Agaricus bisporus strain with high yield, growth promotion, browning resistance and strong disease resistance, gene, vector, method and application

Abstract

The invention belongs to the field of genetic engineering and the technical field of edible mushroom breeding, and discloses an agaricus bisporus strain with high yield, growth promotion, browning resistance and strong disease resistance, a gene, a vector, a method and application, and an agaricus bisporus AbMYB11 overexpression vector with high yield, growth promotion, browning resistance and strong disease resistance is obtained by connecting AbMYB11 with a pCAMBIA1303 vector, and then connecting the AbMYB11 with a pCAMBIA1303 vector to obtain the agaricus bisporus strain with high yield, growth promotion, browning resistance and strong disease resistance. Constructing a complete plasmid, and performing enzyme digestion verification and sequencing verification to obtain a correct plasmid. The invention also discloses an agaricus bisporus strain containing the AbMYB11 overexpression vector. The agaricus bisporus strain is researched from the gene level, the resistance quality of agaricus bisporus is improved, the situation that market supply is insufficient is relieved, the agaricus bisporus strain which promotes growth, resists browning and is high in disease resistance is provided, and the problems that agaricus bisporus is prone to browning, low in yield and the like are solved.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and edible fungus breeding technology, in particular to a high-yield, growth-promoting, browning-resistant and disease-resistant Agaricus bisporus strain, gene, vector, method and application. Background Art

[0002] Agaricus bisporus is one of the most widely cultivated edible mushrooms in the world. It is rich in nutritional value, a high-quality source of plant protein, and contains multiple vitamins. It can also prevent rickets in children and osteoporosis in adults, promote the growth of beneficial intestinal bacteria, and reduce cholesterol absorption, which is beneficial to cardiovascular health. my country is a major producer and consumer of Agaricus bisporus, and the edible fungus industry occupies an important position in the development of my country's agriculture and rural economy. With the improvement of people's living standards and the emphasis on healthy diet, the market demand for Agaricus bisporus continues to grow.

[0003] After being harvested, Agaricus bisporus is prone to browning due to physiological metabolism and mechanical scratching. Browning can cause the color of Agaricus bisporus to change, reducing the visual quality of the product, making consumers think that it is not fresh and of poor quality, thereby reducing consumers' willingness to buy and affecting product sales. At the same time, the occurrence of browning means that the physiological state of Agaricus bisporus has changed, shortening its shelf life. In order to reduce the browning of Agaricus bisporus, a series of preservation measures need to be taken, such as low-temperature refrigeration, modified atmosphere packaging, and the use of preservatives, which increases production costs.

[0004] Foreign countries have made more significant progress in the selection and breeding of Agaricus bisporus strains. Some developed countries have established a complete strain selection and breeding system, and through advanced biotechnology, have cultivated Agaricus bisporus strains with multiple excellent traits such as high yield, high quality, disease resistance, and resistance to adversity. These strains have performed well in the process of promotion and application, significantly improving the yield and quality of Agaricus bisporus. In addition, foreign strain production units are large in scale and advanced in technology, and are able to produce high-quality strains, providing a strong guarantee for the development of the Agaricus bisporus industry, but foreign strains are expensive and have a short service life.

[0005] In the field of Agaricus bisporus strain selection and breeding, domestic researchers have successfully cultivated a series of high-yield, high-quality, and disease-resistant Agaricus bisporus strains through advanced methods such as genetic engineering and mutation breeding. Although these achievements have promoted the development of the edible fungi industry to a certain extent, these strains still face some urgent problems in practical applications:

[0006] Limited disease resistance: Although some strains show a certain degree of disease resistance, existing strains often fail to provide effective resistance to specific pathogens, such as Agaricus bisporus brown spot and other serious diseases. This not only limits the growth and development of the strains, but may also lead to the failure of the entire planting cycle, causing economic losses to farmers.

[0007] The growth promotion effect is not obvious: the existing Agaricus bisporus strains perform mediocrely in terms of growth promotion and lack an effective growth stimulation mechanism, resulting in a long growth cycle and slow growth rate, affecting the overall yield and economic benefits.

[0008] Limited anti-browning effect: The existing Agaricus bisporus strains do not perform well in terms of anti-browning. After harvesting, Agaricus bisporus is prone to browning caused by the oxidation of enzymatic phenolic compounds, and its shelf life is usually only 1 to 3 days at room temperature. This browning phenomenon seriously affects the market value and consumer acceptance of Agaricus bisporus.

[0009] In view of the above problems, the present invention successfully cultivated a high-yield, growth-promoting, browning-resistant, and disease-resistant Agaricus bisporus strain through innovative directional molecular modification technology. This strain not only performs well in environmental adaptability, and can maintain stable growth and high output under variable climatic conditions, but also has significant improvements in disease resistance, and can effectively resist major diseases such as Agaricus bisporus brown spot. In addition, the strain of the present invention also has the characteristics of promoting growth, which can shorten the growth cycle and increase the growth rate, thereby significantly improving the yield and economic benefits. These characteristics make the strain of the present invention have a wide range of application prospects and market competitiveness in the edible fungus industry.

[0010] After searching, no public reports on this invention have been found at home or abroad, and no public use has been found at home or abroad. Summary of the invention

[0011] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a Agaricus bisporus strain, gene, vector, method and application which is high-yielding, growth-promoting, anti-browning and disease-resistant.

[0012] The technical solution adopted by the present invention to solve its technical problem is:

[0013] The invention discloses an application of an AbMYB11 gene in improving the yield of Agaricus bisporus. The accession number of the AbMYB11 gene in the NCBI database is XM_006459610.1, and the gene is marked as a hypothetical protein in the NCBI database.

[0014] The invention discloses an application of an AbMYB11 gene in promoting growth, resisting browning and enhancing disease resistance of Agaricus bisporus. The sequence of the AbMYB11 gene has an accession number of XM_006459610.1 in the NCBI database and is marked as a hypothetical protein in the NCBI database.

[0015] A high-yield, growth-promoting, browning-resistant and disease-resistant Agaricus bisporus AbMYB11 overexpression vector, wherein the overexpression vector is constructed by connecting AbMYB11 with a pCAMBIA1303 vector to form a complete plasmid, and performing enzyme digestion verification and sequencing verification to obtain a correct plasmid;

[0016] The accession number of the sequence of the AbMYB11 gene in the NCBI database is: XM_006459610.1, and it is marked as a hypothetical protein in the NCBI database.

[0017] The AbMYB11 overexpression vector as described above is used to promote growth, resist browning, and enhance disease resistance of Agaricus bisporus.

[0018] A Agaricus bisporus strain comprising the AbMYB11 overexpression vector described above, which has high yield, growth promotion, browning resistance and strong disease resistance.

[0019] The method for constructing the Agaricus bisporus strain as described above uses Agrobacterium-mediated transformation of exogenous genes into the Agaricus bisporus during construction.

[0020] Further, the following steps are included:

[0021] Construction of AbMYB11 overexpression vector: First, the pCAMBIA1303 vector was analyzed, and the CaMV35S promoter was replaced with the AbGPD promoter, named pCAMBIA1303, to obtain the required empty vector; then the AbMYB11 gene was overexpressed and then connected to the empty vector, and after enzyme digestion verification and sequencing analysis were correct, the desired empty vector was obtained.

[0022] pCAMBIA1303-AbMYB11-OE is the AbMYB11 overexpression vector;

[0023] The connected plasmid is transferred into Agrobacterium and used to infect Agaricus bisporus. After resistance screening and AbMYB11 gene expression determination, the target strain is selected for mushroom fruiting test, and the grown Agaricus bisporus fruiting bodies are subjected to browning resistance and disease resistance determination. Finally, the target strain containing the overexpressed AbMYB11 gene and growing well is preserved to obtain the Agaricus bisporus strain.

[0024] Furthermore, the screening includes two steps: primary screening and secondary screening, wherein the strains with better mycelium growth in a culture medium containing hygromycin are screened out as target strains; RNA of the target strains is extracted, and the expression level of the AbMYB11 gene is determined.

[0025] Furthermore, the two steps of primary screening and secondary screening are specifically as follows: transferring the transformed tissue block to the primary screening MMP medium and culturing at 24°C for 2 weeks; picking the newly grown hyphae and transplanting them to the secondary screening MMP medium and culturing at 24°C for 2 weeks;

[0026] The formula of the initial screening MMP culture medium is as follows: 10.0 g maltextract, 5.0 g mycological peptone, and 2.1 g MOPS, 3-(N-morpholino)propanesulfonic acid, are weighed and fully dissolved with distilled water, the pH is adjusted to 7.0 with 1 M KOH, and the volume is fixed to 1 L; the final concentrations of antibiotics are: 30 μg / mL hygromycin B, 200 μM cefotaxime, 20 μg / mL rifampicin, and 50 μg / mL kanamycin and ampicillin;

[0027] In the following examples, the formula of the rescreened MMP medium is as follows: 10.0 g maltextract, i.e. malt extract, 5.0 g mycological peptone, i.e., 2.1 g MOPS, i.e., 3-(N-morpholino)propanesulfonic acid, are weighed and fully dissolved with distilled water, the pH is adjusted to 7.0 with 1 M KOH, and the volume is fixed to 1 L; the final concentration of antibiotics is: 50 μg / mL hygromycin B, 17 μg / mL tetracycline hydrochloride, 50 μg / mL kanamycin and ampicillin.

[0028] The advantages and positive effects achieved by the present invention are:

[0029] 1. The present invention constructs Agaricus bisporus materials with overexpression and silencing of AbMYB11 and studies their disease resistance, and verifies that the AbMYB11 gene can be well expressed on the pCAMBIA1303 vector.

[0030] 2. The connected pCAMBIA1303-AbMYB11-OE and pCAMBIA1303-AbMYB11-RNAi plasmids of the present invention can be well expressed under resistance conditions and can be transformed into Agaricus bisporus.

[0031] 3. Characteristics of the overexpressed AbMYB11 Agaricus bisporus strain of the present invention:

[0032] (1) Mycelial growth: In PDA medium, the overexpressed strain grew denser than the wild type.

[0033] (2) Growth of Agaricus bisporus: In the fruiting test, the overexpressed Agaricus bisporus showed faster growth, higher yield, and stronger resistance to browning and disease than the wild type.

[0034] 4. The strain obtained by the present invention can be preserved and used in actual production, thereby improving the cultivation quality and production value of Agaricus bisporus and optimizing the disease resistance of Agaricus bisporus. Therefore, the research on the strain has important practical significance for improving the quality of Agaricus bisporus.

[0035] 5. The present invention utilizes the gene change in Agaricus bisporus to improve disease resistance, thus preparing for industrialized production.

[0036] 6. The present invention has found that the development process of the fruiting body is regulated by multiple genes, among which the MYB gene may be involved in regulating multiple processes such as cell morphogenesis, tissue differentiation and reproductive development in the development of Agaricus bisporus fruiting bodies. After the MYB gene is overexpressed in Agaricus bisporus, it can improve the resistance of mushrooms to the environment during growth, delay the occurrence of browning, and promote the growth of mushrooms, thereby achieving the purpose of increasing yield.

[0037] 7. The present invention conducts research at the genetic level, improves the resistance quality of Agaricus bisporus and alleviates the situation of insufficient market supply, and provides a growth-promoting, browning-resistant, and disease-resistant Agaricus bisporus strain to solve the problems of easy browning and low yield of Agaricus bisporus.

[0038] 8. The present invention constructs AbMYB11 overexpression and silencing transgenic materials: AbMYB11 overexpression and silencing vectors are constructed using pCAMBIA1303 expression vectors; on this basis, the two constructed vectors are transferred into Agaricus bisporus by using Agrobacterium-mediated transformation method, transformants with hygromycin resistance are screened, and the gene expression level of AbMYB11 is analyzed for the resistant transformants to obtain Agaricus bisporus materials with AbMYB11 overexpression and silencing, and the anti-browning ability and disease resistance of the Agaricus bisporus with AbMYB11 overexpression and silencing are determined. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 A technical roadmap of the method of the present invention;

[0040] Figure 2 It is the construction prediction map of the AbMYB11 overexpression vector pCAMBIA1303-AbMYBI1-OE in the present invention;

[0041] Figure 3It is a diagram showing the result of constructing pCAMBIA1303-AbMYBI1-OE in the present invention; wherein, A is the AbMYB11 gene clone in the present invention, B is the double enzyme digestion verification of the AbMYB11 overexpression vector, i.e., the pCAMBIA1303-AbMYB11-OE recombinant plasmid; M1: 2K Plus DNA Marker; M2: 1Kb DNA Marker; 1: PCR amplification product of AbMYBI1; 2: BglⅡ and BstEⅡ double enzyme digestion verification of pCAMBIA1303-AbMYB11-0E; C is a comparison diagram of the sequencing results of pCAMBIA1303-AbMYBI1-OE;

[0042] Figure 4 It is a predicted map for the construction of the AbMYB11 silencing vector, i.e., pCAMBIA1303-AbMYBII-RNAi in the present invention;

[0043] Figure 5 It is a result diagram of the construction of pCAMBIA1303-AbMYBII-RNAi in the present invention; wherein, A is the cloning of AbMYB11-Sense and AbMYB11-Antisense genes in the present invention, B is the double enzyme digestion verification of the AbMYB11 silencing vector, i.e., the pCAMBIA1303-AbMYB11-RNAi recombinant plasmid; M1: 2K DNA Marker; M2: 1Kb DNA Marker; 1: PCR amplification product of AbMYB11-Sense; 2: PCR amplification product of AbMYB11-Antisense; 3: XhoI and BstEⅡ double enzyme digestion verification of pCAMBIA1303-AbMYB11-RNAi; C is a comparison diagram of the sequencing results of pCAMBIA1303-AbMYBII-RNAi;

[0044] Figure 6 The diagram is a diagram showing the growth of transformants in the primary screening MMP medium containing 30 μg / L hygromycin (A) and the secondary screening MMP medium containing 50 μg / L hygromycin (B) after Agrobacterium infects the gills of Agaricus bisporus in the present invention;

[0045] Figure 7 It is a data graph of the expression level of the AbMYB11 gene of the overexpression type, silenced type and wild type mycelium in the present invention;

[0046] Figure 8 It is a graph showing the growth of wild-type, overexpression and silenced genotype strains on PDA medium in the present invention;

[0047] Fig. 9 It is a diagram showing the growth of mycelium of different strains in wheat grain culture medium in the present invention;

[0048] Fig.10 A diagram showing the growth of Agaricus bisporus in the mushroom production test of the present invention;

[0049] Fig.11 It is a statistical diagram of the yield of the first-wave mushroom and the second-wave mushroom in the present invention;

[0050] Fig.12 It is a growth diagram of Agaricus bisporus on the 46th day and the 47th day of sowing in the present invention;

[0051] Fig.13 This is a graph showing the anti-browning ability of Agaricus bisporus in the present invention;

[0052] Fig.14 It is a graph showing the disease resistance of Agaricus bisporus in the present invention.

[0053] Fig.15 It is the incidence diagram of Agaricus bisporus in the present invention.

[0054] In the above pictures: For the convenience of recording, the present invention uses random letters and numbers for numbering, but they correspond to the genotype names. In the figure, YH26 represents the wild type, HF41 represents OE-AbMYB11-78, and JS59 represents OE-AbMYB11-91. BK58 represents RNAi-AbMYB11-96, and JD97 represents RNAi-AbMYB11-97. DETAILED DESCRIPTION

[0055] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0056] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0057] The invention discloses an application of an AbMYB11 gene in improving the yield of Agaricus bisporus. The accession number of the AbMYB11 gene in the NCBI database is XM_006459610.1, and the gene is marked as a hypothetical protein in the NCBI database.

[0058] The invention discloses an application of an AbMYB11 gene in promoting growth, resisting browning and enhancing disease resistance of Agaricus bisporus. The sequence of the AbMYB11 gene has an accession number of XM_006459610.1 in the NCBI database and is marked as a hypothetical protein in the NCBI database.

[0059] A high-yield, growth-promoting, browning-resistant and disease-resistant Agaricus bisporus AbMYB11 overexpression vector, wherein the overexpression vector is constructed by connecting AbMYB11 with a pCAMBIA1303 vector to form a complete plasmid, and performing enzyme digestion verification and sequencing verification to obtain a correct plasmid;

[0060] The accession number of the sequence of the AbMYB11 gene in the NCBI database is: XM_006459610.1, and it is marked as a hypothetical protein in the NCBI database.

[0061] The AbMYB11 overexpression vector as described above is used to promote growth, resist browning, and enhance disease resistance of Agaricus bisporus.

[0062] A Agaricus bisporus strain comprising the AbMYB11 overexpression vector described above, which has high yield, growth promotion, browning resistance and strong disease resistance.

[0063] The method for constructing the Agaricus bisporus strain as described above uses Agrobacterium-mediated transformation of exogenous genes into the Agaricus bisporus during construction.

[0064] Preferably, the method comprises the following steps:

[0065] Construction of AbMYB11 overexpression vector: First, the pCAMBIA1303 vector was analyzed, and the CaMV35S promoter was replaced with the AbGPD promoter, named pCAMBIA1303, to obtain the required empty vector; then the AbMYB11 gene was overexpressed and then connected to the empty vector, and after enzyme digestion verification and sequencing analysis were correct, the desired empty vector was obtained.

[0066] pCAMBIA1303-AbMYB11-OE is the AbMYB11 overexpression vector;

[0067] The connected plasmid is transferred into Agrobacterium and used to infect Agaricus bisporus. After resistance screening and AbMYB11 gene expression determination, the target strain is selected for mushroom fruiting test, and the grown Agaricus bisporus fruiting bodies are subjected to browning resistance and disease resistance determination. Finally, the target strain containing the overexpressed AbMYB11 gene and growing well is preserved to obtain the Agaricus bisporus strain.

[0068] Preferably, the screening includes two steps of primary screening and secondary screening, wherein the strains with better mycelium growth in a culture medium containing hygromycin are screened out as target strains; RNA of the target strains is extracted to determine the expression level of the AbMYB11 gene.

[0069] Preferably, the steps of primary screening and secondary screening are as follows: transferring the transformed tissue block to the primary screening MMP culture medium and culturing at 24°C for 2 weeks; picking the newly grown hyphae and transplanting them to the secondary screening MMP culture medium and culturing at 24°C for 2 weeks;

[0070] The formula of the initial screening MMP culture medium is as follows: 10.0 g maltextract, 5.0 g mycological peptone, and 2.1 g MOPS, 3-(N-morpholino)propanesulfonic acid, are weighed and fully dissolved with distilled water, the pH is adjusted to 7.0 with 1 M KOH, and the volume is fixed to 1 L; the final concentrations of antibiotics are: 30 μg / mL hygromycin B, 200 μM cefotaxime, 20 μg / mL rifampicin, and 50 μg / mL kanamycin and ampicillin;

[0071] In the following examples, the formula of the rescreened MMP medium is as follows: 10.0 g maltextract, i.e. malt extract, 5.0 g mycological peptone, i.e., 2.1 g MOPS, i.e., 3-(N-morpholino)propanesulfonic acid, are weighed and fully dissolved with distilled water, the pH is adjusted to 7.0 with 1 M KOH, and the volume is fixed to 1 L; the final concentration of antibiotics is: 50 μg / mL hygromycin B, 17 μg / mL tetracycline hydrochloride, 50 μg / mL kanamycin and ampicillin.

[0072] Specifically, the relevant preparation and detection are as follows:

[0073] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0074] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0075] The raw material used in the experiment, Agaricus bisporus fruiting body "W192", was collected from Xingtai City, Hebei Province.

[0076] The vector provided by the present invention is pCAMBIA1303 type, which is named pCAMBIA1303 according to the map study and replaces the CaMV35S promoter with the AbGPD promoter, in order to ensure better expression of the AbMYB11 gene in Agaricus bisporus, but other vectors or other promoters of the vector can also be replaced for experiments. Its technical roadmap is as follows Figure 1 shown.

[0077] The overexpression vector pCAMBIA1303-AbMYB11-OE (AbMYB11 overexpression vector) in the following example was constructed according to the method in Example 1.

[0078] The overexpression vector pCAMBIA1303-AbMYB11-RNAi (AbMYB11 silencing vector) in the following example was constructed according to the method of Example 2.

[0079] The pCAMBIA1303 vector described below is a pCAMBIA1303 vector with the CaMV35S promoter replaced by the AbGPD promoter, and is named pCAMBIA1303. The public can obtain the biological material from the applicant, and the biological material is only used to repeat the experiment of the present invention and cannot be used for other purposes.

[0080] In the following examples, primers were designed according to the principle of seamless cloning, and primer synthesis and sequencing were completed by Suzhou Genewise Biotechnology Co., Ltd. The specific sequences are shown in Table 1 below.

[0081]

[0082] The specific information of the strains used in the present invention is shown in Table 2.

[0083] Table 2 Strains and plasmids used in the present invention

[0084] Strain name describe source DH5α competent cells Transformation of recombinant products Beijing Quanshijin Biotechnology Co., Ltd. EHA105 competent cells Agrobacterium transformation Shanghai Weidi Biotechnology Co., Ltd.

[0085] In the following examples, LB medium: 5.0 g yeast extract, 10.0 g tryptone, and 10.0 g NaCl were weighed separately, fully dissolved with distilled water, adjusted to pH 7.0, and fixed to 1.0 L.

[0086] In the following examples, the basic medium (MM) is as follows: 10 mL K-buffer (262 g / L potassium dihydrogen phosphate, 145 g / L potassium dihydrogen phosphate, pH adjusted to 7.0), 20 mL M-N (30 g / L magnesium sulfate, 15 g / L sodium chloride), 1 mL 0.75% calcium chloride, 10 mL 21.8% glucose (w / v, mass concentration), 10 mL 0.018% ferrous sulfate (w / v, mass concentration), 5 mL Spore Elements (100 mg / L ZnSO 4 7H 2 O zinc sulfate, 100 mg / L copper sulfate, 100 mg / L boric acid, 100 mg / L manganese sulfate, 100 mg / L sodium molybdate) and 2.5 mL of 20% ammonium nitrate, ddH 2 O was diluted to 1.0 L. The above percentages are all mass percentages, and the solvent is all water.

[0087] In the following examples, the induction medium (IM) was prepared by taking 10 mL K-buffer (262 g / L potassium dihydrogen phosphate, 145 g / L potassium dihydrogen phosphate, pH adjusted to 7.0), 20 mL MN (30 g / L magnesium sulfate, 15 g / L sodium chloride), 1 mL 1% calcium chloride, 10 mL 0.01% ferrous sulfate (w / v, mass concentration), 5 mL Spore Elements (100 mg / L zinc sulfate, 100 mg / L copper sulfate, 100 mg / L boric acid, 100 mg / L manganese sulfate, 100 mg / L sodium molybdate), 10 mL 50% glycerol, 40 mL 1 mol / L MES (pH adjusted to 5.3), 5 mL 2 mol / L glucose, 2 mL 100 mmol / L acetosyringone and 2.5 mL 20% sodium nitrate, ddHO 2 O was diluted to 1.0 L. The above percentages are all mass percentages, and the solvent is all water.

[0088] In the following examples, the co-culture medium (CM) was: 10 mL K-buffer (262 g / L potassium dihydrogen phosphate, 145 g / L potassium dihydrogen phosphate, adjusted to pH 7.0), 20 mL MN (30 g / L magnesium sulfate, 15 g / L sodium chloride), 1 mL 1% calcium chloride, 10 mL 0.01% ferrous sulfate (w / v, mass concentration), 5 mL Spore Elements (100 mg / L zinc sulfate, 100 mg / L copper sulfate, 100 mg / L boric acid, 100 mg / L manganese sulfate, 100 mg / L sodium molybdate), 10 mL 50% glycerol, 40 mL 1 mol / L MES (adjusted to pH 5.3), 2.5 mL 2 mol / L glucose, 2 mL 100 mmol / L acetosyringone and 2.5 mL 20% sodium nitrate, ddH 2 O was diluted to 1 L and 1.5% agar was added. The above percentages are all mass percentages, and the solvent is water.

[0089] In the following examples, PDA culture medium: weigh 200 g of fresh potatoes, heat and boil them with distilled water for 30 min, and then filter them with four layers of gauze, then weigh 20 g of glucose and 15 g of agar, respectively, and fully dissolve them with distilled water to make a volume of 1 L.

[0090] In the following embodiments, wheat grain culture medium: the wheat grains are washed clean to remove the sand and broken grains, soaked in clean water for 5-8 hours, and then boiled until there is no white core in the grains, taken out, spread out to dry the surface moisture, mixed with 1% by mass calcium carbonate and placed in a culture bottle.

[0091] In the following examples, the MMP culture medium was initially screened: 10.0 g malt extract, 5.0 g mycological peptone, and 2.1 g MOPS (3-(N-morpholino)propanesulfonic acid) were weighed, fully dissolved with distilled water, adjusted to pH 7.0 with 1 M KOH, and the volume was fixed to 1 L. The final antibiotic concentrations (30 μg / mL hygromycin B, 200 μM cefotaxime, 20 μg / mL rifampicin, 50 μg / mL kanamycin and ampicillin) were set.

[0092] In the following examples, the MMP medium was screened again: 10.0 g maltextract, 5.0 g mycological peptone, and 2.1 g MOPS (3-(N-morpholino)propanesulfonic acid) were weighed and fully dissolved in distilled water, the pH was adjusted to 7.0 with 1 M KOH, and the volume was fixed to 1 L. The final concentration of antibiotics (50 μg / mL hygromycin B, 17 μg / mL tetracycline hydrochloride, 50 μg / mL kanamycin and ampicillin) was 1 L.

[0093] For a better understanding of the present invention, the present invention is further described in detail below in conjunction with embodiments, but the scope of protection claimed by the present invention is not limited to the scope represented by the embodiments.

[0094] The raw materials used in the present invention, unless otherwise specified, are all conventional commercially available products. The methods used in the present invention, unless otherwise specified, are all conventional methods in the art. The quality of each substance used in the present invention is the conventional quality.

[0095] Example 1. Construction of overexpression vector pCAMBIA1303-AbMYB11-OE

[0096] 1. Cloning of AbMYB11 gene

[0097] According to the CDS region of AbMYB11 in the NCBI database and combined with the pCAMBIA1303 vector map, specific primers for AbMYB11 were designed, and BglⅡ and BstEⅡ restriction sites were added respectively. The predicted map is shown in Figure 2 The sequence of AbMYB11 gene in the NCBI database is accession number: XM_006459610.1, and is marked as hypothetical protein in the NCBI database.

[0098] The primer sequences are as follows (BglⅡ and BstEⅡ restriction sites are underlined):

[0099] pCAMBIA1303-AbMYB11-OE-F:

[0100] 5'AACAAGCTCATCGCC AGATCT ATGCTCTGCAGAGAACGCC3'

[0101] pCAMBIA1303-AbMYB11-OE-R:

[0102] 5'CGGGGAAATTCGAGCT GGTCACC CTAGAAAATGTAAGCGAGCTCATTC3'

[0103] PCR amplification was performed with the following procedure: 95°C for 5 min, 35 cycles (95°C for 30 sec, 55°C for 30 sec and 72°C for 2 min), 72°C for 10 min, 4°C. After the reaction, the PCR amplification product was detected by 0.8% agarose gel electrophoresis. The agarose gel detection results showed that the PCR product with the expected fragment size (1167 bp) was obtained. The PCR product with the correct band size was recovered using a gel recovery kit. The successfully amplified AbMYB11 product is shown in Figure 3 A.

[0104] 2. pCAMBIA1303-AbMYB11-OE vector ligation

[0105] 2.1 Carrier processing

[0106] According to the pCAMBIA1303 vector map, the pCAMBIA1303 vector was double-digested with restriction endonucleases BglⅡ and BstEⅡ. After the reaction, the double-digested products were detected by 0.8% agarose gel electrophoresis, and the correct bands were recovered using a gel recovery kit.

[0107] 2.2 Gene and vector connection (seamless cloning)

[0108] The correct double-enzyme digestion products and the PCR amplification products of AbMYB11 were recovered from the gel, and seamlessly cloned and connected using ClonExpress II OneStep Cloning Kit to construct the pCAMBIA1303-AbMYB11-OE vector.

[0109] 2.3 Transformation and culture of recombinant products

[0110] According to the instructions of DH5α cloning competent cells, the recombinant product was transferred into competent cells and cultured.

[0111] 2.4 Enzyme Digestion Verification and Sequencing

[0112] The plasmid was extracted according to the instructions of the plasmid extraction kit and the recombinant plasmid was double-digested with BglⅡ and BstEⅡ for verification. The digestion results are shown in Figure 3 B. The results of agarose gel detection showed that two gene fragments of about 1200bp and 9000bp were obtained, which were consistent with the expected size, indicating that the target gene was successfully connected to the vector. The plasmid with double enzyme digestion verification was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing, and the results showed that the consistency was 100%. The plasmid with correct sequencing was named pCAMBIA1303-AbMYB11-OE, and the sequencing comparison results are shown in Figure 3 C.

[0113] Example 2: Construction of silencing vector pCAMBIA1303-AbMYB11-RNAi

[0114] 1. Cloning of AbMYB11-Sense and AbMYB11-Antisense genes

[0115] According to the nucleotide sequence of AbMYB11 in Agaricus bisporus Genomic DNA in the NCBI database (NW_006267366.1), an exon and intron were selected to design specific primers for AbMYB11-Sense and AbMYB11-Antisense. The BglⅡ and BstEⅡ restriction sites were added respectively according to the pCAMBIA1303 vector map. The predicted map is shown in Figure 4 The primer sequences are as follows (BglⅡ and BstEⅡ restriction sites are underlined):

[0116] AbMYB11-Sense-F:

[0117] 5'AACAAGCTCATCGCC AGATCT AGGATCCCGAGAACCCAAAC3'

[0118] AbMYB11-Sense-R:

[0119] 5'CTGTTGTCGGAGGTTAGGAACTG3'

[0120] AbMYB11-Antisense-F:

[0121] 5'AACCTCCGACAACAGCTTGTTCCATATCGTTCGATTCC3'

[0122] AbMYB11-Antisense-R:

[0123] 5'CGGGGAAATTCGAGCT GGTCACCAGGATCCCGAGAACCCAAAC3'

[0124] PCR amplification was performed with the following procedure: 95°C for 5 min, 30 cycles (95°C for 30 sec, 55°C for 30 sec, and 72°C for 20 sec), 72°C for 10 min, and 4°C for ∞. After the reaction, the PCR amplification products were detected by 0.8% agarose gel electrophoresis. The agarose gel detection results showed that PCR products with the expected fragment sizes (181 bp and 267 bp) were obtained. The PCR products with the correct band sizes were recovered using a gel recovery kit. AbMYB11-Sense and AbMYB11-Antisense (see Figure 5 A).

[0125] 2. Construction of the recombinant vector pCAMBIA1303-AbMYB11-RNAi

[0126] The specific recombination method is the same as that shown in 2 of Example 1. Figure 5 B, Sequencing comparison results are shown in Figure 5 C, the results showed that the consistency was 100%. The plasmid with correct sequencing was named pCAMBIA1303-AbMYB11-RNAi, preserved and used for subsequent experiments.

[0127] Example 3: Screening of pseudo-transformants

[0128] 1. Chemical transformation of recombinant vector into Agrobacterium

[0129] According to the instructions for Agrobacterium competent cells, pCAMBIA1303-AbMYB11-OE, pCAMBIA1303-AbMYB11-RNAi and pCAMBIA1303 (control group) were transformed into Agrobacterium EHA105, respectively.

[0130] 2. Transformation of foreign genes into Agaricus bisporus

[0131] Pick a single colony of Agrobacterium and inoculate it into 10 mL of basic culture medium. Cultivate at 28°C and 220 rpm until OD 600 When the concentration reaches 0.6-0.8, the bacterial solution is transferred to 50 mL to collect the bacteria, and the bacteria are resuspended in 20 mL of induction medium. The bacterial solution is shaken and cultured for 3-6 hours to induce the expression of the VIR region. After selecting mushroom fruiting bodies with intact membranes and cleaning the surface, the gill tissue is collected. The gill tissue is added to the induced Agrobacterium, vacuum infiltration is performed, and the tissue block is transferred to the co-culture medium and cultured at 21°C for 4 days.

[0132] 3. Transformant Screening

[0133] The transformed tissue blocks were transferred to the primary screening MMP medium and cultured at 24°C for about 2 weeks; the newly grown mycelium was picked and transplanted to the secondary screening MMP medium and cultured at 24°C for about 2 weeks. The mycelium of Agaricus bisporus was sensitive to hygromycin, and low concentrations of hygromycin could inhibit the growth of mycelium. The pCAMBIA1303 vector contained the corresponding hygromycin resistance gene, so the mycelium of Agaricus bisporus that grew normally after the primary and secondary screening was the successfully transformed transformant mycelium, see Figure 6 After the screening, three AbMYB11 overexpression strains, three AbMYB11 silenced strains, and one wild-type strain with good growth were transferred to PDA medium for culture and preservation. The primary screening MMP medium and the secondary screening MMP medium were prepared according to the above-mentioned preparation method.

[0134] Example 4: Determination of gene expression

[0135] The mycelia of each strain cultured on PDA medium were collected, and RNA was extracted and reverse transcribed to measure the gene expression level of AbMYB11.

[0136] 1. RNA Extraction

[0137] Weigh 0.2g of sample, grind with liquid nitrogen, and immediately transfer to a 2mL centrifuge tube, add 1mL Trizol extract and 20μL β-mercaptoethanol, shake vigorously, and let stand for 10min to lyse cells. Add 480μL chloroform: isoamyl alcohol (24:1, v / v, volume ratio), gently mix, and it will be milky at this time. Then add 72μL anhydrous ethanol, gently mix and let stand for 3min to completely precipitate the protein. Centrifuge at 4℃, 12000rpm for 15min. Pipette 600μL supernatant and transfer to a new 2mL centrifuge tube, add 1.2mL anhydrous ethanol and 120μL NaAC-HAC buffer solution, gently mix, and let stand at -20℃ for 30min. Centrifuge at 4℃, 12000rpm for 15min, discard the supernatant, and pectin precipitation can be seen at this time. Then dissolve the precipitate with 400μL 75% ethanol and transfer to a new 1.5mL centrifuge tube. Centrifuge at 4°C, 12,000 rpm for 15 min, discard the supernatant, and after the ethanol evaporates, add 21 μL of DEPC to dissolve the precipitate, which is the crude RNA. Use NanoDrop instrument and nucleic acid gel electrophoresis to detect the concentration and purity of the crude RNA.

[0138] 2. cDNA Synthesis and gDNA Removal

[0139] RNA was reversed using a reverse transcriptase kit to obtain cDNA, which was then stored in a -80°C refrigerator.

[0140] 3. Determination of AbMYB11 gene expression

[0141] The results are as follows Figure 7 As shown, after real-time fluorescence quantitative determination of AbMYB11 gene expression level, the results showed that the expression level of AbMYB11 gene in the overexpression strain OE-AbMYB11-71 increased to 3.39 times that of the wild-type control; OE-AbMYB11-91 increased to 2.81 times that of the wild-type; OE-AbMYB11-78 was the strain with the largest expression increase, which was 5.35 times that of the wild-type control. The expression level of AbMYB11 gene in the silenced strain RNAi-AbMYB11-95 was reduced to 5% of the wild-type control; RNAi-AbMYB11-96 was reduced to 7% of the wild-type; RNAi-AbMYB11-97 was the strain with the largest expression decrease, which was 4% of the wild-type control.

[0142] Example 5, strain preparation

[0143] OE-AbMYB11-78, AbMYB11-OE-91 and silent strains RNAi-AbMYB11-96 and RNAi-AbMYB11-97, which have been verified by gene expression level, were selected and inoculated into PDA medium and cultured at a constant temperature of 24-25°C.

[0144] Prepare wheat grain culture medium according to the above method, inoculate quickly with aseptic operation, observe the mycelium growth from the bottle surface, judge the culture time, and then determine the sowing time.

[0145] Growth conditions such as Figure 8 Fig. 9 As shown in the figure, the hyphae of Agaricus bisporus in all media showed a typical white fluffy appearance. However, there were significant differences in the density of hyphae with different AbMYB11 gene expression levels. The strains with overexpression of AbMYB11 gene significantly promoted the branching of hyphae, thereby increasing the density of hyphae. The hyphae with overexpression of AbMYB11 gene showed slightly thicker mycelium than those with silenced hyphae, which may be due to the formation of a denser hyphal network during the growth of overexpressed hyphae. In addition, the three-dimensional sense of the hyphae with overexpression of AbMYB11 gene was more obvious, which may be due to the three-dimensional structure formed by the stacking of hyphae during the growth process. The formation of this structure is related to the key role of AbMYB11 gene in regulating hyphal growth and morphological construction. Morphologically, the network structure of overexpressed hyphae was more complex, which shows that the function of AbMYB11 gene in regulating the growth direction and branching pattern of hyphae is related. AbMYB11 gene plays an important role in the growth and development of Agaricus bisporus.

[0146] Embodiment 6, mushroom production test

[0147] The planting areas are randomly set on the mushroom house bed frame, with each area of ​​1m 2, managed according to conventional cultivation methods. The growth of different strains was observed regularly and photographed for record. Different genotypes were expressed in the strains and ultimately judged in the mushroom entity. For the convenience of recording, the present invention uses random letters and numbers for numbering, but the names of the genotypes correspond one to one. For the overexpression gene phenotype, strains numbered HF41 (OE-AbMYB11-78) and JS59 (OE-AbMYB11-91) were selected, and strains numbered BK58 (RNAi-AbMYB11-96) and JD97 (RNAi-AbMYB11-97) were selected for the silencing gene phenotype. The wild-type strain YH26 (pCAMBIA1303) was used as the control for subsequent breeding.

[0148] The fruiting test of overexpressed and silenced Agaricus bisporus strains, Agaricus bisporus sowing and 45-47 days after sowing, see Fig.10 , and the yield statistics after fruiting can be found in Fig.11 The results showed that Agaricus bisporus strains with different AbMYB11 gene expression levels showed different growth characteristics in the mushroom production experiment. The wild-type strain grew slowly; the strain with overexpression of AbMYB11 grew faster and had stronger adaptability to the environment; compared with the wild-type, the overexpression strain grew more luxuriantly in the soil, with a significantly increased number of mushrooms, showing higher growth vitality and faster growth rate. The AbMYB11-silenced strain showed a slow growth state and lower yield.

[0149] Further, the growth of Agaricus bisporus from the 46th day of sowing and the 47th day of sowing, i.e. the harvest period, was analyzed. Fig.12 . The results showed that there were significant differences in the distribution of mushroom size among different strains. Under the same growth environment and at the same time point, the growth rate of the overexpressed strain was significantly higher than that of the wild-type strain, and the silent strain grew the slowest. At the mid-harvest time, i.e., the 47th day after sowing, only 12.69% of the wild-type strains in the control group YH26 had a mushroom size of about 3-4 cm, and about 58.85% had a mushroom size of ≤1 cm. In the AbMYB11 overexpressed HF41 strain, 31.67% of the mushrooms were about 3-4 cm in size, and only 26.11% of the mushrooms were ≤1 cm. However, in the AbMYB11 silenced JD97 strain, only 9.49% of the mushrooms were about 3-4 cm in size, but 69.76% of the mushrooms were ≤1 cm. This shows that the AbMYB11 overexpressed strain can significantly increase the growth rate of Agaricus bisporus. The Agaricus bisporus strains with AbMYB11 overexpression and silence showed significant differences in the fruiting test and yield size statistics. The AbMYB11 gene has a significant effect on the growth of Agaricus bisporus. Overexpression of AbMYB11 can promote its growth-related metabolic pathways or signal transduction.

[0150] Example 7, Anti-browning experiment and disease resistance experiment

[0151] Harvest the fruiting bodies of Agaricus bisporus. Select fresh Agaricus bisporus with intact, white fruiting bodies, no mechanical damage, no disease spots, uniform size, and a diameter of 3-4 cm. Before processing, cut off the stems (retain about 0.5 cm) and place them neatly.

[0152] 1. Anti-browning experiment

[0153] Each species of Agaricus bisporus was scratched and the browning was observed within 5 minutes, 10 minutes, and 30 minutes. These scratches are to simulate the damage that may be encountered during the natural growth process, so as to better observe its ability to resist browning. Fig.13 The results showed that in this anti-browning ability experiment, Agaricus bisporus strains with different AbMYB11 gene expression levels showed obvious differences in browning. In the control group YH26, at 5 minutes, the scratch area began to show slight browning. At 10 minutes, the degree of browning increased and the color became darker. At 30 minutes, the degree of browning was significant, and the color of the scratch area was significantly darker. Compared with the control group, the AbMYB11 overexpression strains HF41 had a lighter browning degree than YH26 at 5 minutes. At 10 minutes, the degree of browning was still light, and the color change was not obvious. At 30 minutes, the degree of browning was significantly lighter than YH26, and the color change of the scratch area was small. JS59 was similar to HF41, with a lighter degree of browning at 5 minutes and 10 minutes. At 30 minutes, the degree of browning was still light, showing good anti-browning ability. Compared with the control group, the AbMYB11 silenced strains BK58 had a browning degree similar to YH26 at 5 minutes. At 10 minutes, the degree of browning increased and the color became darker than YH26. At 30 minutes, the degree of browning was severe, and the color of the scratched area was significantly darker, which was significantly browned compared with YH26. JD97 showed similar results to BK58, with a darker color at the scratch and a relatively large range of browning. These strains are relatively weak in their ability to resist browning. Agaricus bisporus strains with strong resistance to browning have broad application prospects in the edible fungi industry. They can better maintain the quality and taste of mushrooms, extend the shelf life, and meet consumers' demand for high-quality edible fungi.

[0154] 2. Disease resistance experiment

[0155] P. tolaasii (No.: CGMCC 1.2960) was purchased from China General Microbiological Culture Collection Center. A single colony was selected and cultured at 28°C with shaking until the logarithmic phase. The culture was expanded at a ratio of 1:10. The cells were collected by centrifugation until the logarithmic phase. The bacterial suspension was finally diluted to a concentration of 6 × 10 9CFU / mL. The fruiting bodies of Agaricus bisporus of each strain were randomly divided into two groups, one group was inoculated and the other group was treated with water as a control, and stored at 4°C. Agaricus bisporus began to develop disease at 24h. The disease resistance of Agaricus bisporus overexpressing AbMYB11 was significantly higher than that of the AbMYB11 silenced mushrooms. The disease situation is shown in Fig.14 The incidence rate is Fig.15 The results showed that after inoculation, the YH26 strain as the control group showed obvious disease symptoms within 36 hours after inoculation, including browning, tissue softening and loss of structural integrity, which provided a benchmark for evaluating the disease resistance of other genotypes.

[0156] Compared with the control group, the AbMYB11 overexpression strains showed that at 24h, the disease symptoms of HF41 were lighter than those of YH26, showing a certain degree of disease resistance. At 36h, the disease developed slowly and the degree of browning was mild. At 48h, although the disease developed, it was still mild, showing better disease resistance than YH26. JS59 showed similar disease resistance to HF41, indicating that the overexpression of the AbMYB11 gene was associated with enhanced disease resistance and could reduce the incidence of brown spot disease by about 20% during storage. Compared with the control group, the AbMYB11 silenced strains showed that at 24h, the disease symptoms of BK58 were similar to those of YH26, showing poor disease resistance. At 36h, the disease developed rapidly and the degree of browning was severe. At 48h, the disease symptoms of BK58 were very serious, with an incidence rate of nearly 100%. The disease symptoms of JD97 were similar to those of BK58, and the disease resistance was poor. This may mean that silencing of the AbMYB11 gene reduces the disease resistance of A. bisporus. This suggests that silencing of the AbMYB11 gene generally reduces the disease resistance of A. bisporus. Overexpression of the AbMYB11 gene is positively correlated with disease resistance in A. bisporus, while silencing of the gene is negatively correlated with disease resistance. Agaricus bisporus strains with enhanced disease resistance may have higher value in commercial production because they are better able to resist diseases and reduce post-harvest losses.

[0157] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. An application of the AbMYB11 gene in improving the yield of Agaricus bisporus, wherein the AbMYB11 gene has an accession number of XM_006459610.1 in the NCBI database and is marked as a hypothetical protein in the NCBI database.

2. An application of the AbMYB11 gene in promoting growth, resisting browning, and enhancing disease resistance of Agaricus bisporus. The sequence of the AbMYB11 gene has an accession number of XM_006459610.1 in the NCBI database and is marked as a hypothetical protein in the NCBI database.

3. An Agaricus bisporus AbMYB11 overexpression vector that promotes high yield, growth, browning resistance and disease resistance, characterized in that: The overexpression vector is constructed by connecting AbMYB11 with the pCAMBIA1303 vector to form a complete plasmid, and then performing restriction enzyme digestion verification and sequencing verification to obtain a correct plasmid; The accession number of the sequence of the AbMYB11 gene in the NCBI database is: XM_006459610.1, and it is marked as a hypothetical protein in the NCBI database.

4. Use of the AbMYB11 overexpression vector as described in claim 3 in promoting growth, resisting browning, and enhancing disease resistance of Agaricus bisporus.

5. A Agaricus bisporus strain comprising the AbMYB11 overexpression vector as claimed in claim 3, which has high yield, growth promotion, browning resistance and strong disease resistance.

6. The method for constructing Agaricus bisporus strains according to claim 5, characterized in that: During the construction, Agrobacterium-mediated transformation of foreign genes into Agaricus bisporus was used.

7. The construction method according to claim 6, characterized in that: The steps include: Construction of AbMYB11 overexpression vector: First, the pCAMBIA1303 vector was analyzed, and the CaMV35S promoter was replaced with the AbGPD promoter, named pCAMBIA1303, to obtain the required empty vector; then the AbMYB11 gene was overexpressed and then connected with the empty vector, and after enzyme digestion verification and sequencing analysis were correct, pCAMBIA1303-AbMYB11-OE, i.e., the AbMYB11 overexpression vector, was obtained; The connected plasmid was transferred into Agrobacterium and used to infect Agaricus bisporus, and then screened by resistance screening and AbMYB11 gene expression determination; The target strains were selected for fruiting test, and the anti-browning ability and disease resistance of the grown Agaricus bisporus fruiting bodies were tested. Finally, the target strains containing the overexpressed AbMYB11 gene and growing well were preserved to obtain the Agaricus bisporus strains.

8. The construction method according to claim 7, characterized in that: The screening includes two steps: primary screening and secondary screening, wherein the strains with better mycelium growth in a culture medium containing hygromycin are screened out as target strains; RNA of the target strains is extracted to determine the expression amount of the AbMYB11 gene.

9. The construction method according to claim 8, characterized in that: The two steps of primary screening and secondary screening are as follows: the transformed tissue blocks are transferred to the primary screening MMP medium and cultured at 24°C for 2 weeks; the newly grown mycelium is picked and transplanted to the secondary screening MMP medium and cultured at 24°C for 2 weeks; The formula of the initial screening MMP culture medium is as follows: 10.0 g maltextract, 5.0 g mycological peptone, and 2.1 g MOPS, 3-(N-morpholino)propanesulfonic acid, are weighed and fully dissolved with distilled water, the pH is adjusted to 7.0 with 1 M KOH, and the volume is fixed to 1 L; the final concentrations of antibiotics are: 30 μg / mL hygromycin B, 200 μM cefotaxime, 20 μg / mL rifampicin, and 50 μg / mL kanamycin and ampicillin; In the following examples, the formula of the rescreened MMP medium is as follows: 10.0 g maltextract, i.e. malt extract, 5.0 g mycological peptone, i.e., 2.1 g MOPS, i.e., 3-(N-morpholino)propanesulfonic acid, are weighed and fully dissolved with distilled water, the pH is adjusted to 7.0 with 1 M KOH, and the volume is fixed to 1 L; the final concentration of antibiotics is: 50 μg / mL hygromycin B, 17 μg / mL tetracycline hydrochloride, 50 μg / mL kanamycin and ampicillin.

Images