequence of the recombinant expression vector containing the RNA interference fragment combination 2 is shown as SEQ ID NO: 7, and the nucleotide sequence of the recombinant expression vector containing the RNA interference fragment combination 3 is shown as SEQ ID NO: 10.

[0022] The present invention provides the use of the RNA interference fragment combination or the recombinant expression vector in improving the resistance of plants to Sclerotinia sclerotiorum, cultivating Sclerotinia sclerotiorum-resistant plants and / or preventing and controlling Sclerotinia sclerotiorum diseases of plants.

[0023] Furthermore, the RNA interference fragment combination or the recombinant expression vector inhibits the expression of the SsTOR gene of Sclerotinia sclerotiorum.

[0024] In a specific embodiment of the present invention, Arabidopsis thaliana or rapeseed are used as examples to conduct strain infection experiments to prove that the expression of the SsTOR gene is inhibited, thereby blocking the infection process of Sclerotinia sclerotiorum. Furthermore, experiments are conducted using Arabidopsis thaliana Col-0 ecotype and Zhongshuang 11 rapeseed variety as examples.

[0025] The present invention provides a method for inhibiting the expression of SsTOR gene of Sclerotinia sclerotiorum, and the expression of SsTOR gene of Sclerotinia sclerotiorum is inhibited by using the RNA interference fragment combination or the recombinant expression vector.

[0026] The present invention provides a method for improving the resistance of plants to Sclerotinia sclerotiorum, using the RNA interference fragment combination or the recombinant expression vector according to claim 2 to inhibit the expression of the SsTOR gene of Sclerotinia sclerotiorum in plants.

[0027] The invention provides a method for cultivating plants resistant to Sclerotinia sclerotiorum, wherein the RNA interference fragment combination or the recombinant expression vector is used to inhibit the expression of the SsTOR gene of Sclerotinia sclerotiorum in plants.

[0028] Furthermore, the RNA interference fragment combination or the recombinant expression vector is expressed in plants.

[0029] Furthermore, the plant is Arabidopsis thaliana or rapeseed.

[0030] In a specific embodiment of the present invention, Arabidopsis thaliana or rapeseed are used as examples to conduct strain infection experiments to prove that the expression of the SsTOR gene is inhibited, thereby blocking the infection process of Sclerotinia sclerotiorum. Further, Arabidopsis thaliana Col-0 ecotype and Zhongshuang 11 rapeseed variety are used as examples to conduct experiments.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] This method designs an RNA interference fragment targeting the characteristic sequence of the TOR gene (SsTOR) of Sclerotinia sclerotiorum, and introduces the RNA interference fragment into the genome of Arabidopsis thaliana and rapeseed by transgenic means; during the infection of Sclerotinia sclerotiorum, the small interfering RNA is absorbed by Sclerotinia sclerotiorum, inhibiting the expression of the SsTOR gene, thereby blocking the infection process, and obtaining Arabidopsis thaliana and rapeseed varieties with strong resistance to sclerotinia. After infection with Sclerotinia sclerotiorum, wild-type Arabidopsis thaliana and rapeseed plants are infected or even die, while the transgenic Arabidopsis thaliana and rapeseed plants cultivated by the present invention still grow well and have strong resistance to Sclerotinia sclerotiorum. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Schematic diagram of the principle of designing RNA interference vectors for selecting target fragments on the TOR gene.

[0034] Figure 2 The position of the F1 target fragment on the TOR gene coding sequence.

[0035] Figure 3 It is a pUC57 vector containing the F1 interference fragment expression cassette.

[0036] Figure 4 This is the structure diagram of the RNA interference vector pC1300-SsTOR-RNAi1.

[0037] Figure 5 The PCR and double enzyme digestion verification diagrams of the RNA interference vector pC1300-SsTOR-RNAi1. A is PCR verification; B is double enzyme digestion verification.

[0038] Figure 6 This is a PCR verification diagram of Arabidopsis transgenic plants constructed using the RNA interference vector pC1300-SsTOR-RNAi1.

[0039] Figure 7 The experimental results of Arabidopsis transgenic plants constructed with RNA interference vector pC1300-SsTOR-RNAi1 for infection with Sclerotinia sclerotiorum. The scale bar is 2 cm.

[0040] Figure 8 This is the PCR verification diagram of rapeseed transgenic plants constructed using the RNA interference vector pC1300-SsTOR-RNAi1.

[0041] Fig. 9 The experimental results of the leaves of rapeseed transgenic plants constructed with RNA interference vector pC1300-SsTOR-RNAi1 infected by Sclerotinia sclerotiorum, the scale bar is 2 cm. A is the ZS11 wild type; B is the SsTOR-BnRNAi1-#1 transgenic rapeseed line; C is the SsTOR-BnRNAi1-#2 transgenic rapeseed line; D is the SsTOR-BnRNAi1-#3 transgenic rapeseed line

[0042] Fig.10 The experimental results of the stems of rapeseed transgenic plants constructed with RNA interference vector pC1300-SsTOR-RNAi1 infected by Sclerotinia sclerotiorum. A shows the growth of plants, with a scale bar of 5 cm; B shows the stems infected by Sclerotinia sclerotiorum, with a scale bar of 2 cm.

[0043] Fig.11 The position of the F2 target fragment on the TOR gene coding sequence.

[0044] Fig.12 This is the structure diagram of the RNA interference vector pC1300-SsTOR-RNAi2.

[0045] Fig.13 This is a PCR verification diagram of Arabidopsis transgenic plants constructed using the RNA interference vector pC1300-SsTOR-RNAi2.

[0046] Fig.14 The experimental results of Arabidopsis transgenic plants constructed with RNA interference vector pC1300-SsTOR-RNAi2 for infection with Sclerotinia sclerotiorum. The scale bar is 2 cm.

[0047] Fig.15 This is the PCR verification diagram of rapeseed transgenic plants constructed using the RNA interference vector pC1300-SsTOR-RNAi2.

[0048] Fig.16The experimental results of the leaves of rapeseed transgenic plants constructed with RNA interference vector pC1300-SsTOR-RNAi2 infected by Sclerotinia sclerotiorum, the scale bar is 2 cm. A is the wild type ZS11; B is the SsTOR-BnRNAi2-#1 transgenic rapeseed line; C is the SsTOR-BnRNAi2-#2 transgenic rapeseed line; D is the SsTOR-BnRNAi2-#3 transgenic rapeseed line.

[0049] Fig.17 The experimental results of the stems of rapeseed transgenic plants constructed with RNA interference vector pC1300-SsTOR-RNAi2 infected by Sclerotinia sclerotiorum. A shows the growth of plants, with a scale bar of 5 cm; B shows the stems infected by Sclerotinia sclerotiorum, with a scale bar of 2 cm.

[0050] Fig.18 The position of the F3 target fragment on the TOR gene coding sequence.

[0051] Fig.19 This is the structure diagram of the RNA interference vector pC1300-SsTOR-RNAi3.

[0052] Fig. 20 This is a PCR verification diagram of Arabidopsis transgenic plants constructed using the RNA interference vector pC1300-SsTOR-RNAi3.

[0053] Fig.21 The experimental results of Arabidopsis transgenic plants constructed with RNA interference vector pC1300-SsTOR-RNAi3 for infection with Sclerotinia sclerotiorum. The scale bar is 2 cm.

[0054] Fig. 22 This is a PCR verification diagram of rapeseed transgenic plants constructed using the RNA interference vector pC1300-SsTOR-RNAi3.

[0055] Fig.23 The experimental results of the leaves of rapeseed transgenic plants constructed with RNA interference vector pC1300-SsTOR-RNAi3 infected by Sclerotinia sclerotiorum, the scale bar is 2 cm. A is the ZS11 wild type; B is the SsTOR-BnRNAi3-#1 transgenic rapeseed line; C is the SsTOR-BnRNAi3-#2 transgenic rapeseed line; D is the SsTOR-BnRNAi3-#3 transgenic rapeseed line. DETAILED DESCRIPTION

[0056] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0057] Example 1 Construction of RNA interference vector pC1300-SsTOR-RNAi1

[0058] The gene number of the Sclerotinia TOR gene (SsTOR) is sscle_02g011660, the Gene ID is 5482223, and the full length of the coding sequence is 7293 bp. Figure 1 As shown, the target fragment is selected on the TOR gene to design an RNA interference fragment vector, thereby inhibiting the expression of the TOR gene and blocking the infection process of Sclerotinia sclerotiorum. The nucleotide sequence of the F1 target fragment is shown in SEQ ID NO: 1, with a length of 300 bp (5553-5852), and the position of the F1 target fragment on the TOR gene is shown in Figure 2 shown.

[0059] 1. Design and synthesize an expression cassette containing the F1 interference fragment. The structure of the expression cassette is as follows: Figure 3 The nucleotide sequence of the expression cassette is shown in SEQ ID NO:2.

[0060] like Figure 3 As shown, the expression cassette includes Hind III restriction site, Asc I restriction site, 35S promoter, BamH I restriction site, SbfI restriction site, reverse F1 interference fragment (SEQ ID NO: 3), Sac I restriction site, the fourth intron of Arabidopsis Action8 gene, Sal I restriction site, Pac I restriction site, forward F1 interference fragment (SEQ ID NO: 1), Knp I restriction site, Xba I restriction site, NOS terminator and EcoR I restriction site from 5' end to 3' end. The entire expression cassette is connected between the upper Hind III restriction site and EcoR I restriction site of the pUC57 vector to obtain the pUC57 vector containing the F1 interference fragment.

[0061] 2. Design of expression vector containing F1 interference fragment

[0062] The pCambia1300 vector and the pUC57 vector containing the F1 interference fragment constructed in step 1 were double-digested with restriction endonucleases Hind III and EcoR I, respectively, and the digestion products were purified and recovered to obtain the pCambia1300 vector digestion product and the F1 interference fragment digestion product. The pCambia1300 vector digestion product and the F1 interference fragment digestion product were ligated with T4 DNA ligase to obtain an expression vector containing the F1 interference fragment, named pC1300-SsTOR-RNAi1 (SEQ ID NO: 4), as shown in FIG. Figure 4 shown.

[0063] 3. PCR verification of RNA interference vector pC1300-SsTOR-RNAi1

[0064] Reaction system (20 μL): 10 μL Dream Taq TM PCR Master Mix, 7.5 μL water, 1 μL M13F primer (10 μM / L), 1 μL AtActin8-R primer (10 μM / L) and 0.5 μL RNA interference vector pC1300-SsTOR-RNAi1.

[0065] The nucleotide sequence of the M13F primer is: GTAAAACGACGGCCAGT; the nucleotide sequence of the AtActin8-R primer is: GTAAACCATTAGAGGAGTTG.

[0066] Reaction conditions: 95°C for 2 min; 95°C for 30 s, 55°C for 30 s, 72°C for 2 min (35 cycles); 72°C for 5 min.

[0067] The length of the PCR amplification product is 1327 bp, including the 35S promoter and the reverse F1 interference fragment. Figure 5 As shown in A, the size of the PCR amplification product is between 1000bp and 1500bp of the DNA marker.

[0068] (4) Double enzyme digestion verification of RNA interference vector pC1300-SsTOR-RNAi1

[0069] The RNA interference vector pC1300-SsTOR-RNAi1 was double-digested with restriction endonucleases Hind III and Xba I to obtain two fragments. The smaller fragment was 1669 bp in length and was the expression cassette that did not contain the NOS terminator. Figure 5 As shown in B, the fragment size is between DNA marker 1500 bp and 2000 bp.

[0070] Example 2 Construction of transgenic Arabidopsis thaliana using RNA interference vector pC1300-SsTOR-RNAi1 and verification of resistance to Sclerotinia sclerotiorum

[0071] 1. Experimental Methods

[0072] 1. Transfer the RNA interference vector pC1300-SsTOR-RNAi1 of Example 1 into Agrobacterium.

[0073] (1) Mix 1 μL of RNA interference vector pC1300-SsTOR-RNAi1 with 50 μL of Agrobacterium GV3101 competent cells to obtain a mixed solution.

[0074] (2) The mixed solution of step (1) was placed in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and placed on ice for 5 min.

[0075] (3) Add 500 μL LB liquid culture medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) to the mixed solution treated in step (2), and culture in a shaker at 28°C for 1 hour to obtain a culture solution.

[0076] (4) Spread the culture solution of step (3) on LB solid medium containing kanamycin (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder and 50 mg / L kanamycin), culture in a 28°C incubator for 2 days, preserve the bacterial plaques, and obtain Agrobacterium culture solution.

[0077] 2. Construction of transgenic Arabidopsis

[0078] (1) 1 mL of Agrobacterium culture was cultured in 200 ml of LB liquid medium containing 50 mg / L rifampicin, 50 mg / L gentamicin and 50 mg / L kanamycin for 24 h.

[0079] (2) The Agrobacterium cultured in step (1) was centrifuged at 4000 g / min for 10 min, the supernatant was discarded, and 200 ml of 1 / 2MS transformation solution [2.2 g / L MS powder, 50 g / L sucrose, 0.02% silwet-L77 (v / v)] was added and mixed evenly to obtain Agrobacterium culture treated with the transformation solution.

[0080] (3) Soak flowering Col-0 Arabidopsis in the Agrobacterium solution treated with the transformation solution in step (3) for 1 min, dry the liquid on the surface of Col-0 Arabidopsis with absorbent paper, place in the dark for 12 h, grow in a greenhouse (22°C, 16 h light / 8 h dark) until maturity, and collect seeds.

[0081] (4) Dry the seeds in a 37°C incubator for 24 h, sterilize the seeds with 70% (v / v) alcohol for 5 min, and then dry the seeds in a clean bench.

[0082] (5) The seeds treated in step (4) were evenly spread on 1 / 2MS solid medium (2.2 g / L MS powder, 10 g / L sucrose, 8 g / L agar powder) containing 50 mg / L hygromycin, placed at 4°C for 2 days, and grown in an incubator for 7 days (22°C, 16 h light / 8 h dark) to obtain transgenic Arabidopsis seedlings.

[0083] 3. Extract the leaf genome of transgenic Arabidopsis seedlings as a DNA template for PCR identification.

[0084] Reaction system (20 μL): 10 μL DreamTaq TM PCR Master Mix, 7.5 μL water, 1 μL RNAi-F primer (10 μM / L), 1 μL RNAi-R primer (10 μM / L) and 1 μL DNA template (10 ng / μL).

[0085] The nucleotide sequence of RNAi-F primer is: GACCTGATGCAGCTCTCGR; the nucleotide sequence of RNAi-R primer is: ACAGATCCGGTCGGCATCTAC.

[0086] Reaction conditions: 95°C for 2 min, 95°C for 30 s, 55°C for 30 s, 72°C for 1 min (35 cycles), 72°C for 5 min.

[0087] 4. Transgenic Arabidopsis was cultured to the T2 generation, and three transgenic Arabidopsis lines were selected for the Sclerotinia infection experiment, which were named SsTOR-At RNAi1-#1, SsTOR-AtRNAi1-#2 and SsTOR-AtRNAi1-#3. Sclerotinia (provided by the China Agricultural Microbiological Culture Collection Administration Center, strain number ACCC 37700) was cultured on PDA (27g / L potato sucrose water and 15g / L agar powder) medium for 3 days, and agar blocks containing Sclerotinia hyphae were punched out on the medium with a cork puncher. One-month-old wild-type and transgenic Arabidopsis plants were placed in a tray, and the agar blocks were inoculated on Arabidopsis leaves. The tray was then sealed with plastic wrap to prevent the agar blocks from losing water, and Sclerotinia-infected Arabidopsis was obtained. The Sclerotinia-infected Arabidopsis was cultured in an incubator (22°C, 16h light / 8h dark) for 3-5 days, and the infection of Sclerotinia was observed.

[0088] 2. Experimental Results

[0089] The PCR amplified fragment is a partial fragment of the hygromycin resistance gene, with a size of 969 bp. Figure 6 As shown, the fragment size is around 1000 bp.

[0090] like Figure 7 As shown, 3 days after Sclerotinia infection, both wild-type and transgenic Arabidopsis had leaf infection, but the growth of transgenic Arabidopsis was significantly better than that of the wild type; 5 days after Sclerotinia infection, the wild-type Arabidopsis had died, while some leaves of transgenic Arabidopsis were still not infected by Sclerotinia, indicating that the resistance of transgenic Arabidopsis to Sclerotinia was significantly higher than that of wild-type Arabidopsis.

[0091] Example 3 Construction of transgenic rapeseed using RNA interference vector pC1300-SsTOR-RNAi1 and verification of resistance to Sclerotinia sclerotiorum

[0092] 1. Experimental Methods

[0093] 1. Construction of transgenic rapeseed using RNA interference vector pC1300-SsTOR-RNAi1

[0094] (1) Seeds of rapeseed variety ZS11 were sterilized with 70% (v / v) alcohol for 10 min, washed 5 times with sterile water, and after drying, transferred to M0 medium (2.2 g / L MS powder, 15 g / L sucrose, 5.5 g / L agar) with a sterile spatula and cultured in the dark at 24°C for 6 days to obtain rapeseed seedlings.

[0095] (2) The Agrobacterium culture solution prepared in step 1 of Example 2 was centrifuged to remove the supernatant, and the Agrobacterium was washed twice with a suspension DM (4.4 g / L MS powder, 30 g / L sucrose, 100 M / L acetosyringone) and placed at 4° C. for later use.

[0096] (3) Cut the hypocotyls of the rapeseed seedlings in step (1) with sterile scissors, pour the Agrobacterium solution treated in step (2) into the culture medium for infection, and after the infection, remove the solution with a pipette, dry, and transfer the explants to M1 medium (4.4 g / L MS powder, 30 g / L sucrose, 18 g / L mannitol, 1 mg / L 2,4-D, 0.9 mg / L cytokinin, 5.5 g / L agar powder, 100 M / L acetosyringone), and culture in the dark at 24°C for 48 h.

[0097] (4) The explants cultured in step (3) were transferred to M2 medium (4.4 g / L MS powder, 30 g / L sucrose, 18 g / L mannitol, 1 mg / L 2,4-D, 0.9 mg / L cytokinin, 5.5 g / L agar, 1 ml / L AgNO3, 200 mg / L timentin, 50 mg / L hygromycin) and cultured normally in a plant light incubator for 4 weeks (24°C, 6 h light / 8 h dark).

[0098] (5) The explants cultured in step (4) were transferred to M3 medium (4.4 g / L MS powder, 10 g / L glucose, 0.25 g / L xylose, 0.6 g / L ethanesulfonic acid, 5.5 g / L agar, 2 mg / L Trans-ZT, 0.1 mg / L IAA, 200 mg / L timentin) for culture. The culture conditions were the same as those in step (4). The explants were subcultured every two weeks until green shoots appeared.

[0099] (6) The green shoots with intact growth points in step (5) were transferred to M4 medium (4.4 g / L MS powder, 10 g / L sucrose, 5.5 g / L agar) for rooting. The rooted plants were transferred to nutrient soil and grown in a greenhouse (24° C., 16 h light / 8 h dark) to obtain transgenic rapeseed.

[0100] 2. Extract the leaf genome of transgenic rapeseed as a DNA template for PCR identification.

[0101] The reaction system and reaction conditions are the same as those in step 3 of Example 2.

[0102] 3. The T0 generation transgenic rapeseed plants were cultured to the T1 generation, and three transgenic rapeseed lines were selected for infection experiments, named SsTOR-BnRNAi1-#1, SsTOR-BnRNAi1-#2, and SsTOR-BnRNAi1-#3.

[0103] (1) Infection of leaves: According to the method of step 4 of Example 2, Sclerotinia sclerotiorum was cultured on PDA medium for 3 days, and agar blocks containing Sclerotinia sclerotiorum hyphae were punched out on the medium with a cork puncher. Leaves of ZS11 wild-type and T1 transgenic rapeseed plants were placed in a tray, and the petioles were covered with wet paper towels to keep moisture and prevent the leaves from losing water and wilting. Agar containing Sclerotinia sclerotiorum hyphae was inoculated on the leaves and cultured in an incubator (25°C, 16h light / 8h dark) for 3 days.

[0104] (2) Infection of stems: According to the method of step 4 of Example 2, Sclerotinia sclerotiorum was cultured on PDA medium for 3 days, and agar blocks containing Sclerotinia sclerotiorum hyphae were punched out on the medium with a cork puncher. Seedlings of ZS11 wild-type and T1 transgenic rapeseed lines were cultured for one month, and a leaf blade of the rapeseed plant stem was cut from the base of the petiole with a scalpel, and the agar block containing Sclerotinia sclerotiorum hyphae was wrapped around the cut site with plastic wrap. The plants were placed in a breathable plastic bag to prevent the agar block from drying out, and cultured in an incubator (25°C, 16h light / 8h dark) for 14 days.

[0105] 2. Experimental Results

[0106] like Figure 8As shown, the PCR amplified fragment is a partial fragment of the hygromycin resistance gene, with a size of 969 bp. The fragment size is around 1000 bp (ZS11 is the control).

[0107] like Fig. 9 As shown, obvious hyphae infection and leaf cell death have occurred around the infected area on the leaves of Zhongshuang 11 ( Fig. 9 A), while no obvious lesions formed on the leaves of transgenic rapeseed plants ( Fig. 9 B. Fig. 9 C and Fig. 9 D), indicating that the resistance of transgenic rapeseed leaves to Sclerotinia sclerotiorum was significantly enhanced.

[0108] like Fig.10 As shown in A, after 14 days of cultivation, the ZS11 wild-type plants had withered, while the three transgenic rapeseed plants grew well. Fig.10 As shown in B, observation of stem infection shows that the stems of the ZS11 wild-type plants have completely rotted, while the stems of the transgenic rapeseed plants are only slightly infected at the inoculation site and do not affect plant growth.

[0109] Experiments have shown that after introducing the RNA interference vector containing the F1 interference fragment into plants, the plants' resistance to Sclerotinia sclerotiorum is significantly improved, the expression of the Sclerotinia sclerotiorum TOR gene is inhibited, and the infection ability of Sclerotinia sclerotiorum is significantly reduced.

[0110] Example 4 Construction of RNA interference vector pC1300-SsTOR-RNAi2

[0111] The target fragment F2 is selected on the TOR gene, and an RNA interference fragment vector is designed to inhibit the expression of the TOR gene, thereby blocking the infection process of Sclerotinia sclerotiorum. The nucleotide sequence of the target fragment F2 is shown in SEQ ID NO: 5, with a length of 298 bp (956-1253), and the position of the target fragment F2 on the TOR gene is shown in Fig.11 shown.

[0112] 1. The RNA of Sclerotinia sclerotiorum of Example 2 was extracted and reverse transcribed to obtain Sclerotinia sclerotiorum cDNA. Using Sclerotinia sclerotiorum cDNA as a template, PCR amplification was performed with primers RNAi2-Forward-F (GATGTGGTCGACTTAATTAAACAAGGATAGAAACGACGC) and RNAi2-Forward-R (GAACGATCTCTA GAGGTACCTTCACCGGCGGAATGTAGAAAG) to obtain a forward F2 interference fragment (SEQ ID NO: 5). PCR amplification was performed with primers RNAi2-Reverse-F (AACGATAGGATCCCCTGCAGGTTCACCGGCGGAATGTAGAAAGC) and RNAi2-Rev erse-R (CAATTTTACCTGCTGAGCTCACAAGGATAGAAACGACGC) to obtain a reverse F2 interference fragment (SEQ ID NO: 6).

[0113] PCR reaction system (50μL): 25μL Ultra-Fidelity 2× master mix, 20 μL water, 2 μL Forward primer, 2 μL Reverse primer and 1 μL cDNA.

[0114] PCR reaction conditions: 98°C for 1 min, 98°C for 30 s, 55°C for 30 s, 72°C for 10 s (35 cycles), 72°C for 5 min.

[0115] 2. Double digest the RNA interference vector pC1300-SsTOR-RNAi1 in Example 1 with restriction endonucleases SbfI and Sac I to obtain the RNA interference vector pC1300-SsTOR-RNAi1 after digestion, and connect the reverse F2 interference fragment with the RNA interference vector pC1300-SsTOR-RNAi1 after digestion with Takara In-Fusion recombinase to obtain the intermediate vector pC1300-SsTOR-RNAi1+RNAi2. The In-Fusion digestion reaction system is: 2 μL of RNA interference vector pC1300-SsTOR-RNAi1 after digestion, 2 μL of reverse F2 interference fragment, and 1 μL of In-Fusion recombinase. The In-Fusion digestion reaction conditions are 50°C for 30 min.

[0116] The intermediate vector pC1300-SsTOR-RNAi1+RNAi2 was digested with restriction endonucleases Pac I and Kpn I to obtain the digested pC1300-SsTOR-RNAi1+RNAi2 intermediate vector, and the forward F2 interference fragment was connected with the digested pC1300-SsTOR-RNAi1+RNAi2 intermediate vector using Takara In-Fusion recombinase to obtain the RNA interference vector pC1300-SsTOR-RNAi2 (SEQ ID NO: 7), as shown in Fig.12 As shown. The In-Fusion enzyme digestion reaction system is: 2μL pC1300-SsTOR-RNAi1+RNAi2 intermediate vector after digestion, 2μL forward F2 interference fragment, 1μL In-Fusion recombinase. The In-Fusion enzyme digestion reaction conditions are 50℃30min.

[0117] 3. Use primers M13F, AtActin8-R and M13R (CAGGAAACAGCTATGAC) to sequence and verify the RNA interference vector pC1300-SsTOR-RNAi2.

[0118] Example 5 Construction of transgenic Arabidopsis thaliana using RNA interference vector pC1300-SsTOR-RNAi2 and verification of resistance to Sclerotinia sclerotiorum

[0119] 1. Experimental Methods

[0120] The RNA interference vector pC1300-SsTOR-RNAi1 was replaced with the RNA interference vector pC1300-SsTOR-RNAi2, and the other experimental methods were the same as those in Example 2.

[0121] 2. Experimental Results

[0122] The PCR amplified fragment is a partial fragment of the hygromycin resistance gene, with a size of 969 bp. Fig.13 As shown, the fragment size is around 1000 bp.

[0123] like Fig.14 As shown, 3 days after Sclerotinia infection, both wild-type and transgenic Arabidopsis had leaf infection, but the growth of transgenic Arabidopsis was significantly better than that of the wild type; 5 days after Sclerotinia infection, the wild-type Arabidopsis had died, while some leaves of transgenic Arabidopsis were still not infected by Sclerotinia, indicating that the resistance of transgenic Arabidopsis to Sclerotinia was significantly higher than that of wild-type Arabidopsis.

[0124] Example 6 Construction of transgenic rapeseed using RNA interference vector pC1300-SsTOR-RNAi2 and verification of resistance to Sclerotinia sclerotiorum

[0125] 1. Experimental Methods

[0126] The RNA interference vector pC1300-SsTOR-RNAi1 was replaced with the RNA interference vector pC1300-SsTOR-RNAi2, and the other experimental methods were the same as those in Example 3.

[0127] The three transgenic rapeseed lines obtained were used for infection experiments and named SsTOR-BnRNAi2-#1, SsTOR-BnRNAi2-#2, and SsTOR-BnRNAi2-#3.

[0128] 2. Experimental Results

[0129] like Fig.15 As shown, the fragment size is around 1000 bp (ZS11 is used as a control).

[0130] like Fig.16 As shown, obvious hyphae infection and leaf cell death have occurred around the infected area on the leaves of Zhongshuang 11 ( Fig.16 A), while no obvious lesions formed on the leaves of transgenic rapeseed plants ( Fig.16 B. Fig.16 C and Fig.16 D), indicating that the resistance of transgenic rapeseed leaves to Sclerotinia sclerotiorum was significantly enhanced.

[0131] like Fig.17 As shown in A, after 14 days of cultivation, the ZS11 wild-type plants had withered, while the three transgenic rapeseed plants grew well. Fig.17 As shown in B, observation of stem infection shows that the stems of the ZS11 wild-type plants have completely rotted, while the stems of the transgenic rapeseed plants are only slightly infected at the inoculation site and do not affect plant growth.

[0132] Experiments have shown that after introducing the RNA interference vector containing the F2 interference fragment into plants, the plants' resistance to Sclerotinia sclerotiorum is significantly improved, the expression of the Sclerotinia sclerotiorum TOR gene is inhibited, and the infection ability of Sclerotinia sclerotiorum is significantly reduced.

[0133] Example 7 Construction of RNA interference vector pC1300-SsTOR-RNAi3

[0134] The target fragment F3 is selected on the TOR gene, and an RNA interference fragment vector is designed to inhibit the expression of the TOR gene, thereby blocking the infection process of Sclerotinia sclerotiorum. The nucleotide sequence of the target fragment F3 is shown in SEQ ID NO: 8, with a length of 300 bp (6901-7200), and the position of the target fragment F3 on the TOR gene is shown in Fig.18 shown.

[0135] 1. RNA of Sclerotinia sclerotiorum of Example 2 was extracted and reverse transcribed to obtain Sclerotinia sclerotiorum cDNA. Using Sclerotinia sclerotiorum cDNA as a template, PCR amplification was performed with primers RNAi3-Forward-F (GATGTGGTCGACTTAATTAATCACCTGTAGGACCTAATTTCCG) and RNAi3-Forward-R (GAACGATCT CTAGAGGTACCTAATTCCTCCTCTGGCTTG) to obtain a forward F3 interference fragment (SEQ ID NO: 8), and PCR amplification was performed with primers RNAi3-Reverse-F (AACGATAGGATCCCCTGCAGGTAATTCCTCCTCTGGCTTGAAATC) and RNAi3-Reverse R (CAATTTTACCTGCTGAGCTCTCACCTGTAGGACCTAATTTC) to obtain a reverse F3 interference fragment (SEQ ID NO: 9). The PCR reaction system and reaction conditions were the same as those in Example 4.

[0136] 2. According to the method of Example 4, the reverse F3 interference fragment was connected with the RNA interference vector pC1300-SsTOR-RNAi1 after enzyme digestion using Takara In-Fusion recombinase to obtain the intermediate vector pC1300-SsTOR-RNAi1+RNAi3.

[0137] The intermediate vector pC1300-SsTOR-RNAi1+RNAi3 was digested with restriction endonucleases Pac I and Kpn I to obtain the digested pC1300-SsTOR-RNAi1+RNAi3 intermediate vector. According to the method of Example 4, the forward F3 interference fragment was ligated with the digested pC1300-SsTOR-RNAi1+RNAi3 intermediate vector using Takara In-Fusion recombinase to obtain the RNA interference vector pC1300-SsTOR-RNAi3 (SEQ ID NO: 10). Fig.19 shown.

[0138] 3. Perform sequencing verification according to the method of Example 4.

[0139] Example 8 Construction of transgenic Arabidopsis thaliana using RNA interference vector pC1300-SsTOR-RNAi3 and verification of resistance to Sclerotinia sclerotiorum

[0140] 1. Experimental Methods

[0141] The RNA interference vector pC1300-SsTOR-RNAi1 was replaced with the RNA interference vector pC1300-SsTOR-RNAi3, and the other experimental methods were the same as those in Example 2.

[0142] 2. Experimental Results

[0143] The PCR amplified fragment is a partial fragment of the hygromycin resistance gene, with a size of 969 bp. Fig. 20 As shown, the fragment size is around 1000 bp.

[0144] like Fig.21 As shown, 3 days after Sclerotinia infection, both wild-type and transgenic Arabidopsis had leaf infection, but the growth of transgenic Arabidopsis was significantly better than that of the wild type; 5 days after Sclerotinia infection, the wild-type Arabidopsis had died, while some leaves of transgenic Arabidopsis were still not infected by Sclerotinia, indicating that the resistance of transgenic Arabidopsis to Sclerotinia was significantly higher than that of wild-type Arabidopsis.

[0145] Example 9 Construction of transgenic rapeseed using RNA interference vector pC1300-SsTOR-RNAi3 and verification of resistance to Sclerotinia sclerotiorum

[0146] 1. Experimental Methods

[0147] The RNA interference vector pC1300-SsTOR-RNAi1 was replaced with the RNA interference vector pC1300-SsTOR-RNAi3, and the other experimental methods were the same as those in Example 3.

[0148] Three transgenic rapeseed lines were selected for infection experiments and named SsTOR-BnRNAi3-#1, SsTOR-BnRNAi3-#2, and SsTOR-BnRNAi3-#3.

[0149] 2. Experimental Results

[0150] like Fig. 22 As shown, the fragment size is around 1000 bp (ZS11 is used as a control).

[0151] like Fig.23 As shown, obvious hyphae infection and leaf cell death have appeared around the infected sites on the leaves of Zhongshuang 11, while no obvious lesions have formed on the leaves of transgenic rapeseed plants, indicating that the resistance of the leaves of transgenic rapeseed to Sclerotinia sclerotiorum has been significantly enhanced.

[0152] Experiments have shown that after introducing the RNA interference vector containing the F3 interference fragment into plants, the plants' resistance to Sclerotinia sclerotiorum is significantly improved, the expression of the Sclerotinia sclerotiorum TOR gene is inhibited, and the infection ability of Sclerotinia sclerotiorum is significantly reduced.

[0153] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A RNA interference fragment combination, characterized in that: The RNA interference fragment combination contains at least one of combination 1, combination 2 and combination 3; The nucleotide sequence of the RNA interference fragment in combination 1 is shown in SEQ ID NOs: 1 and 3; The nucleotide sequences of the RNA interference fragments in combination 2 are shown in SEQ ID NOs: 5 and 6; The nucleotide sequences of the RNA interference fragments in combination 3 are shown in SEQ ID NOs: 8 and 9.

2. A recombinant expression vector, characterized in that: The recombinant expression vector contains the RNA interference fragment combination according to claim 1.

3. Use of the RNA interference fragment combination according to claim 1 or the recombinant expression vector according to claim 2 in improving plant resistance to Sclerotinia sclerotiorum, cultivating Sclerotinia sclerotiorum-resistant plants and / or preventing and controlling Sclerotinia sclerotiorum diseases in plants.

4. The use according to claim 3, characterized in that: The RNA interference fragment combination or the recombinant expression vector inhibits the expression of the SsTOR gene of Sclerotinia sclerotiorum.

5. The use according to claim 3 or 4, characterized in that: The plant is Arabidopsis thaliana or rapeseed.

6. A method for improving plant resistance to Sclerotinia sclerotiorum, characterized in that: The RNA interference fragment combination of claim 1 or the recombinant expression vector of claim 2 is expressed in plants to inhibit the expression of the SsTOR gene of Sclerotinia sclerotiorum in plants.

7. A method for cultivating plants resistant to Sclerotinia sclerotiorum, characterized in that: The RNA interference fragment combination of claim 1 or the recombinant expression vector of claim 2 is expressed in plants to inhibit the expression of the SsTOR gene of Sclerotinia sclerotiorum in plants.

8. A method for preventing and controlling plant sclerotinia disease, characterized in that: The RNA interference fragment combination of claim 1 or the recombinant expression vector of claim 2 is expressed in plants to inhibit the expression of the SsTOR gene of Sclerotinia sclerotiorum in plants.

9. The method according to any one of claims 6 to 8, characterized in that: The plant is Arabidopsis thaliana or rapeseed.

Images