Strawberry mottle virus positive control sequence screening method and application

Abstract

The invention discloses a positive control sequence screening method of strawberry mottle virus. The method comprises the following steps: S1, preparing a strawberry material; s2, sampling: collecting a positive control sample and a negative control sample; s3, RNA extraction and sequencing: extracting RNA by adopting a kit, detecting the RNA, and performing RNA sequencing; and S4, preparing RNA positive control plasmids. The virus sequence is deeply analyzed and sequenced by adopting a genomics method, a positive control sample is designed and developed, and the detoxification effect of strawberry seedlings can be accurately evaluated. Compared with a traditional strawberry seedling phenotype detection method, the method has the advantages that the virus detection is rapid and efficient, the detection time is shortened, and the false detection rate is reduced. Technical guarantee is provided for healthy development of the strawberry industry, the application range is wide, the blank of domestic strawberry virus-free seedling detection standards is filled, and the method has remarkable popularization and application potential in the global strawberry planting market and is wide in application prospect.

Description

Technical Field

[0001] The invention relates to A01H, to the field of plant regeneration through tissue culture technology, and in particular to a positive control sequence screening method for strawberry mottle virus and application thereof. Background Art

[0002] Strawberry is widely planted in my country, and my country is a famous strawberry planting base. However, there is a common problem in domestic strawberry varieties. Strawberry seedlings do not achieve true virus-free. Almost all strawberry seedlings carry one or two viruses, including Strawberry Mottle Virus 1 (SMoV1), Strawberry Mild Yellow Edge Virus (SMYEV), Strawberry Mottle Virus 2 (SMoV2), and Strawberry Crinkle Virus (SCV). The problem of viral contamination is prevalent in existing strawberry seedlings, and the inspection standard for strawberry virus-free is immature. Existing detection reagents usually contain only negative controls and do not contain positive controls, which causes the virus-free effect of strawberry seedlings to be unable to be verified. Therefore, it is crucial to screen a positive control sequence of strawberry mottle virus to achieve virus-free detection of strawberry virus.

[0003] Chinese invention patent CN117143965A discloses a strawberry virus-host species multi-target gene chip detection and identification method. The present invention uses a polystyrene microplate as a chip substrate through specific primer and probe design to establish a strawberry virus-host species multi-target gene chip detection and identification technology to meet the needs of virus monitoring and quality control in strawberry seedling production; when detecting the virus, the strawberry species identity information is checked to provide support for improving the efficiency of strawberry seedling quality and safety supervision. However, the fragment sequence is long and the extraction steps are cumbersome. Chinese invention patent CN107090047B discloses a method for preparing a tandem antigen epitope peptide and a chicken yolk antibody for simultaneously detecting five strawberry viruses. The tandem epitope peptide has immunogenicity and can detect five strawberry viruses at the same time, greatly reducing costs, and is fast, specific, and sensitive, providing technical guarantees for the stable development of the strawberry planting industry. However, the preparation steps of the detection method are cumbersome and the process is complicated. Summary of the invention

[0004] In order to develop a positive control sequence for strawberry mottle virus and realize rapid and accurate detoxification detection of strawberry virus, the first aspect of the present invention provides a positive control sequence screening method for strawberry mottle virus, comprising the following steps:

[0005] S1 prepares strawberry materials;

[0006] S2 sampling: collect positive control samples and negative control samples;

[0007] S3 RNA extraction and sequencing: RNA was extracted and detected using a kit and RNA sequencing was performed;

[0008] S4 prepares RNA positive control plasmid.

[0009] As a preferred embodiment, sources of the strawberry materials include strawberry varieties from Dandong, Liaoning, Yantai, Shandong, Nanjing, Jiangsu, Ningbo, Zhejiang, and Kunming, Yunnan.

[0010] As a preferred embodiment, the method for preparing the strawberry material comprises the following specific steps:

[0011] The collected strawberry seedlings of different varieties were planted in inorganic substrates using cultivation bags under artificial climate conditions to determine whether the seedlings themselves carry the virus and avoid secondary infection, and to screen plants with obvious strawberry virus phenotypes for subsequent analysis.

[0012] As a preferred implementation, the specific method of sampling in step S2 is as follows:

[0013] Take the fully mature tissue of the plant with obvious strawberry virus phenotype in step S1 as a positive control;

[0014] The fully mature tissue of the plants grown in the same environment in step S1 that do not show the strawberry virus phenotype is taken as a negative control.

[0015] As a preferred embodiment, the tissue includes at least one of leaves, shortened stems, floral organs, and roots.

[0016] The method for detecting RNA includes detecting the integrity of RNA and detecting the purity of RNA;

[0017] The specific steps for testing RNA integrity are as follows:

[0018] Take 3 μL of the above RNA sample, add 2 μL of bromophenol blue, mix thoroughly and then load the sample for electrophoresis. If the electrophoresis results show two clear bands, one of which is about twice as wide as the other, corresponding to 28S rRNA and 18S rRNA, respectively, it indicates that the RNA extraction quality is good; if the bands are fuzzy or unclear, it means that the RNA extraction quality does not meet the standard and RNA extraction needs to be repeated.

[0019] The specific steps for testing the purity of RNA are as follows:

[0020] Take 1 μL RNA sample and drop it onto the probe of the micro-volume UV spectrophotometer. If the displayed spectrum shows a single peak and the A260 / A280 value is between 1.8 and 2.0, it indicates that the RNA is of high purity; if the A260 / A280 value is greater than 2, it indicates that the RNA may contain ethanol that has not evaporated completely; if the A260 / A280 value is less than 1.8, it indicates that the sample may contain proteins or phenols and the RNA sample has been contaminated.

[0021] The specific steps of RNA sequencing are as follows:

[0022] The RNA samples were sent to Novogene for small RNA sequencing. The raw data generated by the sequencing was first processed and cleaned, and then compared with multiple bioinformatics databases to filter out sequences that matched known genes, non-coding RNAs, and repetitive sequences. After data processing, the heat map distribution analysis was used to further identify regions that may be related to the virus. These regions were assembled to generate longer contig sequences (i.e., spliced ​​continuous sequence fragments), which were eventually established as fragments of the strawberry virus for subsequent research and verification.

[0023] As a preferred embodiment, the bioinformatics database includes an mRNA database, an RFam database (for alignment of non-coding RNA families) and a Repbase database.

[0024] As a preferred embodiment, the specific steps of the RNA positive control plasmid preparation method are as follows:

[0025] 4.1 The strawberry virus fragment obtained in the previous step was used to design a cDNA sequence template containing a subtype of the virus and synthesize a positive control plasmid;

[0026] 4.2 Design virus detection RT-PCR primers, and retest the plants with typical phenotypes and control plants in the above experiment to determine the effectiveness and specificity of the positive control plasmid and virus detection primers.

[0027] As a preferred embodiment, the base sequence of the positive control plasmid of the strawberry mottle virus is as follows:

[0028] GA Y TATGT K CCTACTGAGGTTTTCCCTGATGAGCCTCCAGTGTC YS AA D TTCTTCCCGAA Y ATCCAAA R GCTGG.

[0029] As a preferred embodiment, the base sequence of the RT-PCR primer of the strawberry mottle virus is as follows:

[0030] SMoV1-FQ:GA T TATGT G CCTACTGAGGTTTTCCC SMoV1-RQ:CCAGC Y TTTGGAT R TTCGGGA.

[0031] A second aspect of the present invention provides an application of a positive control sequence screening method for strawberry mottle virus, comprising the following steps:

[0032] M1 Sample collection: Collect tissue samples from the strawberry plants to be tested, keep them sterile, store them stably, and avoid sample degradation;

[0033] M2 RNA extraction: Total RNA was extracted from strawberry plant tissue using an RNA extraction kit;

[0034] M3 reverse transcription synthesis of cDNA: reverse transcription of total RNA to generate cDNA for detection and standby use;

[0035] M4 used RT-PCR primers of strawberry mottle virus to amplify cDNA by PCR, and conducted double control experiments with negative control samples and positive control samples;

[0036] M5 separated the PCR products by agarose gel electrophoresis and stained them with nucleic acid dyes, observed the electrophoresis results, compared the amplified bands of the sample PCR products with those of the positive control sequences, and confirmed whether the strawberry samples carried the virus.

[0037] As a preferred embodiment, the nucleic acid dye includes ethidium bromide or double-stranded chimeric fluorescent dye (SYBR Green). The test result: if a band matching the positive control is shown, it is the virus carrier, and the negative sample does not show the corresponding band, the experiment is valid.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] (1) The positive control sequence screening method for strawberry mottle virus described in the present invention uses a genomics method to deeply analyze and sequence the virus sequence, designs and develops a positive control sample, and can accurately evaluate the detoxification effect of strawberry seedlings.

[0040] (2) The positive control sequence screening method for strawberry mottle virus of the present invention can be used for subsequent virus detection to ensure that the virus-free status of seedlings can be accurately judged through the positive control during virus-free detection, thereby distinguishing true virus-free seedlings from false virus-free seedlings.

[0041] (3) Compared with the traditional strawberry seedling phenotypic detection method, the positive control sequence screening method for strawberry mottle virus of the present invention is fast and efficient in virus detection, shortens the detection time, and reduces the false detection rate.

[0042] (4) The positive control sequence screening method for strawberry mottle virus described in the present invention is applied to virus detection and can be applicable to virus detection of different strawberry varieties, especially to large-scale strawberry planting areas, providing technical guarantee for the healthy development of the strawberry industry and having a wide range of applications.

[0043] (5) The positive control sequence of the strawberry mottle virus described in the present invention is applied to strawberry virus detection, filling the gap in the domestic strawberry virus-free seedling detection standard, and has significant promotion and application potential in the global strawberry planting market, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is the gel electrophoresis image of strawberry mild mottle virus.

[0045] Figure 2 This is the gel electrophoresis image of the negative control sample. DETAILED DESCRIPTION

[0046] Example

[0047] A method for screening a positive control sequence of strawberry mottle virus comprises the following steps:

[0048] S1 prepares strawberry materials;

[0049] S2 sampling: collect positive control samples and negative control samples;

[0050] S3 RNA extraction and sequencing: RNA was extracted and detected using a kit and RNA sequencing was performed;

[0051] S4 Preparation of RNA positive control plasmid.

[0052] The sources of the strawberry materials include strawberry varieties from Dandong, Liaoning, Yantai, Shandong, Nanjing, Jiangsu, Ningbo, Zhejiang, and Kunming, Yunnan.

[0053] The method for preparing the strawberry material comprises the following specific steps:

[0054] The collected strawberry seedlings of different varieties were planted in inorganic substrates using cultivation bags under artificial climate conditions to determine whether the seedlings themselves carry the virus and avoid secondary infection. Plants with obvious strawberry virus phenotypes were screened for subsequent analysis.

[0055] The specific method of sampling in step S2 is as follows:

[0056] Take fully mature tissues (leaves, shortened stems, flower organs, roots) from the plants with obvious strawberry virus phenotype in step S1 as positive controls;

[0057] Fully mature tissues (leaves, shortened stems, flower organs, roots) of the plants grown in the same environment in step S1 and not showing the strawberry virus phenotype were taken as negative controls.

[0058] The specific steps of the method for extracting RNA with the kit are as follows:

[0059] The kit is the EASYspin plant RNA rapid extraction kit from Adelaide Biotechnology Co., Ltd.

[0060] (1) Grinding samples using liquid nitrogen grinding method: After freezing the samples in liquid nitrogen, use a grinder to grind them. Plant tissues such as stem segments become brittle and easy to break under the low temperature of liquid nitrogen. When grinding with a grinder, the samples can be quickly broken and fine particles can be obtained, which is convenient for subsequent experimental processing;

[0061] (2) Take out 500 μL of lysate RLT, pour it into a 1.5 mL centrifuge tube, add 50 μL of PLANTaid, mix well and set aside;

[0062] (3) After grinding the plant tissue into fine powder in liquid nitrogen, 50 mg of the fine powder was transferred into the above centrifuge tube containing RLT and PLANTaid, and immediately shaken vigorously by hand for 20 seconds to fully lyse;

[0063] (4) Use a pipette tip to mix and swirl to help lysis, which can shear DNA, reduce viscosity and increase yield;

[0064] (5) Centrifuge the lysate at 13,000 rpm for 5 minutes to precipitate insoluble fragments and PLANTaid bound to polysaccharides and polyphenols;

[0065] (6) Transfer the supernatant of the lysate to a new centrifuge tube and add anhydrous ethanol equal to half the volume of the supernatant. If precipitation occurs, mix it immediately by pipetting. Centrifugation is not required.

[0066] (7) Add the mixture to the adsorption column RA in portions (less than 720 μL each time), place the adsorption column RA in a collection tube, and centrifuge at 13,000 rpm for 2 min. Discard the waste liquid to ensure that all the liquid passes through the filter membrane after centrifugation without residue.

[0067] (8) Add 700 μL of deproteinized solution RW1, let it stand at room temperature for 1 min, then centrifuge at 13000 rpm for 30 s, and discard the waste liquid;

[0068] (9) Add 500 μL of rinse solution RW and centrifuge at 13,000 rpm for 30 s. Discard the waste liquid and add 500 μL of rinse solution RW again. Repeat the above steps.

[0069] (10) Place the adsorption column RA back into the empty collection tube and centrifuge at 13,000 rpm for 3 min to remove the rinse solution to prevent the residual ethanol in the rinse solution from inhibiting downstream reactions;

[0070] (11) Take out the adsorption column RA from the collection tube and place it in an RNase-free centrifuge tube. According to the expected RNA yield, add 50 μL of RNase-free water to the middle part of the adsorption membrane, then place it at room temperature for 1 min, and then centrifuge at 12000 rpm for 1 min.

[0071] (12) If the expected RNA yield is greater than 30 μg, add 50 μL of RNase-free water, repeat step (7), and combine the two wash solutions to obtain the extracted RNA.

[0072] (13) The protein was further tested by agarose gel electrophoresis.

[0073] The method for detecting RNA includes detecting the integrity of RNA and detecting the purity of RNA;

[0074] The specific steps for testing RNA integrity are as follows:

[0075] Take 3 μL of the above RNA sample, add 2 μL of bromophenol blue, mix thoroughly and then load the sample for electrophoresis. If the electrophoresis results show two clear bands, one of which is about twice as wide as the other, corresponding to 28S rRNA and 18S rRNA, respectively, it indicates that the RNA extraction quality is good; if the bands are fuzzy or unclear, it means that the RNA extraction quality does not meet the standard and RNA extraction needs to be repeated.

[0076] The specific steps for testing the purity of RNA are as follows:

[0077] Take 1 μL RNA sample and drop it onto the probe of the micro-volume UV spectrophotometer. If the displayed spectrum shows a single peak and the A260 / A280 value is between 1.8 and 2.0, it indicates that the RNA is of high purity; if the A260 / A280 value is greater than 2, it indicates that the RNA may contain ethanol that has not evaporated completely; if the A260 / A280 value is less than 1.8, it indicates that the sample may contain proteins or phenols and the RNA sample has been contaminated.

[0078] The specific steps of RNA sequencing are as follows:

[0079] The RNA samples were sent to Novogene for small RNA sequencing. The raw data generated by the sequencing was first processed and cleaned, and then compared with multiple bioinformatics databases to filter out sequences that matched known genes, non-coding RNAs, and repetitive sequences. After data processing, the heat map distribution analysis was used to further identify regions that may be related to the virus. These regions were assembled to generate longer contig sequences (i.e., spliced ​​continuous sequence fragments), which were eventually established as fragments of the strawberry virus for subsequent research and verification.

[0080] The specific steps of the preparation method of the RNA positive control plasmid are as follows:

[0081] 4.1 Use the strawberry virus fragment obtained in the previous step to design a cDNA sequence template containing the subtype virus and synthesize a positive control plasmid

[0082] 4.2 Design virus detection RT-PCR primers, and retest the plants with typical phenotypes and control plants in the above experiment to determine the effectiveness and specificity of the positive control plasmid and virus detection primers.

[0083] The base sequence of the positive control plasmid of strawberry mottle virus is as follows:

[0084] GA Y TATGT K CCTACTGAGGTTTTCCCTGATGAGCCTCCAGTGTC YS AA D TTC

[0085] TTCCCGAA Y ATCCAAA R GCTGG

[0086] The underlined bases are designed for strawberry mottle virus subtypes.

[0087] The base sequences of the RT-PCR primers for strawberry mottle virus are as follows:

[0088] SMoV1-FQ:GA T TATGT G CCTACTGAGGTTTTCCC

[0089] SMoV1-RQ:CCAGC Y TTTGGAT R TTCGGGA

[0090] An application of a positive control sequence screening method for strawberry mottle virus comprises the following steps:

[0091] M1 Sample collection: Collect tissue samples from the strawberry plants to be tested, keep them sterile, store them stably, and avoid sample degradation;

[0092] M2 RNA extraction: Total RNA was extracted from strawberry plant tissue using an RNA extraction kit;

[0093] M3 reverse transcription synthesis of cDNA: reverse transcription of total RNA to generate cDNA for detection and standby use;

[0094] M4 used RT-PCR primers of strawberry mottle virus to amplify cDNA by PCR, and conducted double control experiments with negative control samples and positive control samples;

[0095] M5 separated the PCR products by agarose gel electrophoresis, stained them with nucleic acid dye (Ethidium Bromide), observed the electrophoresis results, compared the amplified bands of the sample PCR products with those of the positive control sequence, and confirmed whether the strawberry sample carried the virus. If a band matching the positive control was shown, it was carrying the virus, and a negative sample did not show the corresponding band.

[0096] The RNA extraction kit is the EASYspin plant RNA rapid extraction kit from Adelaide Biotechnology Co., Ltd.

Claims

1. A method for screening a positive control sequence for strawberry mottle virus, characterized in that: The following steps are involved: S1 prepares strawberry materials; S2 sampling: collect positive control samples and negative control samples; S3 RNA extraction and sequencing: RNA was extracted and detected using a kit and RNA sequencing was performed; S4 prepares RNA positive control plasmid.

2. The positive control sequence screening method for strawberry mottle virus according to claim 1, characterized in that: The sources of the strawberry materials include strawberry varieties from Dandong, Liaoning, Yantai, Shandong, Nanjing, Jiangsu, Ningbo, Zhejiang, and Kunming, Yunnan.

3. The positive control sequence screening method for strawberry mottle virus according to claim 1, characterized in that: The method for preparing the strawberry material comprises the following specific steps: The collected strawberry seedlings of different varieties were planted in inorganic substrates using cultivation bags under artificial climate conditions to determine whether the seedlings themselves carry the virus, avoid secondary infection, and screen plants with obvious strawberry virus phenotypes for subsequent analysis.

4. The positive control sequence screening method for strawberry mottle virus according to claim 1, characterized in that: The specific method of sampling in step S2 is as follows: Take fully mature tissues of the plants with obvious strawberry virus phenotype in step S1 as positive controls; The fully mature tissue of the plants grown in the same environment in step S1 that do not show the strawberry virus phenotype is taken as a negative control.

5. The positive control sequence screening method for strawberry mottle virus according to claim 4, characterized in that: The tissue comprises at least one of leaves, shortened stems, floral organs and roots.

6. The positive control sequence screening method for strawberry mottle virus according to claim 1, characterized in that: The specific steps of the preparation method of the RNA positive control plasmid are as follows: 4.1 The strawberry virus fragment obtained in the previous step was used to design a cDNA sequence template containing a subtype of the virus and synthesize a positive control plasmid; 4.2 Design virus detection RT-PCR primers, and retest the plants with typical phenotypes and control plants in the above experiment to determine the effectiveness and specificity of the positive control plasmid and virus detection primers.

7. The method for screening a positive control sequence for strawberry mottle virus according to claim 6, characterized in that: The base sequence of the positive control plasmid of the strawberry mottle virus is as follows: GA Y TATGT K CCTACTGAGGTTTTCCCTGATGAGCCTCCAGTGTC YS AA D TTCTTCCCGAA Y ATCCAAA R GCTGG。 8. The method for screening a positive control sequence for strawberry mottle virus according to claim 6, characterized in that: The base sequence of the RT-PCR primer of the strawberry mottle virus is as follows: SMoV1-F-Q:GA T TATGT G CCTACTGAGGTTTTCCC SMoV1-R-Q:CCAGC Y TTTGGAT R TTCGGGA。 9. An application of the positive control sequence screening method for strawberry mottle virus according to any one of claims 1 to 8, characterized in that: The following steps are involved: M1 Sample collection: Collect tissue samples from the strawberry plants to be tested, keep them sterile, store them stably, and avoid sample degradation; M2 RNA extraction: Total RNA was extracted from strawberry plant tissue using an RNA extraction kit; M3 reverse transcription synthesis of cDNA: reverse transcription of total RNA to generate cDNA for detection and standby use; M4 used RT-PCR primers of strawberry mottle virus to amplify cDNA by PCR, and conducted double control experiments with negative control samples and positive control samples; M5 separated the PCR products by agarose gel electrophoresis and stained them with nucleic acid dyes, observed the electrophoresis results, compared the amplified bands of the sample PCR products with those of the positive control sequences, and confirmed whether the strawberry samples carried the virus.

10. The use of the positive control sequence screening method for strawberry mottle virus according to claim 9, characterized in that: The nucleic acid dye includes ethidium bromide or a double-stranded chimeric fluorescent dye; the test result: if a band matching the positive control is shown, it is the virus carrier, and the negative sample does not show the corresponding band, the experiment is valid.

Images