Modularized plasmid vector for FRET probe construction and construction method and application thereof

Abstract

The invention belongs to the technical field of biology, and relates to a modular plasmid vector for constructing an FRET (Fluorescence Resonance Energy Transfer) probe. The modular plasmid vector comprises a promoter, a ribosome binding site and a terminator, and a modular probe assembly region is connected between the ribosome binding site and the terminator; the modular probe assembly region comprises an SH3 structural domain gene, a restriction endonuclease recognition site sequence for insertion of a fluorescent protein 1 gene, a connecting chain, a restriction endonuclease recognition site sequence for insertion of a fluorescent protein 2 gene, and a restriction endonuclease recognition site sequence for insertion of an SH3 structural domain ligand gene; the connecting chain comprises a connecting region 1, a restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, a connecting region 2, a restriction endonuclease recognition site sequence for protease recognition sequence gene insertion, a connecting region 3, a restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion and a connecting region 4. The modular plasmid vector can quickly change and replace partial regions according to the application of the FRET probe, and can be used as a universal vector for constructing the FRET probe.

Description

Technical Field

[0001] The present invention relates to the fields of bioengineering and biopharmaceuticals, and in particular to a modular plasmid vector for constructing a FRET probe, and a construction method and application thereof. Background Art

[0002] Förster resonance energy transfer (FRET) is a mechanism for energy transfer between two photosensitive molecules (chromophores). The donor chromophore is initially in an electronically excited state and can transfer energy to the acceptor chromophore via non-radiative dipole-dipole coupling. The efficiency of this energy transfer is inversely proportional to the distance between the donor and acceptor, and FRET is extremely sensitive to small changes in distance. Measurements of FRET efficiency can be used to determine if two fluorophores are within a certain distance. Such measurements play an important role in research ranging from screening for drug inhibitors to detecting antibodies.

[0003] Various probes based on the FRET effect are essentially proteins. In the prior art, the production of recombinant proteins is carried out by genetic engineering, and the first condition is the construction of a recombinant expression plasmid. The two photosensitive molecules in the FRET probe are composed of fluorescent proteins with different optical properties, namely a donor group and an acceptor group. The fluorescent protein emission light of the donor group is the excitation light of the fluorescent protein of the acceptor group. Ideally, the maximum emission light of the donor group is consistent with the maximum excitation light of the acceptor group and there is no overlapping spectral region with its emission light. In fact, there is a large difference in the FRET efficiency between different donor groups and acceptor groups of fluorescent proteins. In addition, depending on the purpose of the experimental research, different fluorescent proteins are often required to match the FRET effect. When constructing a FRET probe based on this fluorescent protein, it is also necessary to add a connecting chain between the donor group and the acceptor group according to different uses according to the current experiment to shorten the distance of the fluorescent protein. Since the various colors of fluorescent proteins currently developed are mainly derived from jellyfish or corals, the similarity of their constituent amino acids is very high, which also causes the gene sequence similarity of the fluorescent protein to be high, which is more difficult to perform genetic engineering operations. When constructing fluorescent protein FRET probes, full gene synthesis is usually chosen, or case-by-case design is performed based on the types of restriction endonucleases available within the probe gene.

[0004] For example, MV Golynskiy et al. (Antibody Detection by Using a FRET-Based Protein Conformational Switch) used the whole gene synthesis method to obtain the probe when designing the antibody detection probe, and then replaced the connector according to the restriction enzyme available inside the fluorescent protein gene; this method is not universal when modifying the probe design, and different types of connector genes need to be resynthesized after replacing the fluorescent protein. Bobin et al. (Fluorescent Protein Based FRET Pairs with Improved Dynamic Range for Fluorescence Lifetime Measurements) used overlap extension PCR to construct the FRET probe gene for TEV protease (tobaccoetch virus protease) activity detection. In actual operation, the fluorescent proteins that constitute the donor group and the acceptor group have the same evolutionary origin, and the consistency in amino acid sequence is very high. Their gene sequences are highly similar. The designed overlap extension PCR primers are prone to misalign the gene position, making the construction of the probe gene a time-consuming and laborious task, usually requiring 2 to 4 weeks.

[0005] Since the construction of FRET probes composed of fluorescent proteins is cumbersome and expensive, the various uses of FRET fluorescent protein probes reported in the literature are mostly based on the avGFP (jellyfish) source green fluorescent protein discovered in previous studies. The emission wavelength of this type of green fluorescent protein is short, it is easy to scatter in the solution, and the light penetration is weak. For detection applications in solution, such as antibody detection, drug screening and other applications, it is more suitable to select infrared and far-infrared with an emission spectrum greater than 600nm wavelength and stronger solution light penetration. However, FRET probes composed of infrared and far-infrared fluorescent proteins are currently less reported, and their characteristics cannot meet the detection requirements. Strengthening the development of infrared and far-infrared fluorescent protein FRET probes can further improve the detection sensitivity of the probe. Therefore, designing a modular FRET probe construction plasmid and method can facilitate and quickly screen and optimize probes and improve the application performance of probes. Summary of the invention

[0006] In view of the problems and shortcomings in the prior art, the present invention aims to provide a modular plasmid vector for constructing a FRET probe and a construction method and application thereof.

[0007] To achieve the purpose of the invention, the technical solution adopted by the present invention is as follows:

[0008] The first aspect of the present invention provides a modular plasmid vector for FRET probe construction, the modular plasmid vector comprises a promoter, a ribosome binding site and a terminator connected in sequence, a modular probe assembly region is connected between the ribosome binding site and the terminator; the modular probe assembly region comprises an SH3 domain gene, a restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, a connecting chain, a restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, and a restriction endonuclease recognition site sequence for SH3 domain ligand gene insertion, which are connected in sequence; the connecting chain comprises a connecting region 1, a restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, a connecting region 2, a restriction endonuclease recognition site sequence for protease recognition sequence gene insertion, a connecting region 3, a restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and a connecting region 4, which are connected in sequence; the fluorescent protein 1 and the fluorescent protein 2 are a pair of FRET fluorescent protein pairs.

[0009] According to the above-mentioned modular plasmid vector, preferably, the modular probe assembly region also includes a purification tag gene and a TEV enzyme recognition sequence gene; the TEV enzyme recognition sequence gene is located upstream of the SH3 domain and is connected to the SH3 domain; the purification tag gene is located upstream of the TEV enzyme recognition sequence gene and is connected to the TEV enzyme recognition sequence gene, and the purification tag gene generates a protein purification tag after translation, which is used for in vitro affinity chromatography purification after the recombinant expression of the FRET probe; the TEV enzyme recognition sequence gene is used to use TEV protease to remove the protein purification tag and T7 RNRP guide peptide on the recombinantly expressed FRET probe.

[0010] According to the above modular plasmid vector, preferably, the modular probe assembly region further includes a T7 RNAP guide peptide gene sequence, and the T7 RNAP guide peptide gene sequence is located upstream of the purification tag gene and connected to the purification tag gene. The T7 RNAP guide peptide gene sequence can utilize the high expression characteristics of T7 RNAP in cells to increase the ability of the FRET probe gene to enter the ribosome, thereby increasing the recombinant expression amount of the FRET probe in the host cell.

[0011] According to the above modular plasmid vector, preferably, the restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, the restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, the restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, the restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and the restriction endonuclease recognition site sequence for protease recognition sequence gene insertion are all different. More preferably, the restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, the restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, the restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, the restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and the restriction endonuclease recognition site sequence for protease recognition sequence gene insertion are all selected from any one of Nco I, Hind III, Eco53K I, BamHⅠ, XhoⅠ, Sal I, EcoR I, and Nde I restriction endonuclease recognition site sequences.

[0012] According to the above modular plasmid vector, preferably, the nucleotide sequence of the SH3 domain gene is as shown in Sequence 1, and the specific nucleotide sequence of Sequence 1 is:

[0013] TTTGAAATTCCGGATGATGTGCCCCTGCCTGCAGGCTGGGAAATGGCCAAAACCAGCAGCGGTCAAAGATACTTCAAGAACCACATCGACCAGACCACAACCTGGCAGGACCCGCGTAAAGCCATGCTGAGCCAGATGGGCGGAAGCGGTAGTGGTGGCAGCGGCAGCGGGGGTTCCGGCAGTGGTGGAAGCGGC.

[0014] According to the above modular plasmid vector, preferably, the nucleotide sequence of the connecting region 1 is as shown in Sequence 2, and Sequence 2 is: GGCGGCTCTGGGGGT.

[0015] According to the above modular plasmid vector, preferably, the nucleotide sequence of the connecting region 2 is as shown in Sequence 3, which is:

[0016] GGTTCAGGTAGCGGTGGCAGCGGTGGTAGCGGCGGTAGCGGTGGTAGCGGCGGCTCTGGC GCCGAGGCAGCGGCAAAAGAAGCTGCAGCCAAGGAAGCAGCAGCAAAAGAAGCCGCTGCCA AGGAGGCCGCTGCCAAGGAAGCCGCCGCCAAGGCCGGCTCTGGCGGTAGCGGAGGCTCCGGC.

[0017] According to the above modular plasmid vector, preferably, the nucleotide sequence of the connecting region 3 is as shown in Sequence 4, which is:

[0018] GGTAGCGGTGGCAGCGGCGGCAGCGGTGCAGAAGCAGCAGCAAAAGAGGCCGCAGCCAA AGAGGCTGCCGCAAAAGAAGCAGCCGCCAAGGAAGCCGCTGCAAAAGAGGCCGCCGCCAAAG CAGGTAGTGGTGGCAGCGGCGGCAGCGGTGGCAGCGGTGGCAGCGGCGGATCTGGAGGAAGC.

[0019] According to the above modular plasmid vector, preferably, the nucleotide sequence of the connecting region 4 is as shown in Sequence 5, and Sequence 5 is: GGCTCCGGCGGCAGCGGC.

[0020] According to the above modular plasmid vector, preferably, the fluorescent protein 1 and the fluorescent protein 2 are both fluorescent proteins derived from corals or jellyfish, and the fluorescent protein 1 and the fluorescent protein 2 are a pair of FRET fluorescent protein pairs.

[0021] According to the above modular plasmid vector, preferably, the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene is used to insert the ligand of the SH3 domain into the modular plasmid. When the fluorescent protein 1 and the fluorescent protein 2 in the FRET fluorescent protein pair are both fluorescent proteins derived from jellyfish, because the FRET fluorescent protein derived from jellyfish has a natural dimerization tendency or has a dimerization tendency after molecular surface mutation (such as S208F and V224L mutations of ECFP / EYFP), this type of fluorescent protein does not require additional structure to assist in forming the FRET effect. Therefore, when constructing a FRET probe using the modular plasmid vector, it is not necessary to insert the SH3 domain ligand gene into the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene in the modular plasmid vector. When both fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair are fluorescent proteins derived from coral, or one of fluorescent protein 1 and fluorescent protein 2 is a fluorescent protein derived from coral, since the FRET fluorescent protein derived from coral (such as Lssmorange / mKate) does not have a tendency to dimerize, it is necessary to add a specific domain to help the fluorescent protein molecules to approach each other. Therefore, when constructing a FRET probe using the modular plasmid vector, it is necessary to insert the SH3 domain ligand gene into the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene in the modular plasmid vector. The protein structure of the SH3 domain and its ligand gene sequence contained in the modular plasmid after translation can adjust the affinity between fluorescent protein 1 and fluorescent protein 2, which is conducive to the approach between fluorescent protein 1 and fluorescent protein 2 molecules; moreover, different SH3 domain ligand genes can be inserted according to the affinity requirements of fluorescent protein 1 and fluorescent protein 2 in the constructed FRET probe.

[0022] According to the above-mentioned modular plasmid vector, preferably, the restriction endonuclease recognition site sequence for inserting the protease recognition sequence gene is used to insert the protease recognition sequence gene into the modular plasmid vector; when the constructed FRET probe is a probe for screening different types of protease inhibitors, different protease recognition sequence genes can be inserted into the restriction endonuclease recognition sequence sequence for inserting the protease recognition sequence gene according to different types of proteases.

[0023] According to the above modular plasmid vector, preferably, the promoter is a prokaryotic promoter or a eukaryotic promoter. More preferably, the promoter is selected from any one of T7, T5, Sp6, lac, Ptac, trp, araBad, CMV, EF1a, CAG, PGK, TRE, U6, and UAS promoters. Most preferably, the promoter is a T7 promoter, and the nucleotide sequence of the T7 promoter is: TAATACGACTCACTATAGG (sequence 6).

[0024] According to the modular plasmid vector described above, preferably, a connecting segment is provided between the promoter and the ribosome binding site, one end of the connecting segment is connected to the promoter, and the other end of the connecting segment is connected to the ribosome binding site. The connecting segment may contain an operon or may not contain an operon, and the nucleotide sequence of the connecting segment is as shown in Sequence 7 or Sequence 8; the nucleotide sequence is as shown in Sequence 7. The connecting segment contains an operon, and preferably, the operon is a lactose operon. More preferably, the specific nucleotide sequences of Sequence 7 and Sequence 8 are as follows:

[0025] Sequence 7 is: GGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAAT;

[0026] Sequence 8 is: CCTCTAGAAATAAT.

[0027] According to the above-mentioned modular plasmid vector, preferably, the nucleotide sequence of the ribosome binding site is: TTTGTTTAACTTTAAGAAGGAGA (sequence 9).

[0028] According to the above modular plasmid vector, preferably, the nucleotide sequence of the T7 RNAP guide region gene sequence is: ATGAACACGATTAACATCGCTAAGAACGACTTC (SEQ ID 10).

[0029] According to the above modular plasmid vector, preferably, the purification tag gene is a polyhistidine purification tag gene. More preferably, the polyhistidine purification tag gene is an 8×His purification tag, and the nucleotide sequence of the 8×His purification tag gene is: CATCATCACCATCACCATCATCAC (SEQ ID 11).

[0030] According to the above modular plasmid vector, preferably, the nucleotide sequence of the TEV enzyme recognition sequence gene is: GAAAACCTGTACTTCCAATCC (sequence 12).

[0031] According to the above modular plasmid vector, preferably, the terminator is a T7 terminator, and the nucleotide sequence of the T7 terminator is: CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (sequence 13).

[0032] The second aspect of the present invention provides the use of the modular plasmid vector for constructing FRET probes described in the first aspect in preparing FRET probes and screening FRET fluorescent protein pairs.

[0033] The third aspect of the present invention provides a method for constructing a modular plasmid vector for constructing a FRET probe as described in the first aspect, comprising the following steps:

[0034] (1) Linearizing the starting plasmid vector to obtain a linearized plasmid vector,

[0035] (2) Artificially synthesizing the nucleotide sequence of the modular probe assembly region, and then seamlessly connecting the artificially synthesized nucleotide sequence of the modular probe assembly region with the linearized plasmid vector prepared in step (1) by homologous recombination to obtain the modular plasmid vector for FRET probe construction.

[0036] According to the above preparation method, the starting plasmid vector is pET28a.

[0037] A fourth aspect of the present invention provides a method for preparing a FRET probe, comprising the following steps:

[0038] S1, inserting the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequences for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector described in the first aspect, respectively, to obtain a FRET probe plasmid;

[0039] S2, transforming the FRET probe plasmid finally constructed in step S1 into the host bacteria, selecting the positive clone bacteria containing the FRET probe plasmid, and performing fermentation culture. After the fermentation culture is completed, the bacteria are collected, resuspended, and the bacteria are crushed, and then the supernatant is collected, and the supernatant is purified by chromatography to obtain the FRET probe.

[0040] According to the above-mentioned method for preparing the FRET probe, preferably, the fluorescent protein 1 and the fluorescent protein 2 are both fluorescent proteins derived from corals or jellyfish.

[0041] According to the above-mentioned method for preparing the FRET probe, preferably, when both the fluorescent protein 1 and the fluorescent protein 2 are fluorescent proteins derived from corals or when any one of the fluorescent protein 1 and the fluorescent protein 2 is a fluorescent protein derived from corals, the step S1 also includes: inserting the coding gene sequence of the SH3 domain ligand into the restriction endonuclease recognition site sequence for SH3 domain ligand gene insertion in the FRET probe plasmid to obtain a FRET probe plasmid containing the SH3 domain ligand gene. That is, when both the fluorescent protein 1 and the fluorescent protein 2 are fluorescent proteins derived from corals or when any one of the fluorescent protein 1 and the fluorescent protein 2 is a fluorescent protein derived from corals, in the method for preparing the FRET probe, step S1 specifically includes: inserting the coding gene sequences of the fluorescent protein 1 and the fluorescent protein 2 into the restriction endonuclease recognition site sequence for fluorescent protein 1 and fluorescent protein 2 gene insertion in the modular plasmid vector described in the first aspect to obtain a FRET probe plasmid; then inserting the coding gene sequence of the SH3 domain ligand into the FRET probe plasmid for insertion. A FRET probe plasmid containing the SH3 domain ligand gene is obtained at the restriction endonuclease recognition site sequence inserted into the SH3 domain ligand gene; step S2 specifically comprises: transforming the FRET probe plasmid containing the SH3 domain ligand gene constructed in step S1 into a host bacterium, selecting positive clone bacteria containing the FRET probe plasmid containing the SH3 domain ligand gene, and performing fermentation culture. After the fermentation culture is completed, the bacteria are collected, resuspended, and the bacteria are crushed, and then the supernatant is collected, and the supernatant is purified by affinity chromatography to obtain the FRET probe.

[0042] A fifth aspect of the present invention provides a method for preparing a FRET probe, wherein the FRET probe is used for antibody detection, and the preparation method comprises the following steps:

[0043] S1, inserting the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequences for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector described in the first aspect, respectively, to obtain a FRET probe plasmid, wherein both fluorescent protein 1 and fluorescent protein 2 are fluorescent proteins derived from jellyfish; inserting the antigen epitope coding gene of the antigen corresponding to the antibody to be tested into the restriction endonuclease recognition site sequence 1 for inserting the antigen epitope gene and the restriction endonuclease recognition site sequence 2 for inserting the antigen epitope gene in the FRET probe plasmid, respectively, to obtain a FRET probe plasmid containing the antigen epitope gene;

[0044] S2. Transforming the FRET probe plasmid containing the antigen epitope gene constructed in step S1 into a host bacterium, selecting positive clone bacteria containing the FRET probe plasmid containing the antigen epitope gene, and performing fermentation culture. After the fermentation culture is completed, collecting the bacteria, resuspending the bacteria, and crushing the bacteria, then collecting the supernatant, and performing chromatography purification on the supernatant to obtain the FRET probe.

[0045] A sixth aspect of the present invention provides a method for preparing a FRET probe, wherein the FRET probe is used for antibody detection, and the preparation method comprises the following steps:

[0046] S1, inserting the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequences for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector described in the first aspect, respectively, to obtain a FRET probe plasmid, wherein the fluorescent protein 1 and fluorescent protein 2 are both fluorescent proteins derived from corals or any one of the fluorescent protein 1 and fluorescent protein 2 is a fluorescent protein derived from corals; inserting the coding gene sequence of the SH3 domain ligand into the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene in the FRET probe plasmid, to obtain a FRET probe plasmid containing the SH3 domain ligand gene; inserting the antigen epitope coding gene of the antigen corresponding to the antibody to be detected into the restriction endonuclease recognition site sequence 1 for inserting the antigen epitope gene and the restriction endonuclease recognition site sequence 2 for inserting the antigen epitope gene in the FRET probe plasmid containing the SH3 domain ligand gene, respectively, to obtain a FRET probe plasmid containing the SH3 domain ligand gene-antigen epitope gene;

[0047] S2. Transforming the FRET probe plasmid containing SH3 domain ligand gene-antigen epitope gene constructed in step S1 into a host bacterium, selecting positive clone bacteria containing the FRET probe plasmid containing SH3 domain ligand gene-antigen epitope gene, and performing fermentation culture. After the fermentation culture is completed, the bacteria are collected, resuspended, and broken, and then the supernatant is collected, and the supernatant is purified by chromatography to obtain a FRET probe.

[0048] A seventh aspect of the present invention provides a method for preparing a FRET probe, wherein the FRET probe is used for screening protease inhibitors, and the preparation method comprises the following steps:

[0049] S1, inserting the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequences for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector described in the first aspect, respectively, to obtain a FRET probe plasmid, wherein both fluorescent protein 1 and fluorescent protein 2 are fluorescent proteins derived from jellyfish; inserting the protease recognition sequence gene into the restriction endonuclease recognition site sequence for inserting the protease recognition sequence gene in the FRET probe plasmid, to obtain a FRET probe plasmid containing the protease recognition sequence gene;

[0050] S2. The FRET probe plasmid containing the protease recognition sequence gene constructed in step S1 is transformed into a host bacterium, and positive clone bacteria containing the FRET probe plasmid containing the protease recognition sequence gene are selected for fermentation culture. After the fermentation culture is completed, the bacteria are collected, resuspended, and broken, and then the supernatant is collected, and the supernatant is purified by chromatography to obtain a FRET probe.

[0051] An eighth aspect of the present invention provides a method for preparing a FRET probe, wherein the FRET probe is used for screening protease inhibitors, and the preparation method comprises the following steps:

[0052] S1, inserting the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequences for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector described in the first aspect, respectively, to obtain a FRET probe plasmid, wherein the fluorescent protein 1 and fluorescent protein 2 are both fluorescent proteins derived from corals or any one of the fluorescent protein 1 and fluorescent protein 2 is a fluorescent protein derived from corals; inserting the coding gene sequence of the SH3 domain ligand into the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene in the FRET probe plasmid, to obtain a FRET probe plasmid containing the SH3 domain ligand gene; inserting the protease recognition sequence gene into the FRET probe plasmid containing the SH3 domain ligand gene into the restriction endonuclease recognition site sequence for inserting the protease recognition sequence gene, to obtain a FRET probe plasmid containing the SH3 domain ligand gene-protease recognition sequence gene;

[0053] S2. Transforming the FRET probe plasmid containing the SH3 domain ligand gene-protease recognition sequence constructed in step S1 into a host bacterium, selecting positive clone bacteria containing the FRET probe plasmid containing the SH3 domain ligand gene-protease recognition sequence, and performing fermentation culture. After the fermentation culture is completed, the bacteria are collected, resuspended, and broken, and then the supernatant is collected, and the supernatant is purified by chromatography to obtain a FRET probe.

[0054] The ninth aspect of the present invention provides a FRET probe prepared using the preparation method described in the fourth, fifth, sixth, seventh or eighth aspect.

[0055] The tenth aspect of the present invention provides the use of the FRET probe prepared according to the ninth aspect in antibody detection, protease inhibitor screening, and FRET fluorescent protein pair screening.

[0056] The eleventh aspect of the present invention provides a method for screening a FRET fluorescent protein pair, comprising: searching for fluorescent protein 1 and fluorescent protein 2 that can potentially undergo FRET according to spectral characteristics, preparing a FRET probe containing fluorescent protein 1 and fluorescent protein 2 according to the FRET probe preparation method described in the fourth, seventh or eighth aspect above, and detecting the FRET efficiency of the fluorescent signal of the FRET probe; if the FRET efficiency of the fluorescent signal of the FRET probe meets the detection criteria, the fluorescent protein 1 and the fluorescent protein 2 are matched as a FRET fluorescent protein pair.

[0057] According to the above-mentioned screening method for FRET fluorescent protein pairs, preferably, the emission light of two fluorescent groups is detected by a multifunctional microplate reader, and the calculation formula of FRET efficiency is: Fa / (Fd+Fa), wherein Fa is the acceptor emission and Fd is the donor emission.

[0058] Compared with the prior art, the present invention has the following positive and beneficial effects:

[0059] (1) The modular plasmid vector for FRET probe construction of the present invention can be inserted with a suitable FRET fluorescent protein into the restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion and the restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion of the modular plasmid vector according to the needs of the prepared FRET probe, so as to construct a FRET probe, which can be used for fluorescent protein pair screening; moreover, the modular plasmid vector of the present invention is provided with an SH3 domain and a restriction endonuclease recognition site for SH3 domain ligand gene insertion, and different SH3 domain ligands can be inserted into the modular plasmid vector according to the sources of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair and the FRET efficiency of the prepared FRET probe, so as to meet the performance requirements of the FRET probe; in addition, even if the SH3 domain ligand gene does not need to be inserted into the modular plasmid vector when preparing the FRET probe, the presence of the SH3 domain in the modular plasmid will not affect the preparation of the FRET probe, nor will it affect the performance of the prepared FRET probe.

[0060] (2) The connecting chain in the modular plasmid vector for FRET probe construction of the present invention includes a connecting region 1 connected to a restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, a restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, a connecting region 2, a restriction endonuclease recognition site sequence for protease recognition sequence gene insertion, a connecting region 3, a restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and a connecting region 4, which are sequentially connected; therefore, the connecting chain region in the modular plasmid vector can be quickly modified and replaced according to the purpose of the FRET probe. For example, when the prepared FRET probe is a probe for antibody detection, the restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, the restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and the connecting region 4 can be directly inserted into the modular plasmid vector. The antigen epitope encoding gene corresponding to the antibody is inserted into the sequence; when the prepared FRET probe is a probe for protease inhibitor screening, the recognition sequence gene of the protease corresponding to the inhibitor can be directly inserted into the restriction endonuclease recognition site sequence for inserting the protease recognition sequence gene in the modular plasmid vector; in addition, the connection region 1, the connection region 2, the connection region 3, and the connection region 4 in the connection chain are designed to be universal. When constructing FRET probes for different purposes, the connection region 1, the connection region 2, the connection region 3, and the connection region 4 in the modular plasmid vector connection chain do not need to be adjusted. It is only necessary to insert the antigen epitope encoding gene corresponding to the antibody at the restriction endonuclease recognition site sequence for inserting the antigen epitope gene of the connection chain or to insert the protease recognition sequence gene at the restriction endonuclease recognition site sequence for inserting the protease recognition sequence gene according to the use of the probe.

[0061] (3) The modular plasmid vector of the present invention can quickly change and replace some regions of the modular plasmid vector according to the purpose of the constructed FRET probe, and can be used as a universal vector for the construction of FRET probes, which has good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 A schematic diagram of the structure of a modular plasmid vector provided in Example 1 of the present invention;

[0063] Figure 2 A diagram showing the structure of the modular plasmid vector pET-FRET vector provided in Example 1 of the present invention;

[0064] Figure 3 A diagram showing the gene sequence and structure of the modular probe construction region in the modular plasmid vector provided in Example 1 of the present invention;

[0065] Figure 4 The performance test result diagram of the TEV protease activity detection probe constructed by FRET fluorescent protein to ECEY;

[0066] Figure 5 The performance test result diagram of the TEV protease activity detection probe constructed by FRET fluorescent protein pair CYYP;

[0067] Figure 6 The performance test result of the TEV protease activity detection probe constructed by FRET fluorescent protein to MaMcy;

[0068] Figure 7 The performance test result of the TEV protease activity detection probe constructed by FRET fluorescent protein to L-MK;

[0069] Figure 8 This is a test result of the inhibitory effect of rheumatoid arthritis on Mpro protease;

[0070] Fig. 9 The graph is a fluorescence spectrum curve of the FRET probe for antibody detection after binding with the antibody; the dotted line represents the spectrum curve of the 0.2 mg / mL FRET probe in the 450-580 nm band, and the solid line represents the fluorescence spectrum curve of the 0.2 mg / mL FRET probe after binding with the HIVp24 polyclonal antibody for 5 minutes. DETAILED DESCRIPTION

[0071] The technical solution of the present invention is further described in detail below through specific implementation methods.

[0072] Unless otherwise specified, the terms used in the present invention are commonly used in the field. The technical means used in the examples, such as preparation processes, test methods, etc., are all conventional means well known to those skilled in the art, and the reagents and products used are all commercially available. The sources and trade names of the reagents used, as well as the components thereof, are indicated when they first appear.

[0073] Biomaterials: The pET28a vector was preserved in our laboratory, and the gene sequence of the modular region was synthesized by GeneWeiZhi Company; the synthesis of related primer sequences and gene sequencing were provided by Shanghai Bioengineering;

[0074] Experimental reagents: seamless cloning kit, a product of Novoprotein Technology Co., Ltd.; KOD enzyme, a product of Toyobo, Japan; restriction endonuclease and T4 ligase, products of Takara Biotechnology; plasmid extraction, gel recovery, agar powder, LB medium, Shanghai Biotech.

[0075] Embodiment 1:

[0076] A modular plasmid vector for constructing a FRET probe, the modular plasmid vector comprising a promoter, a ribosome binding site (RBS) and a terminator, wherein a modular probe assembly region is connected between the ribosome binding site and the terminator; the modular probe assembly region comprises an SH3 domain gene, a restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, a connecting chain, a restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, and a restriction endonuclease recognition site sequence for SH3 domain ligand gene insertion, which are connected in sequence; the connecting chain comprises a connecting region 1, a restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, a connecting region 2, a restriction endonuclease recognition site sequence for protease recognition sequence gene insertion, a connecting region 3, a restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and a connecting region 4, which are connected in sequence; the fluorescent protein 1 and the fluorescent protein 2 form a pair of FRET fluorescent proteins.

[0077] The restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, the restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, the restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, the restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and the restriction endonuclease recognition site sequence for protease recognition sequence gene insertion are all different; the restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, the restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, the restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, the restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and the restriction endonuclease recognition site sequence for protease recognition sequence gene insertion are all selected from any one of Nco I, Hind III, Eco53K I, BamHⅠ, XhoⅠ, Sal I, EcoR I, and Nde I restriction endonuclease recognition site sequences.

[0078] Furthermore, the modular probe assembly region also includes a purification tag gene and a TEV enzyme recognition sequence gene; the TEV enzyme recognition sequence gene is located upstream of the SH3 domain gene and connected to the SH3 domain gene; the purification tag gene is located upstream of the TEV enzyme recognition sequence gene and connected to the TEV enzyme recognition sequence gene.

[0079] Furthermore, the modular probe assembly region also includes a T7 RNAP guide region gene sequence, which is located upstream of the purification tag gene and connected to the purification tag gene; preferably, the purification tag gene is a polyhistidine purification tag gene, and the polyhistidine purification tag gene sequence is an 8×His purification tag.

[0080] Further, the promoter is a prokaryotic promoter or a eukaryotic promoter; preferably, the promoter is selected from any one of T7, T5, Sp6, lac, Ptac, trp, araBad, CMV, EF1a, CAG, PGK, TRE, U6, and UAS promoters;

[0081] Furthermore, a connecting segment is provided between the promoter and the ribosome binding site, one end of the connecting segment is connected to the promoter, and the other end of the connecting segment is connected to the ribosome binding site. The connecting segment may or may not contain an operator.

[0082] Furthermore, the terminator is a T7 terminator.

[0083] As a preferred embodiment, the modular plasmid vector pET-FRET (construction path schematic diagram as shown in FIG. Figure 1 The schematic diagram of the plasmid map structure is shown in Figure 2As shown), it includes a T7 promoter, a ribosome binding site (RBS) and a T7 terminator, a connecting segment is provided between the T7 promoter and the ribosome binding site (RBS), one end of the connecting segment is connected to the promoter, and the other end of the connecting segment is connected to the ribosome binding site, and a modular probe assembly region is connected between the ribosome binding site and the T7 terminator; the modular probe assembly region includes a T7 RNAP guide region gene sequence, an 8×His purification tag gene, a TEV enzyme recognition sequence gene, an SH3 domain gene sequence, a restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, a connecting chain, a restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, and a restriction endonuclease recognition site sequence for SH3 domain ligand gene insertion, which are connected in sequence. The connecting chain includes a connecting region 1, a restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, a connecting region 2, a restriction endonuclease recognition site sequence for protease recognition sequence gene insertion, a connecting region 3, a restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion and a connecting region 4, which are connected in sequence; the fluorescent protein 1 and the fluorescent protein 2 are a pair of FRET fluorescent protein pairs. Among them, the nucleotide sequence of the T7 promoter is shown in sequence 6; the connecting segment contains a lactose operon, and the nucleotide sequence of the connecting segment is shown in sequence 7; the nucleotide sequence of the ribosome binding site is shown in sequence 9. The nucleotide sequence of the T7 RNAP guide region gene sequence is shown in sequence 10. The nucleotide sequence of the 8×His purification tag gene is shown in sequence 11, and the nucleotide sequence of the TEV enzyme recognition sequence gene is shown in sequence 12; the nucleotide sequence of the T7 terminator is shown in sequence 13.The nucleotide sequence of the SH3 domain gene is shown in sequence 1, the nucleotide sequence of the connecting region 1 is shown in sequence 2, the nucleotide sequence of the connecting region 2 is shown in sequence 3, the nucleotide sequence of the connecting region 3 is shown in sequence 4, and the nucleotide sequence of the connecting region 4 is shown in sequence 5; the restriction endonuclease recognition site sequence for the insertion of the fluorescent protein 1 gene is the recognition site sequence of the restriction endonuclease Hind III (as shown in sequence 14); the restriction endonuclease recognition site sequence for the insertion of the fluorescent protein 2 gene is the recognition site sequence of the restriction endonuclease EcoR I (as shown in sequence 15); the restriction endonuclease recognition site sequence 1 for the insertion of the antigen epitope gene is the recognition site sequence of the restriction endonuclease BamHⅠ (as shown in sequence 16); the restriction endonuclease recognition site sequence for the insertion of the protease recognition sequence gene is the recognition site sequence of the restriction endonuclease XhoⅠ (as shown in sequence 17); the restriction endonuclease recognition site sequence 2 for the insertion of the antigen epitope gene is the recognition site sequence of the restriction endonuclease NdeI. I recognition site sequence (as shown in sequence 18); the restriction endonuclease recognition site sequence for SH3 domain ligand gene insertion is the recognition site sequence of restriction endonuclease SalI (as shown in sequence 19). The nucleotide sequence of the modular assembly region is shown in sequence 20. The gene sequence and structure of the modular plasmid vector pET-FRET of the present invention are shown in FIG. Figure 3 The nucleotide sequences involved in this embodiment are specifically shown in Table 1.

[0084] Table 1 Nucleotide sequences involved in this example

[0085]

[0086]

[0087]

[0088] The construction method of the above modular plasmid vector pET-FRET is:

[0089] (1) Linearization of pET28a vector: pET28a vector was used as the starting plasmid vector. Reverse primer P1 and forward primer P2 were designed for the downstream of the RBS sequence and the upstream of the T7 terminator of the pET28a vector sequence, respectively. PCR amplification of the pET28a vector was performed using reverse primer P1 and forward primer P2. After PCR amplification, the PCR product was digested with DpnI enzyme at 37 degrees Celsius for 1 hour, and then the digested PCR product was purified by agarose gel electrophoresis to obtain a linearized pET28a vector.

[0090] The nucleotide sequences of reverse primer P1 and forward primer P2 are:

[0091] Reverse primer P1: 5′-TATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG-3′,

[0092] Forward primer P2: 5′-CAAAGCCCGAAAGGAAGCTG-3′;

[0093] (2) Connection of vectors: artificially synthesize the modular probe assembly region nucleotide sequence of the modular plasmid vector pET-FRET (as shown in sequence 20), and install the modular probe assembly region nucleotide sequence on the pUC19 vector; design upstream amplification primer P3 (nucleotide sequence: 5′-CTTTAAGAAG GAGATATAATGAACACGATTAACATCGCTAAG-3′) and downstream amplification primer P4 (nucleotide sequence: 5′-CTTCCTTTCGGGCTTTGTTAGCAGCCGGATGGTCGAC-3′) according to the modular probe assembly region nucleotide sequence, and use the upstream amplification primer P3 and the downstream amplification primer P4 to perform PCR amplification on the modular probe assembly region nucleotide sequence installed on the pUC19 vector; mix the PCR amplification product of the modular probe assembly region nucleotide sequence with the linearized pET28a vector at a molecular molar ratio of 1:4, and add T4 PNK enzyme was treated at 37℃ for 1h to obtain a mixed solution; then 8μL of the mixed solution was aspirated from the reaction system and mixed with 2μL of homologous recombinase, incubated at 54℃ for 25min to obtain a ligation product, which was transformed into E. coli competent cells DH5α, and the transformed DH5α was coated on an LB solid culture plate containing kanamycin and cultured at 37℃ overnight; then the colonies were picked and identified by colony PCR using the above primers P2 and P3, and the PCR-positive clones were selected and sent to a sequencing company for sequencing, and the Sanger sequencing method was used to determine the connection results of the gene. Sequencing found that the nucleotide sequence of the modular probe assembly region was correctly connected to the pET28a vector, and the modular plasmid vector pET-FRET was obtained.

[0094] Embodiment 2:

[0095] A method for preparing a FRET probe comprises the following steps:

[0096] S1. Insert the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequence for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector pET-FRET constructed in Example 1, respectively, to obtain a FRET probe plasmid; wherein fluorescent protein 1 and fluorescent protein 2 are fluorescent proteins derived from jellyfish; insert a protease recognition sequence gene into the FRET probe plasmid at the restriction endonuclease recognition site sequence for inserting the protease recognition sequence gene, to obtain a FRET probe plasmid containing a protease recognition sequence gene.

[0097] Step S1 is specifically as follows:

[0098] S11, respectively design PCR primers for amplifying fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, respectively use the designed PCR primers to perform PCR amplification on fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, and purify PCR products by agarose gel electrophoresis after PCR amplification; use restriction endonucleases HindⅢ for fluorescent protein 1 gene insertion and EcoRⅠ for fluorescent protein 2 gene insertion to perform enzyme digestion on the modular plasmid vector pET-FRET constructed in Example 1; mix the modular plasmid vector pET-FRET after enzyme digestion with the PCR purified product of fluorescent protein coding gene at a molecular molar ratio of 1:4, add homologous recombinase and connect at 56°C for 30 minutes to obtain a connection product, transform the connection product into Escherichia coli competent cell DH5α, apply the transformed DH5α to LB solid culture plate containing kanamycin, and culture at 37°C overnight; then pick colonies for colony PCR identification, select PCR positive clones and send them to a sequencing company for sequencing, select the plasmid with correct sequencing, and obtain the FRET probe plasmid;

[0099] S12. Artificially synthesize a protease recognition sequence gene, design PCR primers for amplifying the protease recognition sequence gene, use the designed PCR primers to perform PCR amplification on the protease recognition site gene sequence, and purify the PCR product by agarose gel electrophoresis after the PCR amplification; use the restriction endonuclease XhoⅠ for protease recognition sequence gene insertion to perform enzyme digestion on the FRET probe plasmid and the PCR purified product of the protease recognition sequence gene respectively; mix the FRET probe plasmid after enzyme digestion with the PCR purified product of the protease recognition sequence gene after enzyme digestion at a molecular molar ratio of 1:4, add T4 DNA ligase and connect at 16°C for 4h to obtain a ligation product, transform the ligation product into Escherichia coli competent cells DH5α, spread the transformed DH5α on an LB solid culture plate containing kanamycin, and culture at 37°C overnight; then pick the colonies for colony PCR identification, select the PCR positive clones and send them to a sequencing company for sequencing, select the plasmid with the correct sequencing, and obtain the FRET probe plasmid containing the protease recognition sequence gene.

[0100] S2, the FRET probe plasmid containing the protease recognition sequence gene finally constructed in step S1 is transformed into the Escherichia coli BL21 host bacteria, and then the transformed Escherichia coli BL21 is coated on the LB solid culture plate containing kanamycin and cultured overnight at 37°C. The next day, a single colony was picked and inoculated into 10 ml of LB liquid culture medium containing kanamycin, and the culture was expanded at 1:50 after shaking overnight culture. After IPTG induction expression for 20 hours at 35°C, the bacteria were collected by high-speed centrifugation. After the bacteria were resuspended in buffer, ultrasonic disruption was performed, and the ultrasonic disruption liquid was centrifuged at high speed to remove insoluble substances and unbroken bacteria to obtain a supernatant. The supernatant was filtered with a 0.45 μM filter and purified by affinity chromatography according to the 8×His purification tag to obtain a FRET probe.

[0101] Embodiment 3:

[0102] A method for preparing a FRET probe comprises the following steps:

[0103] S1. Insert the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequence for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector pET-FRET constructed in Example 1, respectively, to obtain a FRET probe plasmid, wherein the fluorescent protein 1 and fluorescent protein 2 are both fluorescent proteins derived from corals or any one of the fluorescent protein 1 and fluorescent protein 2 is a fluorescent protein derived from corals; insert the coding gene sequence of the SH3 domain ligand into the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene in the FRET probe plasmid, to obtain a FRET probe plasmid containing the SH3 domain ligand gene; insert the protease recognition sequence gene into the FRET probe plasmid containing the SH3 domain ligand gene, to obtain a FRET probe plasmid containing the SH3 domain ligand gene-protease recognition sequence gene.

[0104] Step S1 is specifically as follows:

[0105] S11, respectively designing PCR primers for amplifying fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, respectively using the designed PCR primers to perform PCR amplification on fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, and purifying PCR products by agarose gel electrophoresis after PCR amplification; using restriction endonucleases HindⅢ for fluorescent protein 1 gene insertion and EcoRⅠ for fluorescent protein 2 gene insertion to perform enzyme digestion on the modular plasmid vector pET-FRET constructed in Example 1; mixing the modular plasmid vector pET-FRET after enzyme digestion with the PCR purified product of fluorescent protein coding gene at a molecular molar ratio of 1:4, adding homologous recombinase to connect at 56°C for 30 minutes to obtain a connection product, transforming the connection product into Escherichia coli competent cells DH5α, coating the transformed DH5α on an LB solid culture plate containing kanamycin, and culturing at 37°C overnight; then picking colonies for colony PCR identification, selecting PCR positive clones to send to a sequencing company for sequencing, selecting the plasmid with the correct sequencing, and obtaining the FRET probe plasmid;

[0106] S12, according to the SH3 domain gene in the FRET probe plasmid, the corresponding SH3 domain ligand gene sequence is artificially synthesized, PCR primers for amplifying the SH3 domain ligand gene sequence are designed, and the SH3 domain ligand gene sequence is amplified by PCR using the designed PCR primers. After the PCR amplification, the PCR product is purified by agarose gel electrophoresis; the FRET probe plasmid and the PCR purified product of the SH3 domain ligand gene sequence are respectively digested by the restriction endonuclease Sal I for SH3 domain ligand gene insertion; the FRET probe plasmid after digestion and the PCR purified product of the SH3 domain ligand gene sequence after digestion are mixed at a molecular molar ratio of 1:4, and T4 DNA ligase was used for ligation at 16°C for 4 hours to obtain a ligation product, which was transformed into Escherichia coli competent cells DH5α, and the transformed DH5α was spread on an LB solid culture plate containing kanamycin and cultured at 37°C overnight; then, colonies were picked for colony PCR identification, and PCR-positive clones were selected and sent to a sequencing company for sequencing, and the plasmid with the correct sequencing was selected to obtain the FRET probe plasmid containing the SH3 domain ligand gene.

[0107] S13, artificially synthesizing a protease recognition site gene sequence, designing PCR primers for amplifying the protease recognition site gene sequence, performing PCR amplification on the protease recognition site gene sequence using the designed PCR primers, and purifying the PCR product using agarose gel electrophoresis after the PCR amplification; using the restriction endonuclease XhoⅠ for protease recognition sequence gene insertion to perform enzyme digestion on the FRET probe plasmid containing the SH3 domain ligand gene and the PCR purified product of the protease recognition site gene sequence, respectively; mixing the FRET probe plasmid containing the SH3 domain ligand gene after enzyme digestion with the PCR purified product of the protease recognition sequence gene after enzyme digestion at a molecular molar ratio of 1:4, and adding T4 DNA ligase was used for ligation at 16°C for 4 hours to obtain a ligation product, which was transformed into Escherichia coli competent cells DH5α, and the transformed DH5α was spread on an LB solid culture plate containing kanamycin and cultured at 37°C overnight; then, colonies were picked for colony PCR identification, and PCR-positive clones were selected and sent to a sequencing company for sequencing, and the plasmid with the correct sequencing was selected to obtain a FRET probe plasmid containing the SH3 domain ligand gene-protease recognition sequence gene.

[0108] S2, the FRET probe plasmid containing the SH3 domain ligand gene-protease recognition sequence gene finally constructed in step S1 is transformed into the Escherichia coli BL21 host bacteria, and then the transformed Escherichia coli BL21 is coated on the LB solid culture plate containing kanamycin and cultured overnight at 37°C. The next day, a single colony was picked and inoculated into 10 ml of LB liquid culture medium containing kanamycin, and the culture was expanded at 1:50 after shaking overnight culture. After IPTG induction expression for 20 hours at 35°C, the bacteria were collected by high-speed centrifugation. After the bacteria were resuspended in buffer, ultrasonic disruption was performed, and the ultrasonic disruption liquid was centrifuged at high speed to remove insoluble substances and unbroken bacteria to obtain a supernatant. The supernatant was filtered with a 0.45 μM filter and purified by affinity chromatography according to the 8×His purification tag to obtain a FRET probe.

[0109] Embodiment 4:

[0110] A method for preparing a FRET probe, wherein the FRET probe is used for antibody detection, and the specific preparation method comprises the following steps:

[0111] S1. Insert the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequences for inserting fluorescent protein 1 and fluorescent protein 2 genes of the modular plasmid vector pET-FRET constructed in Example 1, respectively, to obtain a FRET probe plasmid; wherein fluorescent protein 1 and fluorescent protein 2 are fluorescent proteins derived from jellyfish; insert the antigen epitope coding gene of the antigen corresponding to the antibody to be tested into the restriction endonuclease recognition site sequence 1 for inserting the antigen epitope gene and the restriction endonuclease recognition site sequence 2 for inserting the antigen epitope gene in the FRET probe plasmid, respectively, to obtain a FRET probe plasmid containing the antigen epitope gene.

[0112] Step S1 is specifically as follows:

[0113] S11, respectively designing PCR primers for amplifying fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, respectively using the designed PCR primers to perform PCR amplification on fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, and purifying PCR products by agarose gel electrophoresis after PCR amplification; using restriction endonucleases XhoⅠ for fluorescent protein 1 gene insertion and EcoRⅠ for fluorescent protein 2 gene insertion to perform enzyme digestion on the modular plasmid vector pET-FRET constructed in Example 1; mixing the modular plasmid vector pET-FRET after enzyme digestion with the PCR purified product of the fluorescent protein coding gene at a molecular molar ratio of 1:4, adding homologous recombinase to connect at 56°C for 30 minutes to obtain a connection product, transforming the connection product into Escherichia coli competent cells DH5α, coating the transformed DH5α on an LB solid culture plate containing kanamycin, and culturing at 37°C overnight; then picking colonies for colony PCR identification, selecting PCR-positive clones to send to a sequencing company for sequencing, selecting the plasmid with the correct sequencing, and obtaining the FRET probe plasmid;

[0114] S12. Artificially synthesize an antigen epitope encoding gene sequence, design PCR primers for amplifying the antigen epitope encoding gene sequence, perform PCR amplification on the antigen epitope encoding gene sequence using the designed PCR primers, and purify the PCR product by agarose gel electrophoresis after the PCR amplification; use restriction endonucleases BamHⅠ and NdeⅠ for antigen epitope gene insertion to enzymatically digest the FRET probe plasmid; mix the FRET probe plasmid after enzymatic digestion with the PCR purified product of the antigen epitope encoding gene sequence at a molecular molar ratio of 1:4, add homologous recombinase, connect at 56°C for 30 minutes to obtain a connection product, transform the connection product into Escherichia coli competent cells DH5α, spread the transformed DH5α on an LB solid culture plate containing kanamycin, and culture at 37°C overnight; then pick the colony and send it to a sequencing company for sequencing, select the plasmid with the correct sequencing, and obtain the FRET probe plasmid containing the antigen epitope gene.

[0115] S2, the FRET probe plasmid containing the antigen epitope gene finally constructed in step S1 is transformed into the Escherichia coli BL21 host bacteria, and then the transformed Escherichia coli BL21 is coated on the LB solid culture plate containing kanamycin and cultured overnight at 37°C. The next day, a single colony was picked and inoculated into 10 ml of LB liquid culture medium containing kanamycin, and the culture was expanded at 1:50 after shaking overnight culture. After IPTG induction expression at 35°C for 20 hours, the bacteria were collected by high-speed centrifugation. After the bacteria were resuspended in buffer, ultrasonic disruption was performed, and the ultrasonic disruption liquid was centrifuged at high speed to remove insoluble substances and unbroken bacteria to obtain a supernatant. The supernatant was filtered with a 0.45 μM filter and purified by affinity chromatography according to the 8×His purification tag to obtain a FRET probe.

[0116] Embodiment 5:

[0117] A method for preparing a FRET probe, wherein the FRET probe is used for antibody detection, and the specific preparation method comprises the following steps:

[0118] S1. Insert the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequences for inserting fluorescent protein 1 and fluorescent protein 2 genes of the modular plasmid vector pET-FRET constructed in Example 1, respectively, to obtain a FRET probe plasmid; wherein, fluorescent protein 1 and fluorescent protein 2 are both fluorescent proteins derived from corals or any one of fluorescent protein 1 and fluorescent protein 2 is a fluorescent protein derived from corals; insert the coding gene sequence of the SH3 domain ligand into the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene in the FRET probe plasmid, to obtain a FRET probe plasmid containing the SH3 domain ligand gene; insert the antigen epitope coding gene of the antigen corresponding to the antibody to be tested into the restriction endonuclease recognition site sequence 1 for inserting the antigen epitope gene and the restriction endonuclease recognition site sequence 2 for inserting the antigen epitope gene in the FRET probe plasmid containing the SH3 domain ligand gene, respectively, to obtain a FRET probe plasmid containing the SH3 domain ligand gene-antigen epitope gene.

[0119] Step S1 is specifically as follows:

[0120] S11, respectively designing PCR primers for amplifying fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, respectively using the designed PCR primers to perform PCR amplification on fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, and purifying PCR products by agarose gel electrophoresis after PCR amplification; using restriction endonucleases HindⅢ for fluorescent protein 1 gene insertion and EcoRⅠ for fluorescent protein 2 gene insertion to perform enzyme digestion on the modular plasmid vector pET-FRET constructed in Example 1; mixing the modular plasmid vector pET-FRET after enzyme digestion with the PCR product of the fluorescent protein coding gene at a molecular molar ratio of 1:4, adding homologous recombinase to connect at 56°C for 30 minutes to obtain a connection product, transforming the connection product into Escherichia coli competent cells DH5α, coating the transformed DH5α on an LB solid culture plate containing kanamycin, and culturing at 37°C overnight; then picking colonies for colony PCR identification, selecting PCR-positive clones to send to a sequencing company for sequencing, selecting the plasmid with the correct sequencing, and obtaining the FRET probe plasmid;

[0121] S12. According to the SH3 domain gene in the FRET probe plasmid, the corresponding SH3 domain ligand gene sequence is artificially synthesized, PCR primers for amplifying the SH3 domain ligand gene sequence are designed, and the SH3 domain ligand gene sequence is amplified by PCR using the designed PCR primers. After the PCR amplification, the PCR product is purified by agarose gel electrophoresis; the FRET probe plasmid and the PCR purified product of the SH3 domain ligand gene sequence are respectively digested by the restriction endonuclease SalⅠ for SH3 domain ligand gene insertion; the FRET probe plasmid after digestion and the PCR purified product of the SH3 domain ligand gene sequence after digestion are mixed at a molecular molar ratio of 1:4, and T4 DNA ligase was used for ligation at 16°C for 4 hours to obtain a ligation product, which was transformed into Escherichia coli competent cells DH5α, and the transformed DH5α was spread on an LB solid culture plate containing kanamycin and cultured at 37°C overnight; then, colonies were picked for colony PCR identification, and PCR-positive clones were selected and sent to a sequencing company for sequencing, and the plasmid with the correct sequencing was selected to obtain the FRET probe plasmid containing the SH3 domain ligand gene.

[0122] S13, artificially synthesizing an antigen epitope encoding gene sequence, designing PCR primers for amplifying the antigen epitope encoding gene sequence, performing PCR amplification on the antigen epitope encoding gene sequence using the designed PCR primers, and purifying the PCR product by agarose gel electrophoresis after the PCR amplification; using restriction endonucleases BamHⅠ and NdeⅠ for antigen epitope gene insertion to digest the FRET probe plasmid containing the SH3 domain ligand gene and the PCR purified product of the antigen epitope encoding gene sequence; The T probe plasmid and the PCR purified product of the antigen epitope encoding gene sequence were mixed at a molecular molar ratio of 1:4, and homologous recombinase was added to connect at 56°C for 30 minutes to obtain a connection product. The connection product was transformed into Escherichia coli competent cells DH5α, and the transformed DH5α was spread on an LB solid culture plate containing kanamycin and cultured at 37°C overnight; then the colonies were picked for colony PCR identification, and the PCR-positive clones were selected and sent to a sequencing company for sequencing, and the plasmid with the correct sequencing was selected to obtain the FRET probe plasmid containing the SH3 domain ligand gene-antigen epitope gene.

[0123] S2, the FRET probe plasmid containing the SH3 domain ligand gene-antigen epitope gene finally constructed in step S1 is transformed into the Escherichia coli BL21 host bacteria, and then the transformed Escherichia coli BL21 is coated on the LB solid culture plate containing kanamycin and cultured overnight at 37°C. The next day, a single colony was picked and inoculated into 10 ml of LB liquid culture medium containing kanamycin, and the culture was expanded at 1:50 after shaking overnight culture. After IPTG induction expression for 20 hours at 35°C, the bacteria were collected by high-speed centrifugation. After the bacteria were resuspended in buffer, ultrasonic disruption was performed, and the ultrasonic disruption liquid was centrifuged at high speed to remove insoluble substances and unbroken bacteria to obtain a supernatant. The supernatant was filtered with a 0.45 μM filter and purified by affinity chromatography according to the 8×His purification tag to obtain a FRET probe.

[0124] Embodiment 6:

[0125] A method for preparing a FRET probe comprises the following steps:

[0126] S1. Insert the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequence for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector pET-FRET constructed in Example 1, respectively, to obtain a FRET probe plasmid; wherein fluorescent protein 1 and fluorescent protein 2 are fluorescent proteins derived from jellyfish.

[0127] Step S1 is specifically as follows:

[0128] S11, respectively design PCR primers for amplifying fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, respectively use the designed PCR primers to perform PCR amplification on fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, and purify PCR products by agarose gel electrophoresis after PCR amplification; use restriction endonucleases HindⅢ for fluorescent protein 1 gene insertion and EcoRⅠ for fluorescent protein 2 gene insertion to perform enzyme digestion on the modular plasmid vector pET-FRET constructed in Example 1; mix the modular plasmid vector pET-FRET after enzyme digestion with the PCR purified product of fluorescent protein coding gene at a molecular molar ratio of 1:4, add homologous recombinase and connect at 56°C for 30 minutes to obtain a connection product, transform the connection product into Escherichia coli competent cell DH5α, apply the transformed DH5α to LB solid culture plate containing kanamycin, and culture at 37°C overnight; then pick colonies for colony PCR identification, select PCR positive clones and send them to a sequencing company for sequencing, select the plasmid with correct sequencing, and obtain the FRET probe plasmid;

[0129] S2. The FRET probe plasmid finally constructed in step S1 was transformed into the Escherichia coli BL21 host bacteria, and then the transformed Escherichia coli BL21 was coated on a LB solid culture plate containing kanamycin and cultured overnight at 37°C. The next day, a single colony was picked and inoculated into 10 ml of LB liquid culture medium containing kanamycin, and the culture was expanded at 1:50 after shaking overnight culture. After IPTG induction expression at 35°C for 20 hours, the bacteria were collected by high-speed centrifugation. After the bacteria were resuspended in buffer, ultrasonic disruption was performed, and the ultrasonic disruption liquid was centrifuged at high speed to remove insoluble substances and unbroken bacteria to obtain a supernatant. The supernatant was filtered with a 0.45 μM filter and purified by affinity chromatography according to the 8×His purification tag to obtain a FRET probe.

[0130] Embodiment 7:

[0131] A method for preparing a FRET probe comprises the following steps:

[0132] S1. Insert the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequence for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector pET-FRET constructed in Example 1, respectively, to obtain a FRET probe plasmid, wherein the fluorescent protein 1 and fluorescent protein 2 are both fluorescent proteins derived from corals or any one of the fluorescent protein 1 and fluorescent protein 2 is a fluorescent protein derived from corals; insert the coding gene sequence of the SH3 domain ligand into the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene in the FRET probe plasmid, to obtain a FRET probe plasmid containing the SH3 domain ligand gene.

[0133] Step S1 is specifically as follows:

[0134] S11, respectively designing PCR primers for amplifying fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, respectively using the designed PCR primers to perform PCR amplification on fluorescent protein 1 coding gene and fluorescent protein 2 coding gene, and purifying PCR products by agarose gel electrophoresis after PCR amplification; using restriction endonucleases HindⅢ for fluorescent protein 1 gene insertion and EcoRⅠ for fluorescent protein 2 gene insertion to perform enzyme digestion on the modular plasmid vector pET-FRET constructed in Example 1; mixing the modular plasmid vector pET-FRET after enzyme digestion with the PCR purified product of fluorescent protein coding gene at a molecular molar ratio of 1:4, adding homologous recombinase to connect at 56°C for 30 minutes to obtain a connection product, transforming the connection product into Escherichia coli competent cells DH5α, coating the transformed DH5α on an LB solid culture plate containing kanamycin, and culturing at 37°C overnight; then picking colonies for colony PCR identification, selecting PCR positive clones to send to a sequencing company for sequencing, selecting the plasmid with the correct sequencing, and obtaining the FRET probe plasmid;

[0135] S12, according to the SH3 domain gene in the FRET probe plasmid, the corresponding SH3 domain ligand gene sequence is artificially synthesized, PCR primers for amplifying the SH3 domain ligand gene sequence are designed, and the SH3 domain ligand gene sequence is amplified by PCR using the designed PCR primers. After the PCR amplification, the PCR product is purified by agarose gel electrophoresis; the FRET probe plasmid and the PCR purified product of the SH3 domain ligand gene sequence are respectively digested by the restriction endonuclease Sal I for SH3 domain ligand gene insertion; the FRET probe plasmid after digestion and the PCR purified product of the SH3 domain ligand gene sequence after digestion are mixed at a molecular molar ratio of 1:4, and T4 DNA ligase was used for ligation at 16°C for 4 hours to obtain a ligation product, which was transformed into Escherichia coli competent cells DH5α, and the transformed DH5α was spread on an LB solid culture plate containing kanamycin and cultured at 37°C overnight; then, colonies were picked for colony PCR identification, and PCR-positive clones were selected and sent to a sequencing company for sequencing, and the plasmid with the correct sequencing was selected to obtain the FRET probe plasmid containing the SH3 domain ligand gene.

[0136] S2. The FRET probe plasmid containing the SH3 domain ligand gene finally constructed in step S1 is transformed into the Escherichia coli BL21 host bacteria, and then the transformed Escherichia coli BL21 is coated on the LB solid culture plate containing kanamycin and cultured overnight at 37°C. The next day, a single colony was picked and inoculated into 10 ml of LB liquid culture medium containing kanamycin, and the culture was expanded at 1:50 after shaking overnight culture. After IPTG induction expression for 20 hours at 35°C, the bacteria were collected by high-speed centrifugation. After the bacteria were resuspended in buffer, ultrasonic disruption was performed, and the ultrasonic disruption liquid was centrifuged at high speed to remove insoluble substances and unbroken bacteria to obtain a supernatant. The supernatant was filtered with a 0.45 μM filter and purified by affinity chromatography according to the 8×His purification tag to obtain a FRET probe.

[0137] Embodiment 8:

[0138] The screening method of FRET fluorescent protein pairs is as follows:

[0139] A. Preparation of FRET probes: According to the spectral characteristics, fluorescent protein pairs mAmetrine-mCyRFP1 (MaMcy), LSSmOrange-mKate2 (L-MK), ECFP-EYFP (ECEY), and CyPet-YPet (CYYP) that can potentially undergo FRET are searched, wherein the fluorescent protein pairs MaMcy and L-MK are both derived from coral fluorescent proteins, and the fluorescent protein pairs ECEY and CYYP are both derived from jellyfish fluorescent proteins; FRET probes containing the fluorescent protein pair ECEY and FRET probes containing the fluorescent protein pair CYYP are prepared according to the FRET probe preparation method described in Example 2, and FRET probes containing the fluorescent protein pair ECEY and FRET probes containing the fluorescent protein pair CYYP are prepared. When preparing the FRET probe, the artificially synthesized protease recognition sequence gene in step S12 is the TEV protease recognition sequence gene (the specific nucleotide sequence is GAAAACCTGTACTTCCAATCC); according to the FRET probe preparation method described in Example 3, a FRET probe containing a fluorescent protein pair MaMcy and a FRET probe containing a fluorescent protein pair L-MK are prepared respectively, and when preparing the FRET probe containing a fluorescent protein pair MaMcy and a FRET probe containing a fluorescent protein pair L-MK, the artificially synthesized SH3 domain ligand gene sequence in step S12 is GGCGGCAGCCCTCTGCCACCGTATACCACCGGT, and the artificially synthesized protease recognition sequence gene in step S13 is the TEV protease recognition sequence gene.

[0140] B. FRET probe spectral analysis: Use SpectraMax i3 microplate reader to monitor the fluorescence signal and FRET effect of the four FRET probes constructed in step A. If the FRET efficiency of the fluorescence signal of the FRET probe meets the detection standard, fluorescent protein 1 and fluorescent protein 2 are a pair of FRET fluorescent protein pairs. The specific operation is: use Nanodrop to adjust the concentration of various probes, add 1-40μmol of probes to different ELISA plate wells in turn, then add 5μmol of TEV protease to each well, and make up the volume to 200μl with protein buffer; at the same time, set blank control wells without TEV protease for each concentration probe. Use SpectraMax i3 microplate reader to monitor the emission light of the emission group and the receptor group, detect once every 5 minutes, and shake the ELISA plate for 30 seconds before detection.

[0141] The FRET effect detection results of the FRET probes containing fluorescent protein for MaMcy, the FRET probes containing fluorescent protein for L-MK, the FRET probes containing fluorescent protein for ECEY, and the FRET probes containing fluorescent protein for CYYP constructed in this example are as follows: Figure 4-Figure 7 shown.

[0142] Depend on Figure 4-Figure 7 It can be seen that the FRET probe containing the fluorescent protein pair MaMcy, the FRET probe containing the fluorescent protein pair L-MK, the FRET probe containing the fluorescent protein pair ECEY, and the FRET probe containing the fluorescent protein pair CYYP can all produce FRET effects, but the enzyme cleavage curve shows that the spectrum of the FRET probe containing the fluorescent protein pair MaMcy changes greatly at different concentrations, and the signal of the donor group is too high, which is not suitable as a probe; the slope of the enzyme cleavage curve of the FRET probe containing the fluorescent protein pair ECEY at different concentrations is basically the same, while the slope of the enzyme cleavage line of the FRET probe containing the fluorescent protein pair L-MK and the FRET probe containing the fluorescent protein pair CYYP at different concentrations is different, and at a concentration of 1μmol / L, the tangent slope of the enzyme cleavage curve of the FRET probe containing the fluorescent protein pair CYYP is greater than that of ECEY, and the speed of TEV protease hydrolyzing the ECEY probe is slower than that of CYYP. Therefore, as a FRET probe for detecting TEV protease activity, the most suitable one is the CYYP fluorescent protein pair.

[0143] Embodiment 9:

[0144] The method for preparing a FRET probe for screening SARS-CoV 2 virus Mpro protease inhibitors is specifically as follows: using the fluorescent protein pair CyPet-YPet (CYYP) screened in Example 8 as a fluorescent protein pair constructed by a probe, preparing a FRET probe for screening SARS-CoV 2 virus Mpro protease inhibitors containing the fluorescent protein pair CYYP according to the FRET probe preparation method described in Example 2, and when preparing the FRET probe, the protease recognition sequence gene artificially synthesized in step S12 is the SARS-CoV 2 virus Mpro protease recognition sequence gene (the Mpro protease recognition sequence gene is AGCGGTGGCGCAGTTCTGCAGAGCGGCTTTCGTGGTGGTAGTTAA).

[0145] The method for screening Mpro protease inhibitors using the FRET probe constructed in this embodiment is as follows: add Mpro protease to a reaction vessel, then add different compound molecules, mix well, and then add the above-prepared FRET probe for screening Mpro protease inhibitors to the reaction vessel, detect the emission light of the emission group and the receptor group of the reaction solution in the reaction vessel, and judge whether the added compound is an inhibitor of Mpro protease according to the change in the fluorescence spectrum of the reaction solution. If the compound is an inhibitor of Mpro protease, the compound will bind to the active center of Mpro protease, interfere with the activity of Mpro protease, cause the Mpro protease to hydrolyze the probe speed or not, and then cause the FRET probe fluorescence spectrum signal to change slowly or not; if the compound is not an inhibitor of Mpro protease, the compound will not bind to Mpro protease, will not inhibit the activity of Mpro protease, and will not affect the speed of Mpro protease hydrolysis probe.

[0146] The specific operation is as follows: add 5μmol Mpro protease to the 1st to 6th wells of the ELISA plate, then add 2mM / L emodin (10ul) to the 1st to 3rd wells, add buffer to the 4th to 6th wells, and then add 20μmol / L probe (5ul) to the 1st to 6th wells respectively, and mix by pipetting; add 20μmol / L probe (5ul) to the 7th to 9th wells of the ELISA plate, then add buffer to the 7th to 9th wells, use buffer to make up the volume in the wells to 200μL, and mix by pipetting; use SpectraMaxi3 ELISA reader to monitor the emission light of the emission group and the receptor group in the 1st to 9th wells of the ELISA plate, detect once every 5 minutes, and shake the ELISA plate for 30s before detection. The results are as follows Figure 8 shown.

[0147] Depend on Figure 8 It can be seen that the tangent slope of the enzymatic hydrolysis curve of the wells with added rhein is lower than that of the wells without added compounds, indicating that rhein has inhibitory activity on the activity of Mpro protease hydrolysis probe. Therefore, rhein is an inhibitor of Mpro protease and has an inhibitory effect on the maturation of SARS-CoV-2 virus.

[0148] Embodiment 10:

[0149] The method for preparing a FRET probe for antibody detection against HIV (AIDS) P24 antigen is specifically as follows: using the fluorescent protein pair CyPet-YPet (CYYP) screened in Example 8 as a fluorescent protein pair constructed by a probe, preparing a FRET probe for antibody detection containing the fluorescent protein pair CYYP according to the FRET probe preparation method described in Example 4, and when preparing the FRET probe, the antigen epitope encoding gene sequence artificially synthesized in step S12 is the antigen epitope encoding gene sequence of HIV P24 antigen (the antigen epitope encoding gene sequence of the artificially synthesized HIV P24 antigen is CCTATCGTCCAGAACCTGCAGGGCCAGATG GTG).

[0150] 1. Broad spectrum analysis of the FRET probe for antibody detection prepared in this example:

[0151] The FRET probe for antibody detection constructed in this embodiment (hereinafter referred to as P24 probe) was subjected to spectral analysis. The specific operation was as follows: 120 μl of 0.2 mg / mL p24 probe was mixed with 480 μL of 10 μg / mL p24 polyclonal antibody and incubated at room temperature for 5 minutes; at the same time, 120 μl of 0.2 mg / mL p24 probe was mixed with 480 μL of buffer as a control. A fluorescence spectrophotometer was used to detect the spectral changes after the P24 probe bound to the antibody. The excitation light wavelength was set to 434 nm, the slit was 1 nm, the data interval was 2 nm, and the fluorescence intensity of 450 nm-580 nm was detected. The experimental results are shown in Figure 2. Fig. 9 shown.

[0152] from Fig. 9It can be seen that when the probe is not combined with p24 polyclonal antibody, the fluorescence intensity of the acceptor group yPet (maximum wavelength emitted at 477nm) is much higher than that of the donor group CyPet (maximum wavelength emitted at 528nm), and when the probe is combined with p24 polyclonal antibody, the fluorescence signal of the donor group CyPet is enhanced. When p24 antibody is added, it binds to the antigen epitope in the probe, and the antibody arm destroys the dimerization of the fluorescent protein, increases the distance between the fluorescent proteins, weakens the FRET effect, and the fluorescence intensity of the probe at 477nm increases, and the ratio of 530 / 477nm decreases. The change in the ratio of 530 / 477nm can reflect the binding of the antibody to the probe.

[0153] 2. Application of the FRET probe for antibody detection prepared in this example in the detection of clinical serum samples:

[0154] (1) Experimental samples: 42 serum samples from confirmed HIV-positive patients (containing HIV antibodies) and 6 serum samples from normal subjects (not containing HIV antibodies) were collected.

[0155] (2) Experimental method: 80 μl of each serum sample from the above collected experimental samples was mixed with 20 μl of 0.2 mg / mL P24 probe, incubated at room temperature for 5 min, and the fluorescence values ​​at 477 nm and 528 nm were read using a SpectraMax i3 microplate reader, and the 528 / 477 nm fluorescence intensity ratio was calculated. The test results are shown in Table 2.

[0156] Table 2 Results of antibody detection probe CYYP in serum for HIV antibody detection

[0157]

[0158]

[0159] As shown in Table 2, the average value of the 528 / 477nm fluorescence intensity ratio of 6 normal human sera after binding with the probe is 1.8591, and the 528 / 477nm fluorescence intensity ratio of 42 HIV patient sera after binding with the probe is lower than 1.8; the reason is that the antibody weakens the FRET effect after binding with the FRET probe, the emission light of the acceptor group is weakened, the emission light of the donor group is enhanced, and the ratio of the two decreases. This shows that the P24 probe provided in this embodiment can be used to detect HIV antibodies, thereby distinguishing between the serum of healthy examinees and the serum of HIV patients.

[0160] In summary, the modular plasmid vector of the present invention can quickly change and replace some regions of the modular plasmid vector according to the purpose of the constructed FRET probe, and can be used as a universal vector for the construction of FRET probes, and is used to prepare probes for protease inhibitor screening and antibody detection probes, and has good application value.

[0161] The above embodiments are intended to illustrate the essential content of the present invention, but are not intended to limit the protection scope of the present invention. Those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and protection scope of the technical solution of the present invention.

Claims

1. A modular plasmid vector for FRET probe construction, characterized in that: The modular plasmid vector comprises a promoter, a ribosome binding site and a terminator, wherein a modular probe assembly region is connected between the ribosome binding site and the terminator; the modular probe assembly region comprises a sequentially connected SH3 domain gene, a restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, a connecting chain, a restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, and a restriction endonuclease recognition site sequence for SH3 domain ligand gene insertion; the connecting chain comprises a sequentially connected connecting region 1, a restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, a connecting region 2, a restriction endonuclease recognition site sequence for protease recognition sequence gene insertion, a connecting region 3, a restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and a connecting region 4; the fluorescent protein 1 and the fluorescent protein 2 are a pair of FRET fluorescent protein pairs.

2. The modular plasmid vector for FRET probe construction according to claim 1, characterized in that: The modular probe assembly region also includes a T7 RNAP guide region gene sequence, a purification tag gene and a TEV enzyme recognition sequence gene; the TEV enzyme recognition sequence gene is located upstream of the SH3 domain gene and is connected to the SH3 domain gene; the purification tag gene is located upstream of the TEV enzyme recognition sequence gene and is connected to the TEV enzyme recognition sequence gene; the T7 RNAP guide region gene sequence is located upstream of the purification tag gene and is connected to the purification tag gene.

3. The modular plasmid vector for FRET probe construction according to claim 1 or 2, characterized in that: The restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, the restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, the restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, the restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and the restriction endonuclease recognition site sequence for protease recognition sequence gene insertion are all different; the restriction endonuclease recognition site sequence for fluorescent protein 1 gene insertion, the restriction endonuclease recognition site sequence for fluorescent protein 2 gene insertion, the restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion, the restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion, and the restriction endonuclease recognition site sequence for protease recognition sequence gene insertion are all selected from Nco I, Hind I, and Hind II. , Eco53K I, BamH Ⅰ, Xho Ⅰ, Sal I, EcoR I, Nde I restriction endonuclease recognition site sequence; The nucleotide sequence of the SH3 domain gene is shown in Sequence 1, which is: TTTGAAATTCCGGATGATGTGCCCCTGCCTGCAGGCTGGGAAATGGCCAAAACCAGCAGCGGTCAAAGATACTTCAAGAACCACATCGACCAGACCACAACCTGGCAGGACCCGCGTAAAGCCATGCTGAGCCAGATGGGCGGAAGCGGTAGTGGTGGCAGCGGCAGCGGGGGTTCCGGCAGTGGTGGAAGCGGC; The nucleotide sequence of the connecting region 1 is shown in sequence 2, and sequence 2 is: GGCGGCTCTGGGGGT; The nucleotide sequence of the connecting region 2 is shown in Sequence 3, which is: GGTTCAGGTAGCGGTGGCAGCGGTGGTAGCGGCGGTAGCGGTGGTAGCGGCGGCTCTGGCGCCGAGGCAGCGGCAAAAGAAGCTGCAGCCAAGGAAGCAGCAGCAAAAGAAGCCGCTGCCAAGGAGGCCGCTGCCAAGGAAGCCGCCGCCAAGGCCGGCTCTGGCGGTAGCGGAGGCTCCGGC; The nucleotide sequence of the connecting region 3 is shown in Sequence 4, which is: GGTAGCGGTGGCAGCGGCGGCAGCGGTGCAGAAGCAGCAGCAAAAGAGGCCGCAGCCAAAGAGGCTGCCGCAAAAGAAGCAGCCGCCAAGGAAGCCGCTGCAAAAGAGGCCGCCGCCAAAGCAGGTAGTGGTGGCAGCGGCGGCAGCGGTGGCAGCGGTGGCAGCGGCGGATCTGGAGGAAGC; The nucleotide sequence of the connecting region 4 is shown in Sequence 5, which is: GGCTCCGGCGGCAGCGGC.

4. Use of the modular plasmid vector for constructing FRET probes according to any one of claims 1 to 3 in preparing FRET probes and screening FRET fluorescent protein pairs.

5. A method for preparing a FRET probe, characterized in that: include: S1, inserting the coding gene sequences of fluorescent protein 1 and fluorescent protein 2 in the FRET fluorescent protein pair into the restriction endonuclease recognition site sequence for inserting fluorescent protein 1 and fluorescent protein 2 genes in the modular plasmid vector according to any one of claims 1 to 3, respectively, to obtain a FRET probe plasmid; S2, transforming the FRET probe plasmid finally constructed in step S1 into the host bacteria, selecting the positive clone bacteria containing the FRET probe plasmid, and performing fermentation culture. After the fermentation culture is completed, the bacteria are collected, resuspended, and the bacteria are crushed, and then the supernatant is collected, and the supernatant is purified by affinity chromatography to obtain the FRET probe; Both the fluorescent protein 1 and the fluorescent protein 2 are fluorescent proteins derived from jellyfish or corals; wherein, when both the fluorescent protein 1 and the fluorescent protein 2 are fluorescent proteins derived from corals or when either the fluorescent protein 1 or the fluorescent protein 2 is a fluorescent protein derived from corals, the step S1 further comprises: inserting the coding gene sequence of the SH3 domain ligand into the restriction endonuclease recognition site sequence for inserting the SH3 domain ligand gene in the FRET probe plasmid to obtain a FRET probe plasmid containing the SH3 domain ligand gene.

6. The preparation method according to claim 5, characterized in that: The FRET probe is used for antibody detection, and the step S1 also includes: inserting the antigen epitope encoding gene of the antigen corresponding to the antibody to be detected into the restriction endonuclease recognition site sequence 1 for antigen epitope gene insertion and the restriction endonuclease recognition site sequence 2 for antigen epitope gene insertion in the FRET probe plasmid or the FRET probe plasmid containing the SH3 domain ligand gene, respectively, to obtain a FRET probe plasmid containing the antigen epitope gene or a FRET probe plasmid containing the SH3 domain ligand gene-antigen epitope gene.

7. The preparation method according to claim 5, characterized in that: The FRET probe is used for screening protease inhibitors, and the step S1 also includes: inserting the protease recognition sequence gene into the FRET probe plasmid or the FRET probe plasmid containing the SH3 domain ligand gene at the restriction endonuclease recognition site sequence for protease recognition sequence gene insertion to obtain a FRET probe plasmid containing a protease recognition sequence gene or a FRET probe plasmid containing an SH3 domain ligand gene-protease recognition sequence gene.

8. A FRET probe prepared by the preparation method according to any one of claims 5 to 7.

9. Use of the FRET probe according to claim 8 in antibody detection, protease inhibitor screening, and FRET fluorescent protein pair screening.

10. A method for screening FRET fluorescent protein pairs, characterized in that: include: According to the spectral characteristics, fluorescent protein 1 and fluorescent protein 2 that can potentially produce FRET effect are found, and a FRET probe containing fluorescent protein 1 and fluorescent protein 2 is prepared according to the preparation method of the FRET probe according to any one of claims 5-7, and the fluorescent protein signal of the FRET probe is detected and the FRET efficiency is calculated. If the FRET efficiency of the fluorescent signal of the FRET probe meets the detection standard, the fluorescent protein 1 and the fluorescent protein 2 are matched as a FRET fluorescent protein pair.

Images