Isolated actin5c promoter, methods of construction and expression vectors therefor

CN119570788BActive Publication Date: 2026-09-08TSINGHUA UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411777068.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-05
Publication Date
2026-09-08
Estimated Expiration
2044-12-05

AI Technical Summary

Technical Problem

现有基因表达载体主要存在载体尺寸较大,蛋白表达量低及转染效率低等问题,仍有待研究

Benefits of technology

[0004] This application aims to at least partially address the technical problems existing in the prior art. To this end, this application proposes an isolated Actin5C promoter and its construction method, expression vector, recombinant cells, application, and method for expressing the regulatory gene in Drosophila or Drosophila cells. The expression vector constructed using the isolated Actin5C promoter of this application is small in size and has high transfection efficiency. The expression vector of this application can significantly increase the yield of target proteins in insect S2 cells in vitro, demonstrating high value for scientific research and clinical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005171744910000011
    Figure HDA0005171744910000011
  • Figure HDA0005171744910000012
    Figure HDA0005171744910000012
  • Figure HDA0005171744910000021
    Figure HDA0005171744910000021
Patent Text Reader

Abstract

The application provides an isolated Actin5C promoter, a construction method and an expression vector thereof, wherein the isolated Actin5C promoter is a partial region of a wild-type Actin5C promoter, and the partial region comprises a region from the 94th site in the downstream direction to the 400bp-600bp in the upstream direction from a transcription initiation site. The length of the isolated Actin5C promoter is short, so that the size of the expression vector containing the same is small, and the transfection efficiency is high. The expression vector can significantly improve the target protein yield of insect S2 cells in vitro, and has high scientific research and clinical application values.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biology, specifically to the isolated Actin5C promoter, its construction method, and expression vector. Background Technology

[0002] Gene expression is a nucleic acid tool that uses physical, chemical, and other techniques to introduce exogenous genes into host cells and induce them to complete transcription, translation, and expression. By cloning the target gene into a corresponding vector, regulatory elements on the vector backbone enable the gene to be transcribed and translated in large quantities within the host cell, thus achieving overexpression of the target gene. Gene expression vectors typically include promoter elements, enhancer elements, and a 3' untranslated region (UTR), and are of great significance in biomedical research and industrial applications. Through gene expression systems, exogenous genes can be introduced into target cells, causing them to produce the desired proteins. This has wide-ranging and important applications in gene function research, drug development, and industrial production.

[0003] Drosophila, as a commonly used model organism, plays a crucial role in gene function research due to its stable genetic background and high degree of conservation of human genes and cell signaling pathways. Gene manipulation using in vitro cultured Drosophila Schneider 2 (S2) cells is a common method for studying gene function. S2 cells are a blood-lymphoid cell line differentiated from Drosophila embryos. Currently, constitutive gene expression vectors used in S2 cells primarily use constitutive promoters such as Actin5C and OpIE2, while the 3'-UTR is mainly derived from simian virus SV40. Existing gene expression vectors suffer from problems such as large vector size, low protein expression levels, and low transfection efficiency, and further research is needed. Summary of the Invention

[0004] This application aims to at least partially address the technical problems existing in the prior art. To this end, this application proposes an isolated Actin5C promoter and its construction method, expression vector, recombinant cells, application, and method for expressing the regulatory gene in Drosophila or Drosophila cells. The expression vector constructed using the isolated Actin5C promoter of this application is small in size and has high transfection efficiency. The expression vector of this application can significantly increase the yield of target proteins in insect S2 cells in vitro, demonstrating high value for scientific research and clinical applications.

[0005] In a first aspect of this application, a separated Actin5C promoter is proposed. According to an embodiment of this application, the separated Actin5C promoter is a portion of the wild-type Actin5C promoter, the portion comprising a region extending 400 bp to 600 bp upstream from the 94th position downstream of the transcription start site.

[0006] The Actin5C promoter isolated according to embodiments of this application is a specific DNA sequence truncated from the wild-type Actin5C promoter. This truncated Actin5C promoter is shorter, which helps reduce the overall size of the expression vector, allowing it to accommodate larger exogenous gene fragments and making it easier for cells to take up and process, thereby improving its transfection efficiency in host cells. Furthermore, this truncated Actin5C promoter can efficiently initiate and regulate gene expression, thereby increasing the yield of the target protein.

[0007] According to embodiments of this application, the aforementioned isolated Actin5C promoter may also have the following additional technical features:

[0008] According to an embodiment of this application, the wild-type Actin5C promoter has a nucleotide sequence as shown in SEQ ID NO: 1.

[0009] According to an embodiment of this application, the partial region includes a region starting from the 94th position downstream of the transcription start site and extending 450bp to 550bp upstream.

[0010] According to embodiments of this application, the isolated Actin5C promoter has a nucleotide sequence as shown in SEQ ID NO: 2 or at least 80% homologous nucleotide sequences thereof.

[0011] In a second aspect, this application provides an expression vector. According to an embodiment of this application, the expression vector includes: the isolated Actin5C promoter described in the first aspect.

[0012] According to an embodiment of this application, the expression vector further includes a 3'-UTR sequence, wherein the 3'-UTR sequence includes the 3'-UTR sequence of SV40 virus, the 3'-UTR sequence of P10 baculovirus, or the 3'-UTR sequence of Drosophila K10 gene.

[0013] According to embodiments of this application, the 3'-UTR sequence has a nucleotide sequence as shown in SEQ ID NO: 3 or at least 80% homologous nucleotide sequences thereof.

[0014] In a third aspect of this application, a recombinant cell is provided. According to an embodiment of this application, the recombinant cell comprises: the expression vector described in the second aspect.

[0015] According to an embodiment of this application, the recombinant cells are selected from Drosophila S2 cells.

[0016] In a fourth aspect of this application, a method for constructing the expression vector described in the second aspect is proposed. According to an embodiment of this application, the method includes: providing an initial expression vector, the initial expression vector comprising a wild-type Actin5C promoter; and truncating the wild-type Actin5C promoter to obtain the isolated Actin5C promoter.

[0017] According to an embodiment of this application, the initial expression vector further includes a 3'-UTR sequence derived from SV40 virus; the method further includes replacing the 3'-UTR sequence derived from SV40 virus with a 3'-UTR sequence of P10 baculovirus.

[0018] In a fourth aspect of this application, the application of the aforementioned isolated Actin5C promoter and expression vector in the expression of regulatory genes in Drosophila or Drosophila cells is proposed.

[0019] In a fifth aspect of this application, a method for regulating gene expression in Drosophila or Drosophila cells is provided. According to embodiments of this application, the method includes the steps of using the aforementioned isolated Actin5C promoter, expression vector, and recombinant cells.

[0020] Additional aspects and advantages of this application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of this application. Attached Figure Description

[0021] The above and / or additional aspects and advantages of this application will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0022] Figure 1 A fluorescence microscope image according to an embodiment of this application is shown;

[0023] Figure 2 This diagram illustrates the expression level of Luciferase protein using an expression vector according to an embodiment of this application.

[0024] Figure 3 The diagram shows the protein content of expression vectors containing the Actin5C (301bp) + p10 combination and the Actin5C (494bp) + p10 combination according to one embodiment of this application. Detailed Implementation

[0025] The embodiments of the technical solution of this application are described in detail below. The following embodiments are only used to illustrate the technical solution of this application more clearly, and are therefore only examples, and should not be used to limit the scope of protection of this application.

[0026] In this document, the term "embodiment" means that a particular feature, structure, or characteristic described in connection with an embodiment may be included in at least one embodiment of this application. The appearance of this phrase in various places throughout the specification does not necessarily refer to the same embodiment, nor is it a separate or alternative embodiment mutually exclusive with other embodiments. It will be explicitly and implicitly understood by those skilled in the art that the embodiments described herein can be combined with other embodiments.

[0027] The "range" disclosed in this application is defined by a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, which define the boundaries of a particular range. Ranges defined in this way can include endpoints and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60-120 and 80-110 are listed for a specific parameter, it is also expected that ranges of 60-110 and 80-120 are also included. Furthermore, if minimum range values ​​1 and 2 are listed, and if maximum range values ​​3, 4, and 5 are listed, then the following ranges are all expected: 1-3, 1-4, 1-5, 2-3, 2-4, and 2-5. In this application, unless otherwise stated, the numerical range "ab" represents a shortened representation of any combination of real numbers between a and b, where a and b are real numbers, and ranges defined in this way can include endpoints a and b. For example, the numerical range "0-5" indicates that all real numbers between "0-5" have been listed in this article; "0-5" is simply a shortened representation of these numerical combinations. Furthermore, when a parameter is stated as an integer ≥2, it is equivalent to disclosing that the parameter is, for example, an integer such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0028] Unless otherwise specified, all embodiments and optional embodiments of this application can be combined to form new technical solutions.

[0029] Unless otherwise specified, all technical features and optional technical features of this application may be combined to form new technical solutions.

[0030] Unless otherwise specified, all steps in this application may be performed sequentially or randomly, preferably sequentially. For example, the method includes steps (a) and (b), indicating that the method may include steps (a) and (b) performed sequentially, or it may include steps (b) and (a) performed sequentially. For example, the mention that the method may also include step (c) indicates that step (c) may be added to the method in any order. For example, the method may include steps (a), (b), and (c), or it may include steps (a), (c), and (b), or it may include steps (c), (a), and (b), etc.

[0031] This application proposes methods for constructing isolated Actin5C promoters, expression vectors, recombinant cells, and expression vectors, which will be described in detail below.

[0032] Separated Actin5C promoter

[0033] In a first aspect of this application, a separated Actin5C promoter is proposed. According to an embodiment of this application, the separated Actin5C promoter is a portion of the wild-type Actin5C promoter, the portion of which includes a region starting from the 94th position downstream of the transcription start site and extending upstream for 400bp to 600bp (e.g., 400bp, 420bp, 430, 440bp, 450bp, 460bp, 470, 480bp, 490, 500bp, 520bp, 540bp, 550bp, 560bp, 580bp, or 600bp).

[0034] Gene expression vectors have relatively personalized designs depending on different experimental needs, but they all contain basic elements such as replication initiation sites, selection markers, promoters, multiple cloning sites, and terminators. Currently, constitutive gene expression vectors commonly used for Drosophila S2 cells mainly use the following promoters: Actin5C and OpIE2.

[0035] The S2 cell gene expression vector using OpIE2 as the promoter showed lower expression efficiency compared to gene expression vectors using the Actin5C promoter. Actin5C is widely involved in various types of cell motility and is universally expressed in all eukaryotic cells. The Actin5C promoter is a vector element used for protein expression in in vitro insect cells. The relatively long Actin5C promoter results in a larger vector and lower transfection efficiency. Therefore, the inventors attempted to shorten the length of the Actin5C promoter in the vector and compared whether shortening it could improve the gene expression efficiency. Ultimately, a specific region of the wild-type Actin5C promoter was selected, specifically the region extending 400-600 bp upstream from the 94th position downstream of the transcription start site, or from the downstream end of the wild-type Actin5C promoter to the upstream end. This shorter region helps reduce the overall size of the expression vector, allowing it to accommodate larger exogenous gene fragments and making it easier for cells to take up and process, thereby improving its transfection efficiency in host cells. Furthermore, this truncated Actin5C promoter can efficiently initiate and regulate gene expression, thereby increasing the yield of the target protein.

[0036] In this paper, the 3' end direction at a certain site is considered as the downstream direction, and the 5' end direction is considered as the upstream direction.

[0037] In some embodiments, the truncated region includes a region extending 450 bp to 550 bp from the 94th position downstream of the transcription start site to the 494th position upstream of the transcription start site. This truncated Actin5C promoter can efficiently initiate and regulate gene expression, thereby increasing the yield of the target protein.

[0038] It should be noted that the term "wild-type Actin5C promoter" in this application refers to the initial promoter, that is, the untrunculated promoter, which has the nucleotide sequence shown in SEQ ID NO: 1, wherein the T base at position 2416 (bold + underline) is the transcription start site.

[0039] CATGAATGGCATCAACTCTGAATCAAATCTTTGCAGATGCACCTACTTCTCATTTCCAC

[0040] TGTCACATCATTTTTCCAGATCTCGCTGCCTGTTATGTGGCCCAAAACCAAGACACGT

[0041] TTTATGGCCATTAAAGCTGGCTGATCGTCGCCAAACACCAAATACATAATGAATATGTA

[0042] CACATTCGAGAAAGAAGCGATCAAAGAAGCGTCTTCGGGCGGAGTAGGAGAATGCG

[0043] GAGGAGAAGGAGAACGAGCTGATCTAGTATCTCTCCACAATCCAATGCCAACTGACC

[0044] AACTGGCCATATTCGGAGCAATTTGAAGCCAATTTCCATCGCCTGGCGATCGCTCCATT

[0045] CTTGGCTATATGTTTTTCACCGTTACCCGGGGCCATTTTCAAAGACTCGTCGGCAAGAT

[0046] AAGATTGTGTCACTCGCTGTCTCTCTTCATTTGTCGAAGAATGCTGAGGAATTTCGCGA

[0047] TGACGTCGGCGAGTATTTTGAAGAATGAGAATAATTTGTATTTATACGAAAATCAGTTA

[0048] GTGGAATTTTCTACAAAAACATGTTATCTATAGATAATTTTGTTGCAAAATATGTTGACT

[0049] ATGACAAAGATTGTATGTATATACCTTTAATGTATTCTCATTTTCTTATGTATTTATAATGG

[0050] CAATGATGATACTGATGATATTTTAAGATGATGCCAGACCAAAAGGCTTGAATTTCTGC

[0051] GTCTTTTGCCGAACGCAGTGCATGTGCAATTGTTGTTTTTTGGAATATTCAATTTTCGG

[0052] ACTGTCCGCTTTGATTTCAGTTTCTTGGCTTATTCAAAAAGCAAAGTAAAGCCAAAAA

[0053] AGCGAGATGGCAATACCAAATGCGGCAAAACGGTAGTGGAAGGAAAGGGGTGCGGG

[0054] GCAGCGGAAGGAAGGGTGGGGCGGGGCGTGGCGGGGTCTGTGGCTGGGCGCGACGT

[0055] CACCGACGTTGGAGCCACTCCTTTGACCATGTGTGCGTGTGTGTATTATTCGTGTCTCG

[0056] CCACTCGCCGGTTGTTTTTTTCTTTTTATGCTGCGCTCTCTCTAGCGCCATCTCGCTTAC

[0057] GCATGCTCAACGCACCGCATGTTGCCGTTTCCTTTTATGCGTCATTTTGGCTCGAAATA

[0058] GGCAATTATTTAAACAAAGATTAGTCAACGAAAACGCTAAAATAAATAAGTCTACAATA

[0059] TGGTTACTTATTGCCATGTGTGTGCAGCCAACGATAGCAACAAAAGCAACAACACAG

[0060] GTGGCTTTCCCTCTTTCACTTTTTGTTTGCAAGCCGCGTGCGAGCAAGACGGCACGAC

[0061] CGGCAAACGCAATTACGCTGACAAAGAGCAGACGAAGTTTTGGCGAAAAACATCAA

[0062] GGCGCCTGATACGAATGCATTTGCAATAACAATTGCGATATTTAATATTGTTTATGAAGC

[0063] TGTTTGACTTCAAAACACACAAAAAAAAAAATAAAACAAATTATTTGAAAGAGAATT

[0064] AGGAATCGGACGCTTATCGTTAGGGTAACAACAAGAAATGCTTACTGAGTCACAGCCT

[0065] CTGGAAAACTGCCGCAAGCCAGAGAGAGAGAGAAAAAGAGGGAGAGCAGCTTAGA

[0066] CCGCATGTGCTTGTGTGTGAGGCGTCTCTCTCTTCGTCTCTGTTGCGCAAACGCATAG

[0067] ACTGCACTGAAAAAATCGATTACCTATTTTTTATGAATGAATATTTGCACTATTACTATT

[0068] CAAAACTATTAAGATAGCAATCACATTCAATAGCCAAATACTATACCACCTGAGCGATG

[0069] CAACGAAATGATCAATTTGAGCAAAAATGCTGCATATTTAGGACGGCATCATTATAGAA

[0070] ATGCTTCTTGCTGTGTACTTTTCTCTCGTCTGGCAGCTGTTTCGCCGTTATTGTTAAAAC

[0071] CGGCTTAAGTTAGGTGTGTTTTCTACGACTAGTGAATGCCCTACTAGAAGATGTGTGTT

[0072] GCACAAAATGTCCCTGGAATAACCAATTTGAAGTGCAGATAGCAGTAAACGTAAGCTA

[0073] ATATGAATATTATTTAACTGTAATGTTTTAATATCGCTGACATTACTAATAAACCCACTA

[0074] TAAACACATGTACATATGTATGTTTTGGCATACAATGAGTAGTTGGGGAAAAAATGTGT

[0075] AAAAGCACCGTGACCATCACAGCATAAAGATAACCAGCTGAAGTATCGAATATGAGTA

[0076] ACCCCCAAATTGAATCACATGCCGCAACTGATAGGACCCATGGAAGTACACTCTTCAT

[0077] GGCGATATACAAGACACACACAAGCACGAACACCCAGTTGCGGAGGAAATTCTCCGT

[0078] AAATGAAAACCCAATCGGCGAACAATTCATACCCATATATGGTAAAAGTTTTGAACGC

[0079] GACTTGAGAGCGGAGAGCATTGCGGCTGATAAGGTTTTAGCGCTAAGCGGGCTTTATA

[0080] AACGGGCTGCGGGACCAG T TTTCATATCACTACCGTTTGAGTTCTTGCTGTGTGG

[0081] ATACTCCTCCCGACACAAAGCCGCTCCATCAGCCAGCAGTCGTCTAATCCAGAGAC (SEQ ID NO: 1, 5'→3')

[0082] According to embodiments of this application, the isolated ACTIN5C promoter has a nucleotide sequence as shown in SEQ ID NO: 2 or at least 80% homologous nucleotide sequences thereof. Therefore, the isolated ACTIN5C promoter fragment is shorter and has a better effect on regulating and promoting the target gene. The expression vector constructed from it is small in size, has high transfection efficiency, and can effectively improve protein expression levels, thus having high application value.

[0083] AATATCGCTGGACATTACTAATAAACCCACTATAAACACATGTACATATGTATGTTTTGG

[0084] CATACAATGAGTAGTTGGGGAAAAAATGTGTAAAAGCACCGTGACCATCACAGCATA

[0085] AAGATAACCAGCTGAAGTATCGAATATGAGTAACCCCCAAATTGAATCACATGCCGCA

[0086] ACTGATAGGACCCATGGAAGTACACTCTTCATGGCGATATACAAGACACACACAAGCA

[0087] CGAACACCCAGTTGCGGAGGAAATTCTCCGTAAATGAAAACCCAATCGGCGAACAAT

[0088] TCATACCCATATATGGTAAAAGTTTTGAACGCGACTTGAGAGCGGAGAGCATTGCGGC

[0089] TGATAAGGTTTTAGCGCTAAGCGGGCTTTATAAAACGGGCTGCGGGACCAGTTTTCAT

[0090] ATCACTACCGTTTGAGTTCTTGTGCTGTGTGGATACTCCTCCCGACACAAAGCCGCTCCATCAGCCAGCAGTCGTCTAATCCAGAGAC (SEQ ID NO: 2)

[0091] In this paper, the term "homology" is used to describe the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences relative to a reference sequence, determined by conventional methods, see, for example, Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN procedure (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research). Foundation, Washington, DC). There are many algorithms for aligning sequences and determining sequence homology, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48: 443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2: 482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85: 2444; and the Smith-Waterman algorithm (Meth. Mol. Biol. 70: 173-187 (1997)). And the BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J.Mol.Biol. 215: 403-410). Computer programs utilizing these algorithms are also available, and include, but are not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth.Enzym., 266: 460-480 (1996)); or GAP, BESTFIT, BLASTAltschul et al., above, FASTA, and TFASTA, available in Genetics Computing Group (GCG) package, version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0092] In this paper, the term "at least 80% homology" means that the homology between the sequence and its corresponding reference sequences is at least 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98%, 99%, or 100%.

[0093] expression carrier

[0094] In a second aspect of this application, an expression vector is provided. According to an embodiment of this application, the expression vector includes the isolated Actin5C promoter described in the first aspect. As previously mentioned, the isolated Actin5C promoter of this application is shorter, resulting in a smaller expression vector size, making it easier for cells to take up and process, thereby improving its transfection efficiency in host cells. Furthermore, this expression vector can better regulate and initiate the transcription of downstream genes, thereby increasing the yield of the target protein.

[0095] According to an embodiment of this application, the expression vector further includes a 3'-UTR sequence, wherein the 3'-UTR sequence includes the 3'-UTR sequence of SV40 virus, the 3'-UTR sequence of P10 baculovirus, or the 3'-UTR sequence of Drosophila K10 gene.

[0096] The 3'-UTR sequence is the untranslated region at the 3' end, typically including a polyA sequence. The 3'-UTR sequences from the aforementioned sources can prevent mRNA degradation by related nucleases and also serve as regulatory elements for some ribosome recognition of corresponding transcripts, thus playing a role in stabilizing mRNA and promoting translation initiation. Among the three sources mentioned, the 3'-UTR sequence from P10 baculovirus is the most effective, significantly improving the protein expression efficiency of expression vectors.

[0097] According to embodiments of this application, the 3'-UTR sequence has a nucleotide sequence as shown in SEQ ID NO: 3 or at least 80% homologous nucleotide sequences thereof. Therefore, the expression vector having the above-described 3'-UTR sequence exhibits high target gene expression efficiency.

[0098] ATGAATCGTTTTAAAATAACAAATGAATTGTTTTATAATATTCGTACGATTCTTTGATTA

[0099] TGTAATAAAATGTGATCATATTAGGAAGATTACGAAAAATATAAAAAATATGAGTTCTGTG

[0100] TGTATAACAAATGCTGTAAACGCCAGAATTGTGTTTGTTGCAAATAAACCCATGATTAT

[0101] TTGATTAAAATTGTTGTTTTCTTTGTTCATATACAATAGTGTGTTTTGCCTAAACGTGTA

[0102] CTGCATAAACTCCATGCGAGTGTATAGCGAGCTAGTGGCTAACGCTTGCCCCACCAAA

[0103] GTAGATTCGTCAAAATCCTCAATTTCATCACCCTCCTCCAAGTTTAACATTTGGCCGTC

[0104] GGAATTAACTTCTAAAGATGCCACATAATCTAATAAAATGAAATAGAGATTCAAACGTGG

[0105] CGTCATCGTCCGTTTCGACCATTTCCGAAAAGAACTCGGGCATAAACTCTATGATTTCT

[0106] CTGGACGTGGTGTTGTCGAAACTCTCAAAGTACGCAGTCAGGAACGTGCGCGACATG

[0107] TCGTCGGGAAAACTCGCGCGGAAACATGTTGTTGTAACCGAACGGGTCCCATAGCGCC

[0108] AAAACCAAATCTGCCAGCGTCAATAGAATGAGCACGATGCCGACAATGGAGCTGGCTTGGATAGCGATTCGA (SEQ ID NO: 3)

[0109] It should be noted that the features and advantages described above for the isolated ACTIN5C promoter also apply to this expression vector, and will not be repeated here.

[0110] Recombinant cells

[0111] In a third aspect of this application, a recombinant cell is provided. According to an embodiment of this application, the recombinant cell comprises the expression vector described in the second aspect. Thus, the recombinant cell containing the aforementioned expression vector can efficiently express the target protein.

[0112] It should be noted that the term "recombinant cell" in this application refers to a cell obtained by introducing an expression vector into a cell. The gene on the expression vector can either be recombined into the cell's genome or exist in a free form within the cell. Specifically, the recombinant cells in this application do not include germ cells, fertilized eggs, or embryonic cells.

[0113] According to an embodiment of this application, the recombinant cells are selected from Drosophila S2 cells.

[0114] It should be noted that the features and advantages described above for the expression vector also apply to this recombinant cell, and will not be repeated here.

[0115] Methods for constructing expression vectors

[0116] In a fourth aspect of this application, a method for constructing the expression vector described in the second aspect is proposed. According to an embodiment of this application, the method includes: providing an initial expression vector comprising a wild-type Actin5C promoter; and truncating the wild-type Actin5C promoter to obtain the isolated Actin5C promoter. Thus, the isolated Actin5C promoter obtained using the method of this application is shorter, which helps reduce the overall size of the expression vector, allowing it to accommodate larger exogenous gene fragments and making it easier for cells to take up and process, thereby improving its transfection efficiency in host cells. Furthermore, this truncated Actin5C promoter is more effective in maintaining its function of initiating and regulating gene expression, and can more effectively promote the transcription of downstream genes, thereby increasing the yield of the target protein.

[0117] In some embodiments, the truncation method may include: using the initial expression vector as a template, amplifying the isolated Actin5C promoter, digesting the initial expression vector with enzymes to remove the wild-type Actin5C promoter, and inserting the isolated Actin5C promoter into the digested expression vector to obtain the target expression vector. In some embodiments, the initial expression vector is Addgene's plasmid T6-pAC5.1 mEGFP-EcoRV (Plasmid#206489).

[0118] According to embodiments of this application, the initial expression vector further comprises a 3'-UTR sequence derived from SV40 virus; the method further comprises replacing the 3'-UTR sequence derived from SV40 virus with a 3'-UTR sequence derived from P10 baculovirus. This can further effectively improve protein expression efficiency.

[0119] In some embodiments, the replacement method includes: digesting the 3'-UTR sequence of the SV40 virus on the expression vector with enzymes, and then inserting the 3'-UTR sequence of the P10 baculovirus.

[0120] It should be noted that the features and advantages described above for the expression carrier also apply to this method, and will not be repeated here.

[0121] Applications and methods

[0122] In a fourth aspect of this application, the application of the aforementioned isolated Actin5C promoter, expression vector, and recombinant cells in the expression of regulatory genes in Drosophila or Drosophila cells is described. As previously stated, the isolated Actin5C promoter of this application is shorter, which helps to reduce the overall size of the expression vector, accommodate larger exogenous gene fragments, and is more easily taken up and processed by cells, thereby improving its transfection efficiency in host cells. Furthermore, this truncated Actin5C promoter is more effective in maintaining its function of initiating and regulating gene expression, and can more effectively promote the transcription of downstream genes.

[0123] In a fifth aspect of this application, a method for regulating gene expression in Drosophila or Drosophila cells is proposed. According to embodiments of this application, the method includes the steps of using the aforementioned isolated Actin5C promoter, an expression vector, and recombinant cells. As previously stated, the isolated Actin5C promoter of this application is shorter, which helps to reduce the overall size of the expression vector, accommodates larger exogenous gene fragments, and is more easily taken up and processed by cells, thereby improving its transfection efficiency in host cells. Furthermore, this truncated Actin5C promoter is more effective in maintaining its function of initiating and regulating gene expression, and can more effectively promote the transcription of downstream genes.

[0124] It should be noted that the characteristics and advantages described above for the isolated Actin5C promoter, expression vector, and recombinant cells also apply to this application and method, and will not be repeated here.

[0125] The following will explain the solution of this application with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0126] Example 1

[0127] The method for constructing the expression vector is as follows:

[0128] 1) Using Addgene's plasmid T6-pAC5.1 mEGFP-EcoRV (Plasmid #206489) as a template, this plasmid carries 2510 bp of Actin5c (SEQ ID NO: 1) and 135 bp of SV40 polyA (SEQ ID NO: 4). Actin5C (494, SEQ ID NO: 2) was amplified using the following specific oligonucleotide primers. The amplified product was digested with BamHI, and the vector plasmid pVAM was also digested with BamHI. After gel recovery, Actin5C (494) was inserted into the pVAM backbone using enzyme digestion and ligation to obtain pVAM-Actin5C (494). The specific oligonucleotide primers are:

[0129] 5'-TGTCTAGAGCGGATCCAATATCGCTGGACATTACTAATAAACCCAC-3' (SEQ ID NO: 5)

[0130] 5'-GCCTCGAGTGGATCCGTCTCTGGATTAGACGAC-3' (SEQ ID NO: 6)

[0131] GATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGT

[0132] GAAAAAAATGCTTTATTTGTGAAATTTGGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT (SEQ ID NO: 4)

[0133] 2) Using Addgene's plasmid T6-pAC5.1 mEGFP-EcoRV (Plasmid #206489) as a template, Actin5C (301, SEQ ID NO: 7) was amplified using the following specific oligonucleotide primers. The amplified product was digested with BamHI, and the vector plasmid pVAM was also digested with BamHI. After gel recovery, Actin5C (301) was inserted into the pVAM backbone using enzyme digestion and ligation to obtain pVAM-Actin5C (301). The specific oligonucleotide primers are:

[0134] 5'-TGTCTAGAGCGGATCCAGTACACTCTTCATGGCGATATACAAGAC-3' (SEQ ID NO: 8)

[0135] 5'-GGCCTCGAGTGGATCTCTCTGGATTAGACGACTGCTGGC-3'(SEQ ID NO: 9)AGTACACTCTTCATGGCGATATACAAGACACACACAAGCACGAACACCCAGTTGCGGAGGAAATTCTCCGTAAATGAAAACCCAATCGGCGAACAATTCATACCCATATATGGTAAAAGTTTTGAACGCGACTTGAGAGCGGAGAGCATT GCGGCTGATAAGGTTTTAGCGCTAAGCGGCTTTAATAAAACGGGCTGCGGGACCAGTTTTCATATCACTACCGTTTGAGTTCTTGTGCTGTGTGGATACTCCTCCCGACACAAAGCCGCTCCATCAGCCAGCAGTCGTCTAATCCAGAGA(SEQ ID NO:7)

[0136] 3) eGFP-P10 (SEQ ID NO: 3) was amplified using the following specific oligonucleotide primers. The amplification product was digested with XhoI, and the vector plasmids pVAM-Actin5C(494) and pVAM-Actin5C(301) were also digested with XhoI. After gel recovery, eGFP-P10 was inserted into the pVAM-Actin5C(494) and pVAM-Actin5C(301) backbones, respectively, using enzyme digestion and ligation to obtain pVAM-Actin5C(494)-eGFP-P10 and pVAM-Actin5C(301)-eGFP-P10. The specific oligonucleotide primers are:

[0137] 5'-CGGATCCACTCGAGGCCACCATGGTGAGCAAG-3' (SEQ ID NO: 14)

[0138] 5'-GCTGGAGCTCGAGTCGAATCGCTATCCAAGCCAG-3' (SEQ ID NO: 15)

[0139] 4) The OpIE2 promoter (SEQ ID NO: 10) was amplified on the template (Invitrogen's pIB / V5-His vector) using specific oligonucleotide primers. The amplification product was digested with BamHI, and the vector plasmid pVAM was also digested with BamHI. After gel recovery, pVAM-OpIE2 was obtained by restriction enzyme digestion and ligation. The specific oligonucleotide primers are:

[0140] 5'-GTCTAGAGCGGATCCTTGATAATCTCATGATGA-3' (SEQ ID NO: 11)

[0141] 5'-GGCCTCGAGTGGATCCTTTAAATTCGAACAGATGCT-3' (SEQ ID NO: 12)

[0142] (SEQ ID NO: 10)

[0143] 5) Using specific oligonucleotide primers, eGFP-polyA (OpIE2, SEQ ID NO: 13) was amplified on the template (Invitrogen's pIB / V5-His vector). The amplification product was digested with XhoI, and the vector plasmid pVAM-OpIE2 was also digested with XhoI. After gel recovery, eGFP-polyA (OpIE2) was inserted into the pVAM-OpIE2 backbone using enzyme digestion and ligation to obtain pVAM-OpIE2-eGFP-polyA (OpIE2). The specific oligonucleotide primers were:

[0144] 5'-GGATCCACTCGAGGCCACCATGGTGAGCAAG-3' (SEQ ID NO: 16)

[0145] 5'-ACCGCTCGAGCACGCGCTTTGAAAGGAG-3' (SEQ ID NO: 17)

[0146] ATCTTAGTTTGTATTGTCATGTTTTAATACAATATGTTATGTTTAAATATGTTTTTAAT AAATTTTATAAAATAATTTCAACTTTTATTGTAACAACATTGTCCATTTACACACTCCTT TCAAGCGCGTG (SEQ ID NO: 13)

[0147] 6) The constructed vector was transfected into *E. coli* and cultured at 37°C for 16 h. The plasmid was extracted and then transfected into *Drosophila S2* cells. After 24 h of cell culture, the expression of green fluorescent protein (GFP) and red fluorescent protein (mcherry) was observed using a fluorescence microscope. The results are as follows: Figure 1 and Figure 2 As shown.

[0148] Assay for luciferase: After 24 hours of cell culture, the cell supernatant was removed, cell lysis buffer was added, and the cells were lysed for 5 minutes. The lysate was collected and centrifuged for 5 minutes. Luciferin was added and reacted for 5 minutes. The fluorescence intensity released during luciferin oxidation was measured using a fluorescence meter. The results are as follows: Figure 3 As shown.

[0149] Depend on Figure 1 It can be seen that, compared with the OplE2+PolyA combination and the Actin5C (2510bp)+SV40 combination, the Actin5C (494bp)+p10 combination showed higher expression levels of mcherry and GFP proteins. Figure 2 It can be seen that the luciferase protein expression level of the Actin5C (494bp) + p10 combination is higher than that of the OplE2 + PolyA combination and the Actin5C (2510bp) + SV40 combination. Figure 3It can be seen that, compared to Actin5C truncated to 301bp, Actin5C truncated to 494bp facilitates more efficient regulation and initiation of luciferase gene expression, thereby increasing luciferase protein yield. Furthermore, the inventors compared the Actin5C (494bp) + p10 combination with the Actin5C (494bp) + SV40 combination; the Actin5C (494bp) + p10 combination showed higher expression levels of mcherry and GFP proteins, and also higher luciferase protein yield. This indicates that the Actin5C promoter truncated to 494bp and p10, as a constitutive expression vector for polyA, can achieve very high efficiency in in vitro expression of exogenous genes in insect S2 cells.

[0150] Although embodiments of this application have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting this application. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of this application.

Claims

1. A separate Actin5C promoter, characterized in that, The nucleotide sequence of the isolated Actin5C promoter is shown in SEQ ID NO:

2.

2. An expression carrier, characterized in that, include: The isolated Actin5C promoter as described in claim 1.

3. The expression vector according to claim 2, characterized in that, Further includes: The 3'-UTR sequence includes the 3'-UTR sequence of SV40 virus, the 3'-UTR sequence of P10 baculovirus, or the 3'-UTR sequence of the Drosophila K10 gene.

4. The expression vector according to claim 3, characterized in that, The nucleotide sequence of the 3'-UTR sequence is shown in SEQ ID NO:

3.

5. A recombinant cell, characterized in that, include: The expression vector according to any one of claims 2 to 4.

6. The recombinant cell according to claim 5, characterized in that, The recombinant cells were selected from Drosophila S2 cells.

7. A method for constructing the expression vector according to any one of claims 2 to 4, characterized in that, include: An initial expression vector is provided, the initial expression vector comprising a wild-type Actin5C promoter; The wild-type Actin5C promoter is truncated into the isolated Actin5C promoter as described in claim 1 to obtain the target expression vector.

8. The method according to claim 7, characterized in that, The initial expression vector further includes a 3'-UTR sequence derived from the SV40 virus; The method further includes replacing the 3'-UTR sequence derived from the SV40 virus with the 3'-UTR sequence of the P10 baculovirus.

9. The application of the Actin5C promoter isolated according to claim 1 and the expression vector according to any one of claims 2 to 4 in the expression of regulatory genes in Drosophila cells.

10. A method for regulating gene expression in Drosophila cells, characterized in that, include: The steps involve using the isolated Actin5C promoter as described in claim 1, the expression vector as described in any one of claims 2 to 4, or the recombinant cells as described in claim 5 or 6.

Citation Information

Patent Citations

  • Expression vector and application thereof

    CN105907788A

  • Drosophila melanogaster efficient transcription inhibition system

    CN118813703A