Monoclonal antibody 27E7 for resisting PCV2 Cap protein as well as preparation method and application method of monoclonal antibody 27E7

Abstract

The invention relates to the technical field of biology, and aims to provide a monoclonal antibody 27E7 for resisting PCV2Cap protein as well as a preparation method and an application method of the monoclonal antibody 27E7. The monoclonal antibody comprises Ig structural domains VH CDR1, VH CDR2 and VH CDR3 of a heavy chain of the antibody, and Ig structural domains VL CDR1, VL CDR2 and VL CDR3 of a light chain of the antibody, wherein the amino acid sequences of the VH CDR1, the VH CDR2 and the VH CDR3 are respectively as shown in SEQ ID NO: 1 to SEQ ID NO: 3; the amino acid sequences of the VL CDR1, the VL CDR2 and the VL CDR3 are respectively as shown in SEQ ID NO: 4 to SEQ ID NO: 6. The monoclonal antibody provided by the invention is an IgG1 subtype, and has the advantages of high titer, strong specificity, high affinity and the like; the kit has high sensitivity and strong specificity, and has no cross reaction with other genotypes of porcine circoviruses; the kit can be further used for development of PCV2 diagnostic kits, and can be effectively popularized and applied to PCV2 diagnosis.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a monoclonal antibody 27E7 against PCV2 Cap protein and a preparation and application method thereof. Background Art

[0002] Porcine circovirus (PCV) belongs to the Circoviridae family and is one of the smallest viruses known so far. There are four main genotypes of PCV, namely type I (PCVl), type II (PCV2), type III (PCV3), and type IV (PCV4). Among them, PCV2 is the most pathogenic and is the main pathogen of postweaning multisystemic wasting syndrome (PMWS). Infected pigs can excrete the virus from nasal fluid, feces, etc., and infect pigs of different ages through the oral and respiratory routes. PCV2 infection can also cause immunosuppression and secondary infection with various other pathogens. PCV2 has become one of the main pathogens that seriously hinder the development of the pig industry.

[0003] PCV2 Cap protein is the main immunogenic protein of porcine circovirus and an ideal target antigen for PCV2 subunit vaccines. It can be further assembled into virus-like particles (VLPs) without viral nucleic acid, retaining the antigenic epitopes (linearity and conformation) of the virus to the greatest extent. In existing reports, monoclonal antibodies against PCV2 are mainly monoclonal antibodies against Cap protein. The antigenic protein for preparing PCV2 monoclonal antibodies is mainly obtained through a prokaryotic expression system. The protein has low activity and immunogenicity and no VLPs structure, which leads to the limitation of the viral antigenic epitopes recognized by the monoclonal antibodies prepared therefrom.

[0004] Therefore, the present application intends to propose a new monoclonal antibody to solve the above technical problems. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a monoclonal antibody 27E7 against PCV2 Cap protein and a preparation and application method thereof.

[0006] To solve the technical problem, the solution of the present invention is:

[0007] Provided is a monoclonal antibody 27E7 against PCV2 Cap protein, wherein the monoclonal antibody comprises the Ig domain V of the antibody heavy chain H CDR1, V H CDR2 and V H CDR3, and the Ig domain V of the antibody light chain L CDR1, VL CDR2 and V L CDR3; wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3 respectively; L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6, respectively.

[0008] As a preferred embodiment of the present invention, the monoclonal antibody is a full-length antibody, a Fab antibody or a F(ab')2 antibody.

[0009] As a preferred embodiment of the present invention, in the monoclonal antibody, the amino acid sequence of the light chain variable region is shown as SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.8.

[0010] The present invention further provides a gene encoding the aforementioned monoclonal antibody, wherein the gene sequence encoding the light chain variable region is shown as SEQ ID NO.9, and the gene sequence encoding the heavy chain variable region is shown as SEQ ID NO.10.

[0011] The present invention also provides a method for preparing the aforementioned monoclonal antibody, comprising the following steps:

[0012] (1) Based on the PCV2 Cap protein gene sequence shown in SEQ ID NO: 11, the specific primers shown in SEQ ID NO. 12 and SEQ ID NO. 13 were used to construct a recombinant plasmid having the PCV2 Cap protein gene sequence;

[0013] (2) PCV2 Cap protein was induced to express using a prokaryotic expression system, and after purification, it was dialyzed for VLP self-assembly to obtain PCV2 Cap-VLP protein;

[0014] (3) Animal immunization with PCV2 Cap-VLP protein;

[0015] (4) Through hybridoma monoclonal antibody technology, positive hybridoma cells were screened and monoclonalized, and the monoclonal antibody 27E7 against PCV2 Cap protein was obtained after identification.

[0016] The present invention also provides an application method of any one of the above-mentioned monoclonal antibodies, which is to prepare a kit for detecting PCV2 using the monoclonal antibody.

[0017] The present invention also provides a kit for detecting PCV2 virus, which comprises any one of the aforementioned monoclonal antibodies.

[0018] As a preferred embodiment of the present invention, the kit is an ELISA detection kit or an immunohistochemistry kit, and the detection method when using the kit is serological detection.

[0019] Compared with the prior art, the technical effects of the present invention are:

[0020] 1. The monoclonal antibody against PCV2 Cap protein provided by the present invention is of IgG1 subtype, and has the advantages of high titer, strong specificity, high affinity, etc.

[0021] 2. The monoclonal antibody provided by the present invention has high sensitivity and strong specificity, and has no cross-reaction with porcine circovirus of other genotypes.

[0022] 3. The monoclonal antibody provided by the present invention can be further used in the development of diagnostic kits for PCV2, which can effectively promote and apply PCV2 diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The SDS-PAGE and Western blot analysis of the PCV2 Cap-VLP protein expressed and purified in Example 1.

[0024] Figure 2 The transmission electron microscopy image and dynamic light scattering analysis image of the PCV2 Cap-VLP protein in Example 1.

[0025] Figure 3 This is an analysis of serum antibody titers after mice were immunized with PCV2 Cap-VLP protein in Example 2.

[0026] Figure 4 This is the titer determination analysis of the PCV2 Cap 27E7 monoclonal antibody in Example 2.

[0027] Figure 5 This is the specificity analysis of the PCV2 Cap 27E7 monoclonal antibody in the Western blot method in Example 3. This monoclonal antibody does not react with PCV3 Cap.

[0028] Figure 6 This is the specificity analysis of the PCV2 Cap 27E7 monoclonal antibody in the ELISA method in Example 3. The monoclonal antibody does not react with PCV3 Cap.

[0029] Figure 7This is the application of the PCV2 Cap 27E7 monoclonal antibody in Example 4 to detect PCV2 in the Western blot method.

[0030] Figure 8 This is the application of the PCV2 Cap 27E7 monoclonal antibody in Example 5 to detect PCV2 in the indirect immunofluorescence method. DETAILED DESCRIPTION

[0031] The present invention further dialyzes the prokaryotic expression system to obtain PCV2Cap protein with high purity, good activity and VLPs structure, and immunizes mice to obtain a monoclonal hybridoma cell line secreting specific anti-PCV2 Cap capsid protein.

[0032] "CDR" (complementarity-determining regions) is called complementarity-determining region or complementarity-determining cluster in immunology. It is a short segment of Ig and TCR protein, which contains most of the sequence differences between different Ig or TCR and can contact with antigen. In the monoclonal antibody against PCV2 Cap protein described in the present invention, there are 3 CDRs on each antigen receptor polypeptide chain, and 6 CDRs on each complete Ig or TCR molecule, namely VH CDR1, VH CDR2 and VH CDR3, and VLCDR1, VL CDR2 and VL CDR3, where VH and VL refer to the Ig domain of the antibody heavy chain and antibody light chain, respectively. These "hypervariable" segments are shown as ring structures, which together form a surface that can complement the three-dimensional structure of the antigen.

[0033] Example 1: Preparation of PCV2-Cap-VLP protein

[0034] Experimental methods:

[0035] (1) Construction of recombinant expression plasmid: The codon-optimized PCV2 Cap protein gene sequence is shown in SEQ ID NO: 11. Specific primers (F: atatacatatgcatcatcatcatcatcatagccatcttggccagatcctccg, sequence SEQ ID NO.12; R: cttgtaatcgtggtggtggtggtggtgcttagggttaagtggggggtctttaag, sequence SEQ ID NO.13) were used to perform PCR with the codon-optimized PCV2 Cap sequence as a template. The PCV2 Cap sequence was ligated to the PET30a expression vector using the homologous recombination method. The ligation product was transferred to 50 μL of E. coli DH5α competent cells, and after heat shock transformation, it was spread on an LB plate containing kanamycin resistance. After the positive clones were sequenced correctly by the company, the positive recombinant plasmid was transformed into the E. coli Rosseta (DE3) expression strain. After overnight culture at 37°C, single colonies were selected and placed in 5 mL of LB liquid culture medium containing kanamycin, and the culture was shaken and stored.

[0036] (2) Prokaryotic expression: The expression strain containing the pET30a-PCV2-Cap plasmid was cultured overnight. 10 mL of the overnight culture product was re-inoculated into 400 mL of fresh LB medium containing kanamycin (100 μg / mL) and cultured at 37°C and 220 rpm. When the OD600 value reached 0.6-0.8, isopropylthiogalactoside (IPTG) was added at a final concentration of 1 mM and the expression of the recombinant protein was induced overnight at 16°C and 120 rpm.

[0037] (3) Protein purification: Collect the cells by centrifugation at 4°C and 5000 rpm for 10 min, and resuspend the cells in PBS buffer. Then, use an ultrasonic cell crusher in an ice bath to break the cells, and the ultrasonic conditions are 150W, 60 min, 4s on and 4s off, until the cells are completely lysed. Subsequently, collect the supernatant by centrifugation at 4°C and 12000 rpm for 15 min, and remove impurities with a 0.22μm cell filter. Then add the supernatant to the pre-equilibrated Ni-NTA agarose gel and combine overnight on a shaker at 4°C. Add the protein-containing agarose gel to a gravity protein purification column, and use the prepared gradient imidazole dilution buffer (200mMNaCl, 50mMTris, 50mM-500mM imidazole, pH=7.4) to gradually elute the target protein by affinity chromatography. Collect the eluted target protein, aliquot, and store at -20°C.

[0038] (4) SDS-PAGE analysis: Prepare SDS-PAGE gel; take 60 μL of purified flow-through, 50 mM imidazole wash buffer, 100 mM imidazole wash buffer, and 500 mM imidazole elution buffer, add 15 μL of 5× Loading Buffer, mix well by pipetting, and heat in a boiling water pot for 10 min; assemble the electrophoresis tank, fill it with electrophoresis buffer, load the sample, and perform electrophoresis at 80 V for 30 min and then 120 V for 90 min; after the electrophoresis, place the gel in Coomassie brilliant blue dye solution, shake on a shaker at 37°C for 2 h for staining, and then place it in decolorizing solution for decolorization. Change the decolorizing solution every 1 h. After the bands are clearly visible, place it on a gel imager to take pictures and observe the results.

[0039] (5) Western blot analysis: The 500mM imidazole eluate (containing the target protein) was subjected to SDS-PAGE electrophoresis. Transfer: Cut off the PVDF membrane of the same size as the polyacrylamide gel to be transferred, pre-treat the PVDF membrane with methanol for 2 minutes to activate its surface, and then transfer it to the wet transfer buffer for immersion. Assemble the transfer device in the order of (+) thick sponge-thin filter paper-PVDF membrane-gel-thin filter paper-thick sponge (-), and then use the wet transfer method to transfer the protein, setting the constant current condition to 200mA, 50min. After the transfer is completed, the PVDF membrane is placed in a blocking solution containing 5% skim milk powder TBST (Tris buffered saline solution, containing 0.1% Tween 20) and blocked at 37°C on a shaker for 1h. After the blocking is completed, the PVDF membrane is washed 3 times with TBST, each time for 5min. Primary antibody incubation: dilute mouse His monoclonal antibody with 0.5% skim milk powder at 1:2000, and incubate overnight at 4°C on a shaker. Wash the PVDF membrane with TBST 3 times, 5 min each time. Secondary antibody incubation: dilute HRP-labeled goat anti-mouse secondary antibody with 0.5% skim milk powder at 1:5000, and incubate at 37°C on a shaker for 1 h. Wash the PVDF membrane with TBST 3 times, 5 min each time. Add 200 μL of color development solution and place it on a gel imager to take pictures and record the experimental results.

[0040] (6) Transmission electron microscopy observation of VLP assembly: The purified target protein was transferred to a dialysis bag, and the imidazole solution environment was replaced with 10 mM PBS at 4°C for 48 h. The external PBS solution was replaced every 24 h. The dialyzed protein solution was added to the copper mesh and incubated for 30 s, then the excess liquid was removed with filter paper, and the copper mesh was allowed to air dry naturally. 2% phosphotungstic acid (PTA, Ph=6.8) was added to the copper mesh for negative staining for 60 s, and the excess liquid was removed with filter paper, and the copper mesh was allowed to air dry naturally. The copper mesh loaded with protein was placed in a transmission electron microscope, and the self-assembly ability of the protein was observed at an accelerating voltage of 80 kV and photographed for preservation.

[0041] (7) Dynamic light scattering identification of particle diameter: Place the fresh protein solution in a centrifuge tube and seal it with a sealing film. Store it at low temperature and send it to Shanghai Aofa Meijia Company for dynamic light scattering (DLS, USA, PSS, Nicomp) analysis to measure the hydrodynamic diameter and size distribution of PCV2 Cap-VLP.

[0042] Experimental results:

[0043] The codon-optimized PCV2 Cap gene fragment (654 bp) was connected to the PET30a vector, and the recombinant PET30a-PCV2 Cap plasmid was obtained by PCR and sequencing verification. The recombinant plasmid was further introduced into the expression host bacteria Rosseta (DE3), and after induction of expression at 16°C, the PCV2 Cap target protein with high purity was successfully obtained by nickel column purification, with a size of about 27 kDa and a protein concentration of 0.25 mg / mL. The SDS-PAGE of the PCV2 Cap protein purification results is attached. Figure 1 -A, Western Blot results are attached Figure 1 -B. After further dialysis, the purified PCV2 Cap protein was used to detect the particle assembly and particle size of PCV2Cap-VLP using transmission electron microscopy and dynamic light scattering. Transmission electron microscopy observations showed that PCV2-Cap proteins were able to self-assemble into VLPs (see Appendix Figure 2 -A). Dynamic light scattering analysis showed that the main particle diameter of PCV2 Cap-VLP was 21.3nm (see Appendix Figure 2 -B). The obtained PCV2 Cap-VLP protein can be used for subsequent monoclonal antibody preparation.

[0044] Example 2: Preparation of PCV2 Cap Monoclonal Antibody

[0045] Experimental methods:

[0046] (1) Animal immunization: The purified recombinant PCV2 Cap-VLP protein was emulsified with Seppic-206 adjuvant at a ratio of 1:1 and immunized 8-week-old Balb / c mice at multiple points on the back subcutaneously. Boost immunization was performed every two weeks. After 4 immunizations, blood was collected from the mouse orbits to determine the antibody titer of the serum. Three days before cell fusion, the recombinant PCV2 Cap-VLP protein was injected intraperitoneally for shock immunization.

[0047] (2) Cell fusion: Obtain fresh blood and spleen from immunized mice. Separate the blood to obtain serum, which is used as a positive control for monoclonal antibody screening. Place the spleen in a well of a six-well plate, wash and remove tissue, fascia and fat outside the spleen. Place the washed spleen on a copper mesh. Crush the spleen with a sterilized test tube until the spleen is crushed and filtered through the copper mesh. Transfer the filtered cells to a centrifuge tube and centrifuge at 1200 rpm and 28°C for 10 minutes. Place four 75 cm 2 The SP2 / 0 cells in the square bottle were resuspended with 1640 medium, transferred to a centrifuge bottle, and centrifuged at 1200rpm, 28℃ for 10min. The cells obtained in the above two steps were resuspended with medium and combined into one bottle, and centrifuged at 1200rpm, 28℃ for 10min. Resuspend and centrifuge with new medium and wash again, then discard the supernatant. Suspend the centrifuge tube in a 37℃ water bath, drip PEG1450 preheated at 37℃ within 1min, shake the centrifuge tube while dripping, let it stand for 30s, then drip 1mL 1640 medium within 1min, let it stand for 30s, then drip 2mL, 3mL, 4mL, 5mL, 6mL 1640 medium within 1min, and let it stand for 30s to terminate the fusion. Centrifuge at 1200 rpm, 28°C for 10 min, discard the supernatant, add 1640 screening medium (containing triple antibody + 20% serum + 50×HAT) to resuspend, divide into 10 96-well plates, and culture at 37°C.

[0048] (3) Screening of positive hybridoma cells and monoclonal production: Positive hybridoma cells were screened using the established ELISA detection method. 5 μg / mL recombinant PCV2 Cap-VLP protein was used to coat the cells overnight at 4°C. After discarding the solution, the cells were washed three times with PBST for 5 min each time. 200 μL of blocking solution was added to each well, and the cells were blocked at 37°C for 2 h and then discarded. The cells were washed three times with PBST for 5 min each time. The hybridoma culture supernatant was added to the corresponding wells of the detection ELISA plate at 100 μL / well, incubated at 37°C for 1 h, then discarded and washed three times with PBST for 5 min each time. Positive and negative mouse sera were diluted 4000 times as positive and negative controls, respectively. Goat anti-mouse enzyme-labeled secondary antibody was diluted 1:5000 with secondary antibody diluent, and 100 μL / well was added to the ELISA plate. The cells were reacted at 37°C for 1 h, and then washed three times with PBST for 5 min each time. 100 μL of TMB colorimetric solution was added to each well and reacted at 37°C in the dark for 10 min. Add 50 μL 2M H2SO4 to each well to stop color development, measure the absorbance value at 450 nm, and screen positive hybridoma cells based on the reading value.

[0049] Resuspend the cells in the positive wells with complete medium containing HAT, count the cells, dilute according to the monoclonal dilution, and add to the 96-well plate, and culture at 37°C for 10 days. Observe the cell growth, add 50 μL of medium every 3-4 days, and take 100 μL of cell supernatant for ELISA detection on the 10th day to preliminarily determine the positive monoclonal cell line and preserve it.

[0050] (4) Preparation of monoclonal antibody ascites and titer determination: 8-week-old female Balb / c mice were selected and intraperitoneally injected with 1 mL of sterilized liquid paraffin. Seven days after the injection, the monoclonal hybridoma cell line was prepared with 1640 medium at a concentration of approximately 2×10 6 The cell suspension of each mouse was prepared. The prepared hybridoma cell suspension was injected intraperitoneally again. About 7 days after cell inoculation, the mouse abdomen was obviously swollen, and the abdominal fluid was carefully extracted. The ascites was centrifuged at 13000rpm / min for 10min, the supernatant was collected, and stored in aliquots at -20℃. After the mouse ascites was diluted in proportion, the antibody titer of the ascites was determined according to the established ELISA method.

[0051] Experimental results:

[0052] After mice were immunized with recombinant PCV2 Cap-VLP protein multiple times, the serum antibody titer was >1:128000 after ELISA test. Figure 3 As shown. After the mouse spleen cells with high serum titer were fused with myeloma cells, a high-affinity anti-PCV2 Cap specific monoclonal antibody was successfully obtained through multiple rounds of ELISA screening, named 27E7. 10mL of mouse ascites was further prepared, and the ascites titer was >1∶128000 by ELISA test. The results are shown in the attached Figure 4 shown.

[0053] Example 3: Specificity analysis of PCV2 Cap 27E7 monoclonal antibody

[0054] Experimental methods:

[0055] 20 μL of prokaryotically expressed PCV2 Cap and PCV3 Cap proteins were added to 5 μL of 5× Loading buffer and boiled in a water bath for 10 min. The protein samples were subjected to SDS-PAGE electrophoresis, and Western blot analysis was performed using 27E7 hybridoma cell supernatant, PCV2 Cap mouse positive serum, PCV3 Cap mouse positive serum as primary antibodies, and goat anti-mouse HRP labeled antibody as secondary antibody to detect the specificity of anti-PCV2 antibodies secreted by 27E7 monoclonal hybridoma cell lines. The results are shown in the attached Figure 5 .

[0056] ELISA plates were coated with 5 μg / mL recombinant PCV2 Cap-VLP and PCV3 Cap-VLP proteins at 4°C overnight. ELISA analysis was performed using the supernatant of 27E7 monoclonal hybridoma cell line and mouse negative serum as primary antibodies and goat anti-mouse HRP labeled antibody as secondary antibodies to detect the specificity of anti-PCV2 antibodies secreted by 27E7 monoclonal hybridoma cell line. The results are shown in the attached Figure 6 .

[0057] Experimental results:

[0058] As attached Figure 5 , 6 As shown, PCV2 Cap 27E7 monoclonal antibody can specifically react with PCV2 Cap protein and does not react with PCV3 Cap protein, which shows that PCV2 Cap 27E7 monoclonal antibody has good specificity.

[0059] Example 4: Application of PCV2 Cap 27E7 monoclonal antibody to detect PCV2 in Western blot method.

[0060] Experimental methods:

[0061] When the confluence of PK-15 cells in the 6-well plate reached 80%, the old culture medium was discarded, and the cells were washed twice with Hanks solution. The PK-15 cells were infected with PCV2 at an MOI of 1. After 48 hours of infection, the supernatant of the culture medium was discarded, and 200 μL of cell lysis solution was added to each well for full lysis for 5 minutes. Centrifuge at 12000 rpm for 5 minutes, take 40 μL of supernatant, add 10 μL of 5× Loading buffer, and boil the sample in a water bath for 10 minutes. PK-15 cells not infected with PCV2 were used as negative controls, and the protein samples were subjected to SDS-PAGE electrophoresis. Western blot analysis was performed using 27E7 monoclonal antibody ascites diluted 1:500 as the primary antibody and goat anti-mouse HRP labeled antibody as the secondary antibody.

[0062] Experimental results:

[0063] As attached Figure 7 As shown, PCV2 Cap 27E7 monoclonal antibody can specifically react with PCV2 whole virus, showing the expression of PCV2 Cap protein in cells, and does not react with irrelevant proteins.

[0064] Example 5: Application of PCV2 Cap 27E7 monoclonal antibody in the detection of PCV2 in the indirect immunofluorescence method

[0065] Experimental methods:

[0066] When the confluence of PK-15 cells in the 96-well plate reached 80%, the old culture medium was discarded, the cells were washed twice with Hanks solution, and PK-15 cells were infected with PCV2 at an MOI of 1. After 48 hours of infection, the culture supernatant was discarded. 50 μL of 4% paraformaldehyde was added to each well and fixed at room temperature for 30 minutes. The fixative was discarded, the cells were gently washed twice with PBS, 50 μL of 0.2% Triton X-100 was added to each well, and permeabilization was performed at room temperature for 15 minutes. The permeabilization solution was discarded, the cells were gently washed twice with PBS, 200 μL of 5% skim milk powder was added to each well, and the cells were blocked at 37°C for 2 hours. The blocking solution was discarded, and 1:500 diluted 27E7 monoclonal antibody ascites was added to each well as the primary antibody, and incubated at 37°C for 1 hour. The supernatant was discarded, the cells were gently washed twice with PBS, 1:1000 diluted FITC-labeled goat anti-mouse fluorescent secondary antibody was added, 50 μL per well, and incubated at 37°C in the dark for 1 hour. 1:200 diluted DAPI was added, 50 μL per well, and the cells were stained for 5 minutes at room temperature, and the cells were gently washed twice with PBS, and observed and photographed under a fluorescence microscope.

[0067] Experimental results:

[0068] As attached Figure 8 As shown, PCV2 Cap 27E7 monoclonal antibody can specifically bind to PCV2 virus and display the distribution of the virus in cells, and no fluorescent signal is generated in the control cells, indicating that the monoclonal antibody has good specificity and can be used for the differential diagnosis of PCV2 virus.

[0069] Example 6: Analysis of monoclonal antibody encoding gene sequences

[0070] Experimental methods:

[0071] The total RNA of PCV2 Cap 27E7 monoclonal hybridoma cells was extracted using a kit and reverse transcribed into cDNA. Two pairs of degenerate primers were designed based on the variable regions of the heavy and light chains of the antibody, and PCR amplification was performed separately. The target fragments were recovered and cloned into T vectors and sent to the company for sequencing.

[0072] Experimental results:

[0073] The V of 27E7 monoclonal antibody was obtained by IMGT analysis H CDR1, V H CDR2 and V H CDR3 and V L CDR1, V L CDR2 and V L CDR3, wherein the V H CDR1, V H CDR2 and V HThe amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3, respectively. L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6. The amino acid sequence of the light chain variable region is shown in SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.8; the gene sequence encoding the light chain variable region is shown in SEQ ID NO.9; and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO.10.

[0074] Example 7: Specific application examples of monoclonal antibodies

[0075] The immunochromatographic colloidal gold rapid detection kit was prepared according to the following formula:

[0076] 1) Coating fluid

[0077] Take 50 mM CBS buffer (pH = 9.6) and add 3% methanol.

[0078] 2) NC membrane blocking solution

[0079] Take 10 mM pH=7.4 PBS buffer, add 0.5% Tween 20, 0.5% PEG2000, 2% BSA and 0.02% NaN3.

[0080] 3) Gold label antibody diluent

[0081] Take 10 mM borate buffer (BB, pH 8.2), add 8% sucrose, 2% BSA and 0.05% NaN3.

[0082] 4) Immunochromatographic colloidal gold immunochromatographic test strips

[0083] The detection line (T line) was coated with PCV2 polyclonal antibody, the quality control line C line was coated with goat anti-mouse IgG, the C line and T line were arranged from top to bottom on the NC membrane, and the gold-labeled PCV2 monoclonal antibody 27E7 was fixed on the gold label pad.

[0084] The kit was used in the following manner:

[0085] During the test, take an appropriate amount of the sample to be tested and drop it into the sample well. If the sample contains PCV2 virus, it will bind to the polyclonal antibody coated on the T line and to the corresponding gold-labeled 27E7 monoclonal antibody, thereby developing color.

[0086] Example 8: Specific application examples of monoclonal antibodies

[0087] Prepare the immunohistochemistry kit according to the following recipe:

[0088] 1) 10 mM pH 7.4 PBS buffer

[0089] 8g NaCl, 0.2g KCl, 3.58g Na2HPO4·12H2O, 0.27g KH2PO4, add deionized water to 800mL, adjust pH to 7.4, and make up to 1L.

[0090] 2) 10mM PBST buffer pH=7.4

[0091] 10 mM pH = 7.4 PBS buffer, add 500 μL of Tween-20 per liter.

[0092] 3) Fixative

[0093] 4% paraformaldehyde.

[0094] 4)Permeabilizing fluid

[0095] 0.5% Triton-X100.

[0096] 5) Primary antibody diluent

[0097] Take 10 mM pH = 7.4 PBS buffer, add 0.05 g / mL mannitol, 0.05 g / mL sucrose, 0.1% proclin-300, and 0.01 g / mL BSA at a final concentration.

[0098] 6) Enzyme-labeled secondary antibody dilution solution

[0099] Take 10 mM pH = 7.4 PBS buffer, add 0.05% Tween-20 (Tween-20), 0.1% proclin-300, and 0.01 g / mL BSA at a final concentration.

[0100] The kit was used in the following manner:

[0101] 1) Take the sample to be tested and add the fixative solution, and incubate at 4°C overnight.

[0102] 2) Discard the fixative solution and wash with PBS three times, 5 minutes each time.

[0103] 3) Add permeabilization solution and incubate at room temperature for 15 minutes.

[0104] 4) Discard the permeabilization solution and wash with PBS three times, 5 minutes each time.

[0105] 5) Add PCV2 monoclonal antibody diluted with primary antibody diluent and incubate in a humidified chamber at 37°C for 1 h.

[0106] 6) Discard the primary antibody and wash with PBS three times, 5 minutes each time.

[0107] 7) Add HRP-labeled anti-mouse IgG (H+L) antibody diluted with enzyme-labeled secondary antibody diluent, incubate in a wet box at 37°C for 1 hour; discard the secondary antibody, and wash 3 times with PBS, 5 minutes each time.

[0108] 8) Observe the image using a microscope.

[0109]

[0110]

[0111]

Claims

1. A monoclonal antibody 27E7 against PCV2 Cap protein, characterized in that: The monoclonal antibody comprises the Ig domain V of the antibody heavy chain H CDR1, V H CDR2 and V H CDR3, and the Ig domain V of the antibody light chain L CDR1, V L CDR2 and V L CDR3; wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3 respectively; L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6, respectively.

2. The monoclonal antibody according to claim 1, characterized in that The monoclonal antibody is a full-length antibody, a Fab antibody or a F(ab')2 antibody.

3. The monoclonal antibody according to claim 1 or 2, characterized in that In the monoclonal antibody, the amino acid sequence of the light chain variable region is shown in SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

8.

4. The gene encoding the monoclonal antibody according to claim 3, characterized in that: The gene sequence encoding the light chain variable region is shown in SEQ ID NO.9, and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO.

10.

5. The method for preparing a monoclonal antibody according to claim 1, characterized in that: The following steps are involved: (1) Based on the PCV2 Cap protein gene sequence shown in SEQ ID NO: 11, the specific primers shown in SEQ ID NO. 12 and SEQ ID NO. 13 were used to construct a recombinant plasmid having the PCV2 Cap protein gene sequence; (2) PCV2 Cap protein was induced to express using a prokaryotic expression system, and after purification, it was dialyzed for VLP self-assembly to obtain PCV2 Cap-VLP protein; (3) Animal immunization with PCV2 Cap-VLP protein; (4) Through hybridoma monoclonal antibody technology, positive hybridoma cells were screened and monoclonalized, and the monoclonal antibody 27E7 against PCV2 Cap protein was obtained after identification.

6. The method for using any one of the monoclonal antibodies according to claim 1 or 2, characterized in that: The monoclonal antibody is used to prepare a kit for detecting PCV2.

7. A kit for detecting PCV2 virus, characterized in that: The kit comprises any one of the monoclonal antibodies described in claim 1 or 2.

8. The kit according to claim 7, characterized in that The kit is an ELISA test kit or an immunohistochemistry kit, and the detection method when using the kit is serological detection.

Images