Construction method and application of specific annular RNA probe

Abstract

The invention relates to a kit for detecting the sensitivity of kidney cancer to a targeted drug, which comprises an RNA (Ribonucleic Acid) nucleic acid probe, and the sequence of the RNA nucleic acid probe is shown as SEQ ID NO: 4. The invention also provides a construction method of the specific annular RNA probe. The construction method comprises the following steps: S1, designing and constructing a recombinant plasmid containing a target gene; s2, constructing a tricRNA (Ribonucleic Acid) vector containing a reverse complementary sequence crossing a backspace junction site and a Broccoli sequence, wherein the reverse complementary sequence crossing the backspace junction site and the Broccoli sequence are subjected to reverse complementary sequence crossing the backspace junction site; s3, carrying out vector transfection on the HEK293T cell to express a tricRNA probe, and extracting the tricRNA probe; and S4, constructing a tricAGAP1 Probe-Broccoli probe. The method comprises the following steps of: constructing a tricAGAP1 probe; the invention provides application of a probe in preparation of a cell imaging probe and in preparation of a kit for detecting sensitivity of kidney cancer to a targeted drug. The invention not only provides a new method and technology for guiding the medication of sunitinib for patients with advanced kidney cancer, but also provides a technical example for the development of other circRNA detection technologies.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a construction method and application of a specific circular RNA probe. Background Art

[0002] With the increasing development of high-throughput sequencing technology and bioinformatics, circular RNA (circRNA) as an important member of the non-coding RNA family has gradually attracted people's attention, and it has been found that they are involved in the occurrence and development of various diseases. CircRNA is associated with the occurrence of various diseases such as cardiovascular system, neurodevelopmental and degenerative diseases, blood system and tumors. It is abundant in various body fluids such as blood and saliva, and has great potential to become a molecular marker for early diagnosis and prognosis of diseases. However, the current detection of circRNA expression in tumor tissues requires static detection through surgery, puncture to obtain tissues, or through peripheral blood CTC sorting, which has the above-mentioned limitations. Molecular imaging technology provides the possibility of non-invasive, real-time, in situ quantitative detection of abnormally expressed circRNA in lesions in vivo.

[0003] American scientist Matera et al. discovered a new method for constructing circRNA vectors, proposing to replace the intron sequence of tRNA with circRNA to obtain tricRNA vectors. On this basis, we explore new technical methods for the expression changes of circRNA, so as to perform non-invasive, in vivo, real-time, dynamic and sensitive detection of circRNA, and thus achieve accurate diagnosis of diseases and prediction of disease progression.

[0004] We know that linear RNA probes for detecting circRNA are very easily degraded by nucleases after entering the body, and their half-life after entering the body is often from a few seconds to a few minutes. Therefore, modifications such as thiophosphorylation are required, but the modified monomers have poor stability, long coupling time, and low efficiency, so the final yield is naturally lower than that of general primers. Modified primers usually require PAGE or HPLC purification, and the purification process has large losses. The raw materials used in modified primers are hundreds of times that of general primer raw materials, so the price of the product is naturally high. Moreover, the 3' terminal base cannot be modified by thiophosphorylation, because when it is dissociated from the solid support, the phosphate bond no longer exists, and the 3' terminal base is OH.

[0005] We can observe various behaviors of living cells and living bodies through green fluorescent protein GFP. The closed circular structure formed by reverse shearing of the reverse complementary precursor RNA at the end makes circRNA not easily degraded by RNase. It has certain tissue specificity and time sequence specificity. It is abundant in body fluids and is expected to become a potential clinical diagnosis and treatment marker with great application prospects.

[0006] Circular RNA research also urgently needs a simple, direct and living cell and in vivo labeling method similar to fluorescent proteins. This is an extremely useful tool for in-depth research on the functional mechanism of circular RNA.

[0007] It is crucial to construct fluorescent circular probes for detecting circular RNA (taking circ0058792 as an example) for tracing circular RNA in cells.

[0008] Chinese patent document CN111696627A discloses a design method for a long-chain RNA-specific probe; the long-chain RNA-specific probe can simultaneously detect the expression abundance or differential expression of at least two long-chain RNAs among mRNA, circular RNA or long-chain non-coding RNA. The long-chain RNA-specific probe obtained by the design method of the present invention has high sensitivity and strong specificity, and can simultaneously, rapidly and high-throughput detect the expression abundance of regulatory RNA molecules such as circular RNA and long-chain non-coding RNA and mRNA of expressed proteins in trace samples.

[0009] However, there are no reports on the construction method and application of a specific circular RNA probe. Summary of the invention

[0010] The purpose of the present invention is to provide a method for constructing a specific circular RNA probe and its application in view of the deficiencies in the prior art.

[0011] In a first aspect, the present invention provides a kit for detecting the sensitivity of renal cancer to targeted drugs, comprising an RNA nucleic acid probe, wherein the sequence of the RNA nucleic acid probe is shown in SEQ ID NO:4.

[0012] As a preferred example, the targeted drug is sunitinib.

[0013] In a second aspect, the present invention provides the use of a kit in preparing a reagent for detecting the sensitivity of renal cancer to targeted drugs.

[0014] As a preferred example, the targeted drug is sunitinib.

[0015] In a third aspect, the present invention provides a specific circular RNA probe, wherein the probe is prepared by the following steps:

[0016] S1: Design and construct a recombinant plasmid containing the target gene;

[0017] S2: construct a tricRNA vector containing a reverse complementary sequence across the backsplice junction site and a Broccoli sequence;

[0018] S3: vector transfected HEK293T cells to express tricRNA probes, and tricRNA probes were extracted;

[0019] S4: Construction of tricAGAP1 Probe-Broccoli probe.

[0020] As a preferred example, the method further includes S5: preparing a Tet-on vector for inducing expression of miR-4297 / AGO2 to promote degradation of unbound probes.

[0021] In a third aspect, the present invention provides the use of the probe in preparing a cell imaging probe.

[0022] In a fourth aspect, the present invention provides use of the probe in preparing a kit for detecting the sensitivity of renal cancer to targeted drugs.

[0023] In a fifth aspect, the present invention provides a method for constructing a specific circular RNA probe, comprising the following steps:

[0024] S1: Design and construct a recombinant plasmid containing the target gene;

[0025] S2: construct a tricRNA vector containing a reverse complementary sequence across the backsplice junction site and a Broccoli sequence;

[0026] S3: vector transfected HEK293T cells to express tricRNA probes, and tricRNA probes were extracted;

[0027] S4: Construction of tricAGAP1 Probe-Broccoli probe.

[0028] As a preferred example, the method further includes S5: preparing a Tet-on vector for inducing expression of miR-4297 / AGO2 to promote degradation of unbound probes.

[0029] The advantages of the present invention are that circular RNA is abundant in body fluids, urine and blood, and has strong specificity and good stability. It has been found that abnormal expression of circular RNA is closely related to a variety of diseases such as the cardiovascular system, nervous system, respiratory system, osteoarthritis and malignant tumors. In addition, articles published by Nature and other journals have reported that circular RNA has great application potential and has the possibility of becoming a disease marker. The successful design of the tricRNA Probe-Broccoli probe can track the distribution of circular RNA in vivo, providing new opportunities for the development of living cell and living body biosensors, instant diagnosis and even real-time diagnosis technology. At present, the use of circRNA as an RNA probe has not been reported internationally. The present invention not only provides new methods and technologies for guiding the use of sunitinib in patients with advanced renal cancer, but also provides a technical example for the expansion of other circRNA detection technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : Vector map.

[0031] Figure 2 : Sequencing result diagram.

[0032] Figure 3 :tricRNA vector construction.

[0033] Figure 4 :Construction diagram of the fluorescent circular probe (tric58792Probe-Broccoli) used to detect circ0058792 (taking circ0058792 as an example).

[0034] Figure 5 A: Construction of tricRNA vector; B: Construction diagram of the fluorescent circular probe (tricAGAP1Probe-Broccoli) for detecting circAGAP1; C: Synthesis of the fluorescent / paramagnetic dual-modal probe - tricAGAP1Probe-Broccoli for detecting circAGAP1.

[0035] Figure 6 :The miRDB database predicted that the probe targeting tricAGAP1 predicted 5 miRs that bind to the probe sequence, of which 3 sites were in the reverse sequence part, miR-4297 was located in the middle position, and the other two were located at the edge. By measuring its effect on the half-life of the probe, miR-4297 was screened.

[0036] Figure 7 : Comparison chart between high-sensitivity group and low-sensitivity group. DETAILED DESCRIPTION

[0037] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0038] Example 1

[0039] 1. Method

[0040] (1) Basic description of previous work: In our previous research, we successfully identified several new renal cancer-specific circRNAs and conducted a series of studies. We have published two papers (Journal of Cancer, 2020, IF: 3.565) [1] and (Journal of Experimental & Clinical Cancer Research, 2021, IF: 12.1) [2]. We reported that circAGAP1 (circbase name circ0058792, chip ID circ102949) was the circRNA with the highest upregulation in renal cancer (Foldchange = 21.42, p < 0.001) [1]. In addition, the level of circAGAP1 in tissue samples of patients with advanced renal cancer who received ST treatment was significantly higher than that in the insensitive group. ROC curve analysis showed the sensitivity and specificity of circAGAP1 in predicting ST treatment sensitivity (AUC = 0.905, p < 0.001), suggesting that circAGAP1 is very likely to be a potential biomarker for predicting ST treatment sensitivity. Detection in a variety of renal cancer cells found that circAGAP1 in highly sensitive cell lines was significantly higher than that in low-sensitive and resistant cells, indicating that the expression level of circAGAP1 was positively correlated with ST sensitivity.

[0041] Why is circAGAP1 level associated with ST sensitivity and does it regulate the molecular targets of ST? Given the multi-target nature of ST, combined with Khella et al.'s report that miRNAs targeting VEGFR may be used as biomarkers to predict ST remission rate [3], and our first report on the specific targeted complementary binding of miR-15a-5p and circAGAP1 [2], and in-depth analysis found that the target genes of miR-15a-5p include VEGFR2, the main specific target of ST. Finding multiple miRNA targets of circAGAP1 as a core hub molecule has become a breakthrough direction. In the early stage of our project, we found through the CircBank database that circAGAP1 can bind to another 50 miRNAs in addition to targeting miR-15a-5p. Further, through the Targetscan database, we found that as many as 13 of these miRNAs have more than one binding site for mRNAs of genes such as PDGFRA (encoding PDGFRα), PDGFRB (encoding PDGFRβ), FLT1 (encoding VEGFR-1) and KdR (encoding VEGFR2). Therefore, we collectively refer to these 13 associated miRNAs as miR-X (see Fig. 2 and Table 1 for site information and possible target genes), suggesting that circAGAP1 may be a super circRNA that regulates ST treatment sensitivity. Related results have been published [4].

[0042] We know that linear RNA probes for detecting circRNA are very easily degraded by nucleases after entering the body. Since circular circRNA cannot be end-labeled, it is more difficult to trace. American scientist Matera et al. discovered a new method for circRNA vector construction and tracing—tricRNA, which greatly solved the problem of linear RNA probe degradation; the fluorescent aptamer Broccoli sequence solved the effect of directly labeling nucleotides on RNA stability and binding specificity [5,6].

[0043] On this basis, we constructed the target gene recombinant plasmid

[0044] (2) Design and construct a recombinant plasmid containing the target gene

[0045] 1) Overexpression cloning target gene information

[0046] Gene name Gene seq Source Length Company Number Broccoli-Junction-Broccoli / / 566bp HY-KL-01942

[0047] 2) Cloning vector information

[0048]

[0049]

[0050] See the vector map for Figure 1

[0051] 3) Synthetic oligo information

[0052] oligo name oligo single-stranded DNA sequence 5' to 3'

[0053] HY-KL-01942-P1(EcoRV)CGAATGCATCTAGATCCAATGAGGGCCTATTTCCCATGATTC(SEQID NO:1)

[0054] HY-KL-01942-P2(EcoRV)GGCCCGGGATCCGATAAAAAACCGACAAAGAAAACGGAAG(SEQ IDNO:2)

[0055] 4) Experimental results

[0056] aSequencing results analysis

[0057] The sequencing and splicing results are as follows:

[0058] tacctcgcgaatgcatctagatccaatGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAG

[0059] GCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAG

[0060] TAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGA

[0061] AAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTGCTCGCTTCGGCAGCACATATA

[0062] CTATGGCCGACCAAATAGCGACGCCTTCGATAGCTCAGTTGGTAGAGCGGTGGACTGTAGAGTGCGGCCGCGAGA

[0063] CGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTCTGTTCACGAAGGCATCGTCCTGGAAGACCC

[0064] GAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTCGTGGCCGCGGTGTTGAAATCCATAGG

[0065] TCGCTGGTTCAAATCCGGCTCGAAGGATATTATTTTGGGTTTTCTTCCGTTTTCTTTGTCGGTTTTTTattggatcggatcccgggcc(SEQ ID NO:3)

[0066] Note: Lowercase bases are vector sequences, and uppercase bases are inserted into the customer's target sequence;

[0067] bSequencing results are shown in Figure 2

[0068] (3) Construct a tricRNA vector containing the reverse complementary sequence across the backsplice junction site and the Broccoli sequence. For the construction of the tricRNA vector, see Figure 3

[0069] (4) Transfect HEK293T cells with the vector to express tricRNA probes, and extract tricRNA probes: After RNA extraction, RNA exonuclease digestion removes linear RNA to obtain tricRNA probes. On this basis, tric58792Probe-Broccoli is transfected into engineered cells for large-scale expression and purification to produce fluorescent probes for circRNA tracing. The construction model of the fluorescent circular probe (tric58792Probe-Broccoli) used to detect circ0058792 is shown in Figure 4 .

[0070] (5) Construction of tricAGAP1 Probe-Broccoli Probe

[0071] 1) Insert the reverse sequence gene of 40 nt before and after the junction site and two Broccoli sequences into the middle of the tricRNA intron. Incubate tricAGAP1 Probe-Broccoli with DFHBI-1T-NH2-SPIO to combine and form the final product tricRNA-DFHBI-1T-SPIO probe. The two are incubated together to form a probe that can convert the fluorescent signal into a magnetic signal: a certain amount of tricRNA-Broccoli is dispersed in a mixed solution of EDC / NHS with a certain molar mass ratio (pH=5, PBS solution). Then, add an appropriate amount of DFHBI-1T-NH2-SPIO to the above mixed solution, stir at room temperature for 24 hours, collect by centrifugation, wash with deionized water 2-3 times, and finally disperse in PBS solution to obtain the tricAGAP1 Probe-Broccoli-SPIO probe, referred to as tricAGAP1 SPIO probe. See tricRNA vector construction for details. Figure 5 .

[0072] (6) Preparation of Tet-on inducible expression of miR-4297 / AGO2 vector to promote degradation of unbound probes

[0073] Based on the technique of miRNA mediating AGO2 degradation of circRNA in a sequence-dependent manner, we used the miRDB database to design a miRNA (miR-4297) that overexpresses the reverse complementary sequence of the binding probe to promote the degradation of the unbound probe. Figure 6 .

[0074] 2. Results and Analysis

[0075] We can observe living cells through green fluorescent protein GFP. The closed circular structure formed by reverse shearing of the reverse complementary precursor RNA at the end makes circRNA not easily degraded by RNase. It has certain tissue specificity and time sequence specificity. It is abundant in body fluids and is expected to become a potential clinical diagnosis and treatment marker with great application prospects. Figure 7 .

[0076] Circular RNA research also urgently needs a simple, direct and living cell and in vivo labeling method similar to fluorescent proteins. tricRNA Probe-Broccoli is a fluorescent probe used for circRNA tracing, which is an extremely useful tool for in-depth research on the functional mechanism of circular RNA.

[0077] RNA nucleic acid probe sequence such as SEQ ID NO:4

[0078] RNA-seq:

[0079] FASTA format: NCBI ID, gene name, length

[0080]

[0081] Contains the underline mark of the interface junction sequence

[0082] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention. These improvements and supplements should also be regarded as the scope of protection of the present invention.

[0083] References

[0084] (1)Lv Q, Ma C, Li H, Tan X, Wang G, Zhang Y, Wang P. Circular RNA microarray expression profile and potential function of circ0005875in clear cell renal cell carcinoma. J Cancer 2020,11(24):7146-7156.

[0085] (2)Lv Q,Wang G,Zhang Y,Shen A,Tang J,Sun Y,Ma C,Wang P.CircAGAP1promotes tumor progression by sponging miR-15-5p in clear cell renal cellcarcinoma.J Exp Clin Cancer Res 2021,40(1):76.

[0086] (3)Khella HWZ,Butz H,Ding Q,Rotondo F,Evans KR,Kupchak P,Dharsee M,Latif A,Pasic MD,Lianidou E,Bjarnason GA,Yousef GM.miR-221 / 222Are Involved inResponse to Sunitinib Treatment in MetastaticRenal Cell Carcinoma.Mol Ther2015,23(11):1748-1758.

[0087] (4)QI LV1,#,GANGMIN WANG2,#,YI HONG1,TIANYI ZHU1,SHUANG QIN1,SAIFEISUN1,YUTINGWANG1,YAOHUA LIU1,QING ZHANG1,CHUNHUI MA3,*,PEIJUN WANG1*。CircularRNAcircAGAP1 promotes sunitinib sensitivity in renal cell carcinoma viasponging multiple PDGFR-targetedmiRNAs.Oncology research.2024, / doi:10.32604 / or.2024.047698

[0088] (5)Noto JJ,Schmidt CA,Matera AG:Engineering and expressing circularRNAs via tRNA splicing.RNA Biol2017,14(8):978-984.

[0090] (6)Schmidt CA,Noto JJ,Filonov GS,Matera AG:A Method for Expressingand Imaging Abundant,Stable,Circular RNAs In Vivo Using tRNA Splicing.In:Visualizing Rna Dynamics in the Cell.Volume 572,edn.Edited by Filonov GS,Jaffrey SR.San Diego:Elsevier Academic Press Inc;2016:215-236.

Claims

1. A kit for detecting the sensitivity of renal cancer to targeted drugs, characterized in that: It comprises an RNA nucleic acid probe, and the sequence of the RNA nucleic acid probe is shown in SEQ ID NO:

4.

2. The kit according to claim 1, characterized in that The targeted drug is sunitinib.

3. Use of the kit according to claim 1 or 2 in the preparation of a reagent for detecting the sensitivity of renal cancer to targeted drugs.

4. The use according to claim 3, characterized in that: The targeted drug is sunitinib.

5. A specific circular RNA probe, characterized in that: The probe is prepared by the following steps: S1: Design and construct a recombinant plasmid containing the target gene; S2: construct a tricRNA vector containing a reverse complementary sequence across the backsplice junction site and a Broccoli sequence; S3: vector transfected HEK293T cells to express tricRNA probes, and tricRNA probes were extracted; S4: Construction of tricAGAP1 Probe-Broccoli probe.

6. The probe according to claim 5, characterized in that It also includes S5: preparing a Tet-on inducible expression miR-4297 / AGO2 vector to promote degradation of unbound probes.

7. The probe according to claim 5, characterized in that: The probe is used in preparing cell imaging probes.

8. The probe according to claim 5, characterized in that: The probe is used in preparing a kit for detecting the sensitivity of renal cancer to targeted drugs.

9. A method for constructing a specific circular RNA probe, characterized in that: The following steps are involved: S1: Design and construct a recombinant plasmid containing the target gene; S2: construct a tricRNA vector containing a reverse complementary sequence across the backsplice junction site and a Broccoli sequence; S3: vector transfected HEK293T cells to express tricRNA probes, and tricRNA probes were extracted; S4: Construction of tricAGAP1 Probe-Broccoli probe.

10. The construction method according to claim 9, characterized in that: It also includes S5: preparing a Tet-on inducible expression miR-4297 / AGO2 vector to promote degradation of unbound probes.

Images